ID: 1029726307

View in Genome Browser
Species Human (GRCh38)
Location 7:102407857-102407879
Sequence CCTCCTCGATCTTGTCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029726303_1029726307 3 Left 1029726303 7:102407831-102407853 CCTGCAGCAGCTCTCGGGGCTAC 0: 1
1: 0
2: 2
3: 24
4: 136
Right 1029726307 7:102407857-102407879 CCTCCTCGATCTTGTCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029726307 Original CRISPR CCTCCTCGATCTTGTCCAGG AGG Intronic
No off target data available for this crispr