ID: 1029726303

View in Genome Browser
Species Human (GRCh38)
Location 7:102407831-102407853
Sequence GTAGCCCCGAGAGCTGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029726303_1029726304 0 Left 1029726303 7:102407831-102407853 CCTGCAGCAGCTCTCGGGGCTAC 0: 1
1: 0
2: 2
3: 24
4: 136
Right 1029726304 7:102407854-102407876 ATCCCTCCTCGATCTTGTCCAGG 0: 1
1: 0
2: 0
3: 4
4: 78
1029726303_1029726310 16 Left 1029726303 7:102407831-102407853 CCTGCAGCAGCTCTCGGGGCTAC 0: 1
1: 0
2: 2
3: 24
4: 136
Right 1029726310 7:102407870-102407892 GTCCAGGAGGGAAAATTGAGAGG 0: 1
1: 0
2: 1
3: 21
4: 208
1029726303_1029726307 3 Left 1029726303 7:102407831-102407853 CCTGCAGCAGCTCTCGGGGCTAC 0: 1
1: 0
2: 2
3: 24
4: 136
Right 1029726307 7:102407857-102407879 CCTCCTCGATCTTGTCCAGGAGG No data
1029726303_1029726308 4 Left 1029726303 7:102407831-102407853 CCTGCAGCAGCTCTCGGGGCTAC 0: 1
1: 0
2: 2
3: 24
4: 136
Right 1029726308 7:102407858-102407880 CTCCTCGATCTTGTCCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029726303 Original CRISPR GTAGCCCCGAGAGCTGCTGC AGG (reversed) Intronic
900415205 1:2531570-2531592 TTAGCCCCCAGAGCTGGGGCTGG + Intergenic
903240730 1:21981031-21981053 GTAGGTCCGGGAGCTCCTGCGGG - Exonic
903647100 1:24902308-24902330 GTCGCCCCCACTGCTGCTGCCGG + Exonic
905441772 1:38000543-38000565 GGAGCCCTGAGAGCTGCTGCTGG + Intronic
905704136 1:40041295-40041317 GTTGCCCCGCAGGCTGCTGCAGG + Intronic
906060288 1:42943999-42944021 GGAGCCCTGAGCTCTGCTGCAGG - Intronic
907884693 1:58582011-58582033 CTAACCCCCAGAGGTGCTGCAGG - Intergenic
912453967 1:109785626-109785648 GTGGCCCAGAGAGGAGCTGCAGG + Intergenic
917969063 1:180195699-180195721 CTACCCCAGAGGGCTGCTGCTGG + Intronic
1062787263 10:275648-275670 CTAGCACCGAGAGCCACTGCGGG + Exonic
1067048333 10:42998343-42998365 GAAGTCCCCAGATCTGCTGCTGG - Intergenic
1070389638 10:75958183-75958205 GCAGCCCCAAGGGCTGCTTCAGG + Intronic
1070687847 10:78502890-78502912 GTGGCCCCGAGAACTTCTGTGGG + Intergenic
1070744906 10:78927757-78927779 GCAGCACCCAGAGCTGCCGCGGG - Intergenic
1070750285 10:78960014-78960036 CCAGCCCCCAGAGCTGCTGTGGG - Intergenic
1073288311 10:102401279-102401301 GTGGCCCCGGAAGCTGCTTCGGG - Exonic
1073442272 10:103559216-103559238 TAAGCCCCCAGAGCTGCTGCCGG - Intronic
1075834866 10:125444632-125444654 GAAGGCCTGAGAGTTGCTGCTGG + Intergenic
1076110522 10:127856009-127856031 AGAGCCCCGAGACCTGCTCCTGG - Intergenic
1077021076 11:417413-417435 GTAGCCCCGGCAGCGGCAGCAGG + Intronic
1077227346 11:1444230-1444252 CTAGCCCCCACAGCTGCTGGGGG - Intronic
1079344180 11:19637577-19637599 GTAGCCCCGGCATCTGCTTCTGG + Intronic
1083940568 11:65893206-65893228 GGAGCGCCTAGAGCTGGTGCTGG - Exonic
1091931788 12:4402435-4402457 GGAGCCTTGAGAGCTGCTTCAGG + Intergenic
1092265638 12:6978326-6978348 GTGGCCCGGTGAGCTGCTGGTGG - Exonic
1092284842 12:7122747-7122769 GCAGCCCTCAGAGCTTCTGCTGG + Intergenic
1095481920 12:42644963-42644985 GTAGCCAGGAGAGCTACTTCTGG + Intergenic
1095498670 12:42812541-42812563 GGGGCCCAGAGTGCTGCTGCTGG - Intergenic
1096551878 12:52378358-52378380 GCCGCCCCGGGAGCTGCTGACGG + Exonic
1096593088 12:52675367-52675389 GTAGCCCCCACTGCTGCTTCCGG + Exonic
1097191004 12:57219665-57219687 CTAGGGCCCAGAGCTGCTGCCGG + Intronic
1101469928 12:104986580-104986602 GGAGCCCCGGGGACTGCTGCGGG + Intronic
1103144426 12:118582347-118582369 GCAGCCCCGAGGGCTGCTGGTGG + Intergenic
1103909546 12:124344748-124344770 GGAGCCCCCCGAGCTGCTGGCGG + Exonic
1104425220 12:128671154-128671176 GTAGCCCCCAAAGCAGCTACAGG - Intronic
1106405829 13:29471940-29471962 CCAGGCCCGAGAGATGCTGCAGG + Intronic
1106515051 13:30445857-30445879 ATAGCACCGACAGCTGCAGCTGG - Intergenic
1108196154 13:47997554-47997576 ATAGCCCCCACTGCTGCTGCTGG + Intronic
1110418111 13:75274174-75274196 GTAACCAAGAGAGCTACTGCGGG - Intergenic
1110452822 13:75656213-75656235 GTGGGCAAGAGAGCTGCTGCAGG - Intronic
1118763431 14:68894518-68894540 GTAGCCCCCACAGCTGCAGAAGG - Intronic
1121463763 14:94101379-94101401 GGACCCCCGCGTGCTGCTGCAGG + Intronic
1122890630 14:104730663-104730685 GTGGCCCCGAGAGGTGCTGCGGG + Intronic
1123215147 14:106802628-106802650 GTAGCCCCGCGCGCCCCTGCAGG + Intergenic
1124494062 15:30175771-30175793 GTCTCCCCGTGAGCTGCTTCAGG - Intergenic
1124749508 15:32362874-32362896 GTCTCCCCGTGAGCTGCTTCAGG + Intergenic
1127630883 15:60826512-60826534 GTAGCGCCTAGAACTGGTGCAGG - Intronic
1129658746 15:77541587-77541609 GTAGCCTGGAGAGCGGCTGTGGG + Intergenic
1131180258 15:90234238-90234260 GTGGCCCCGGCAGCGGCTGCGGG + Intronic
1132270406 15:100519320-100519342 ACAGCACCCAGAGCTGCTGCTGG - Intronic
1132849131 16:2016617-2016639 GTGGCCCGGGGAGCTTCTGCAGG - Intronic
1132943258 16:2518945-2518967 GCCGCCCCAAGAGCTGCTGCTGG + Intronic
1133757941 16:8776533-8776555 GTTGCCCCGGAGGCTGCTGCGGG - Intronic
1136029082 16:27489781-27489803 GTAGCCACCAGAGCTGCAGCAGG - Intronic
1137700571 16:50495071-50495093 GCAGCCCCAAGGGCTGCTGGAGG - Intergenic
1137712581 16:50576582-50576604 TTTGGCCTGAGAGCTGCTGCAGG + Intronic
1138102918 16:54268867-54268889 GTGGCCCAGTGAGCTGCGGCTGG - Intronic
1138352990 16:56356428-56356450 GCAGCCCCTGGAGCTCCTGCTGG + Intronic
1138529220 16:57625955-57625977 GTAGACCCCAGAGCCCCTGCTGG - Intronic
1139532641 16:67550274-67550296 GTAACCCCTAGAGCTGTTGGAGG - Intergenic
1140641428 16:76977835-76977857 GCAGCCCTGAGGGCTGCTGGTGG - Intergenic
1142170137 16:88617569-88617591 GCAGCCCAGACAGCTCCTGCGGG - Intronic
1142570861 17:873145-873167 GAAGCCCCAAGAGCTGCAGTTGG - Intronic
1142694819 17:1627980-1628002 GCAGCCCCGACCGCTGCCGCAGG + Intronic
1143874503 17:9981599-9981621 GAGGCCACCAGAGCTGCTGCTGG + Intronic
1146055701 17:29579931-29579953 GCAGCCCCGAGAGCATCAGCAGG - Intronic
1146061373 17:29609159-29609181 GCAGGACCGGGAGCTGCTGCTGG + Exonic
1146967507 17:37045419-37045441 GCAGCCACGAGTGCTGCTGCAGG - Intronic
1147887795 17:43696395-43696417 GTAGCCGCCACAGCTGATGCTGG + Intergenic
1151263905 17:72938927-72938949 GGAGCCCTTAGAGCAGCTGCTGG - Intronic
1151553423 17:74834893-74834915 GTAGCCCGGAGAGCAGAAGCGGG + Intronic
1151876528 17:76870319-76870341 GAGGCCCGGAGAGCTGGTGCAGG + Intronic
1152108507 17:78343985-78344007 GTGCCCCAGAGAGCTGCTCCGGG + Intergenic
1152645681 17:81467576-81467598 GTGGCCCCGGGTGCAGCTGCTGG - Intergenic
1154325386 18:13387351-13387373 GGAGCACAGAGAGCTGCGGCTGG + Exonic
1157685680 18:49640723-49640745 GTAGCCCAAAGAGCTGCCCCTGG + Intergenic
1159447978 18:68563997-68564019 GCAGACCAGAGAGCTTCTGCAGG + Intergenic
1162739498 19:12765986-12766008 GCAGCTCGGATAGCTGCTGCTGG + Exonic
1163417285 19:17194417-17194439 GTGGCCCTGAGAGATGCTTCTGG - Intronic
1167145857 19:47680616-47680638 GCAGGGCTGAGAGCTGCTGCGGG - Exonic
926035121 2:9630522-9630544 GGAGCCTCGAGAGCTGCGGAGGG + Exonic
928246309 2:29631487-29631509 GCAGCCCTGCCAGCTGCTGCAGG - Intronic
928380247 2:30811471-30811493 GAAGCCCCGAGAGTGTCTGCTGG + Intronic
931216246 2:60247639-60247661 GCAGCCCTGGGAGCTGCTGTTGG + Intergenic
934853114 2:97713643-97713665 GTGGGCCTCAGAGCTGCTGCTGG + Exonic
940184845 2:150972470-150972492 GCAGCCCCAAGGGCTGCTGGTGG + Intergenic
940754080 2:157661580-157661602 GTAGAATCGAGAGCTGCTTCAGG + Intergenic
944199028 2:197085736-197085758 GTAGCTCCAAGGGCTGCTGGTGG - Intronic
947564498 2:231185437-231185459 GTAGCCTCCAGAGCTAATGCTGG + Intergenic
947929101 2:233948614-233948636 GGAGACTGGAGAGCTGCTGCTGG + Intronic
948759796 2:240183550-240183572 GCAGCCCCGGGAGAGGCTGCGGG - Intergenic
1168829073 20:834442-834464 CCAGCCCCCAGAGCCGCTGCTGG + Intronic
1175570813 20:60020280-60020302 ATAGCCCTGTGGGCTGCTGCAGG - Intronic
1178002836 21:28182756-28182778 TTAGCCCAGAAAGCAGCTGCAGG + Intergenic
1179320356 21:40285491-40285513 GTGGCCCTGGGAGCTGCTGCAGG - Intronic
1180559212 22:16601924-16601946 GAAGCCCCGGGAGCAGCAGCAGG - Intergenic
1180706132 22:17811022-17811044 GTGGCACTGAGGGCTGCTGCAGG - Intronic
1180981044 22:19878151-19878173 GGAGCCCCCACAGCTGGTGCTGG - Exonic
1181307132 22:21923193-21923215 GGACCCCCAAGAGCTGCTGGAGG - Exonic
1182308482 22:29388187-29388209 GAAGCCCCAGGAGGTGCTGCGGG + Intronic
1182549607 22:31093732-31093754 GGAGCCCAGCGAGCTGCTCCTGG + Intronic
1184249004 22:43249707-43249729 GTAGCCCCGTGAGCTGCAGTGGG + Intronic
952252159 3:31665537-31665559 GTACCCCCAGGAGGTGCTGCTGG - Intronic
954217715 3:49133624-49133646 GTAGGCACGAGAAGTGCTGCGGG + Intergenic
956675008 3:71725247-71725269 GCAGCGCCGACAGCTGCTGCAGG + Exonic
960672244 3:120165146-120165168 GAAGCCATCAGAGCTGCTGCCGG - Intronic
961336062 3:126180400-126180422 GGAGCCCCCGGAGCTGCAGCCGG + Intronic
978778304 4:112523927-112523949 GTAACCCCGAGAGGGGCAGCAGG - Intergenic
985961459 5:3306226-3306248 GGATCCCCCAGAGCTGCTGTGGG - Intergenic
992910684 5:81393738-81393760 GGAGCCCAGAGAGCTTCTGCGGG - Intronic
994490526 5:100437794-100437816 GTTTCCCCAAGATCTGCTGCTGG + Intergenic
1001548652 5:172586614-172586636 GGAGACCAGAGAGCAGCTGCTGG - Intergenic
1002522312 5:179798602-179798624 GCAGGCCTGTGAGCTGCTGCAGG + Intronic
1003298988 6:4859748-4859770 GGAGCCAGGAGAGCTGGTGCTGG - Intronic
1003325305 6:5086004-5086026 GCAGCCCCCCGAGCTGCTCCAGG - Exonic
1004337994 6:14782101-14782123 GTAGCTCTGACACCTGCTGCAGG + Intergenic
1005841856 6:29748899-29748921 GCACCCCAGGGAGCTGCTGCTGG - Intergenic
1006058625 6:31403681-31403703 GCACCTCCGGGAGCTGCTGCTGG + Exonic
1006878851 6:37321693-37321715 GGAGCCCCCAGGGCTGGTGCAGG + Intronic
1009828286 6:68896974-68896996 GTAACCCCCAGAGGAGCTGCTGG - Intronic
1011807339 6:91086827-91086849 GAAGCCCAGAGAGCTTCAGCAGG + Intergenic
1016682775 6:146850260-146850282 GAAGGCCCGAGATTTGCTGCTGG - Intergenic
1018726429 6:166616419-166616441 GCAGGCATGAGAGCTGCTGCTGG - Intronic
1018935674 6:168272488-168272510 GATGCTCCGAGAGCTGCTCCTGG + Intergenic
1020002175 7:4762276-4762298 GTGGCCGCGACGGCTGCTGCTGG - Exonic
1023201794 7:37706104-37706126 GCAGGCCCGAGAGCTTCTGGAGG - Intronic
1023907070 7:44530735-44530757 ATAGCCCCCAGGGCTTCTGCAGG + Intronic
1025561977 7:62380681-62380703 GCAGCGCCGAGGGCTGCTCCTGG + Intergenic
1025966982 7:66282687-66282709 GAAGCCCAGAGAGCTGATGCGGG + Intronic
1025996433 7:66530255-66530277 ATAGCCCCCAGAAATGCTGCCGG + Intergenic
1026222290 7:68410731-68410753 GCAGCCCCGAGGGCCGCTGGTGG + Intergenic
1026282813 7:68936848-68936870 GGGGTCCCAAGAGCTGCTGCTGG - Intergenic
1027654814 7:80917665-80917687 GTAGCCACTAGAGCTCCTGTAGG - Intronic
1029672350 7:102042174-102042196 GTGGCTCCCAAAGCTGCTGCTGG + Intronic
1029726303 7:102407831-102407853 GTAGCCCCGAGAGCTGCTGCAGG - Intronic
1031052069 7:116954164-116954186 GGAGGCCCGAGGGCGGCTGCCGG + Intronic
1033577943 7:142704170-142704192 GTAGCCCTGAGGGCTGCTTGTGG - Intergenic
1034618037 7:152435911-152435933 GCAGCCCCGGGAGCAGCAGCAGG + Exonic
1035405670 7:158595546-158595568 GTAGGCCCGGGTGCTGCTGCAGG - Intergenic
1035566520 8:644772-644794 GGAGCCCCAAGACCTGCTGCAGG - Intronic
1036773854 8:11596740-11596762 GTGGGCCCAAGTGCTGCTGCCGG + Intergenic
1046563636 8:115870605-115870627 GTAGCCCTGAGAGCTATTACTGG + Intergenic
1046961716 8:120120604-120120626 GTAGCCTGGAGATTTGCTGCAGG - Intronic
1057429426 9:94980300-94980322 GCAGCCCCCAGAGCGGCTGCAGG + Intronic
1058011178 9:99979095-99979117 GTATCCTAGAGAGCTGCTGGAGG - Intergenic
1059218073 9:112585442-112585464 GGAGCCAGGAGAGTTGCTGCTGG + Intronic
1059334361 9:113559445-113559467 CTAGCCCAGAGGCCTGCTGCTGG - Intronic
1059730090 9:117048380-117048402 GTAGCACAGTGAGCTGCTTCAGG - Intronic
1060755352 9:126208469-126208491 GAAGCCCCAAGAGCTCCTGCAGG + Intergenic
1060987800 9:127829755-127829777 CTGGCCCCGAGAGGTGCTTCTGG - Exonic
1061892741 9:133631302-133631324 GCAGCCCTGAGTGCTGGTGCAGG + Intergenic
1062110933 9:134781794-134781816 GGAGCCCCGGGAGCTGGCGCTGG + Intronic
1198341675 X:135720143-135720165 GGAGCCCCAGGAGCTGCTGCTGG - Intronic
1198346323 X:135763218-135763240 GGAGCCCCAGGAGCTGCTGCTGG + Intronic
1198348229 X:135780503-135780525 GGAGCCCCAGGAGCTGCTGCTGG + Intergenic
1198350131 X:135797766-135797788 GGAGCCCCAGGAGCTGCTGCTGG + Intronic
1198352041 X:135815039-135815061 GGAGCCCCAGGAGCTGCTGCTGG + Intronic
1198353949 X:135832307-135832329 GGAGCCCCAGGAGCTGCTGCTGG + Intronic
1198355857 X:135849557-135849579 GGAGCCCCAGGAGCTGCTGCTGG + Intronic
1198357768 X:135866836-135866858 GGAGCCCCAGGAGCTGCTGCTGG + Intergenic
1198359686 X:135884118-135884140 GGAGCCCCAGGAGCTGCTGCTGG + Intronic
1198366540 X:135945896-135945918 GGAGCCCCAGGAGCTGCTGCTGG + Intergenic
1199854755 X:151751315-151751337 GTAGCACCTAGAGCAGCTACTGG + Intergenic