ID: 1029731612

View in Genome Browser
Species Human (GRCh38)
Location 7:102442121-102442143
Sequence AAACCTCTGCATAGGCCAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 1, 2: 1, 3: 7, 4: 140}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029731605_1029731612 -5 Left 1029731605 7:102442103-102442125 CCAAGGCCCCACCTCATAAAACC 0: 1
1: 2
2: 14
3: 82
4: 458
Right 1029731612 7:102442121-102442143 AAACCTCTGCATAGGCCAGGCGG 0: 1
1: 1
2: 1
3: 7
4: 140
1029731604_1029731612 3 Left 1029731604 7:102442095-102442117 CCAGTGATCCAAGGCCCCACCTC 0: 1
1: 0
2: 1
3: 19
4: 176
Right 1029731612 7:102442121-102442143 AAACCTCTGCATAGGCCAGGCGG 0: 1
1: 1
2: 1
3: 7
4: 140
1029731600_1029731612 18 Left 1029731600 7:102442080-102442102 CCCCAACACAGAGAACCAGTGAT 0: 1
1: 0
2: 1
3: 17
4: 223
Right 1029731612 7:102442121-102442143 AAACCTCTGCATAGGCCAGGCGG 0: 1
1: 1
2: 1
3: 7
4: 140
1029731599_1029731612 19 Left 1029731599 7:102442079-102442101 CCCCCAACACAGAGAACCAGTGA 0: 1
1: 0
2: 1
3: 22
4: 248
Right 1029731612 7:102442121-102442143 AAACCTCTGCATAGGCCAGGCGG 0: 1
1: 1
2: 1
3: 7
4: 140
1029731601_1029731612 17 Left 1029731601 7:102442081-102442103 CCCAACACAGAGAACCAGTGATC 0: 1
1: 0
2: 2
3: 15
4: 220
Right 1029731612 7:102442121-102442143 AAACCTCTGCATAGGCCAGGCGG 0: 1
1: 1
2: 1
3: 7
4: 140
1029731602_1029731612 16 Left 1029731602 7:102442082-102442104 CCAACACAGAGAACCAGTGATCC 0: 1
1: 0
2: 1
3: 12
4: 166
Right 1029731612 7:102442121-102442143 AAACCTCTGCATAGGCCAGGCGG 0: 1
1: 1
2: 1
3: 7
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029731612 Original CRISPR AAACCTCTGCATAGGCCAGG CGG Intronic
903210394 1:21814851-21814873 GACCCTCTGCAGAGGCCATGCGG + Intronic
903785961 1:25861562-25861584 AAACCTGTGCAGAGACCAAGAGG - Exonic
906492491 1:46279225-46279247 AAACATCTGCCAAGGCCAGCAGG + Exonic
909267336 1:73577330-73577352 AAATCTCTGCACAGGAAAGGTGG - Intergenic
909843361 1:80358344-80358366 AAACCTCTCCAAGGGCCAGATGG - Intergenic
912553468 1:110499326-110499348 CATCCTCTGCAATGGCCAGGAGG - Intergenic
913156916 1:116108694-116108716 AAATGCCTACATAGGCCAGGTGG - Intergenic
915448769 1:155990195-155990217 AGACTTCTGCATAGGCTTGGTGG - Intronic
915466275 1:156100078-156100100 ACCCCTCTGCATAGCCCTGGAGG + Intronic
1063596537 10:7440866-7440888 ACACCTCTGCCCAGGCAAGGTGG + Intergenic
1063599705 10:7469214-7469236 AGACCTCTGCAAAAGCCAGATGG + Intergenic
1063891639 10:10635754-10635776 AAACCTTTTCATAGGCATGGAGG - Intergenic
1065271099 10:24034751-24034773 AAGCCTCTGCAAAGGTCAGTGGG - Intronic
1065689169 10:28315520-28315542 AAATGTCTGCAGTGGCCAGGAGG - Intronic
1067551017 10:47236608-47236630 AAACCGCTGCAGGGACCAGGGGG + Intergenic
1068695837 10:59967369-59967391 AACTCCCTGCAGAGGCCAGGTGG + Intergenic
1068842717 10:61633250-61633272 ACATCTCTGCAGAGCCCAGGAGG + Intergenic
1071392496 10:85189905-85189927 AAACCTGTGCTTAGTCCAGAGGG + Intergenic
1073544044 10:104334291-104334313 CATCCCCTGCGTAGGCCAGGGGG - Intronic
1078566917 11:12423139-12423161 AAACATCTGGCTAGGCGAGGTGG - Intronic
1079231512 11:18653034-18653056 AAACATATAAATAGGCCAGGTGG - Intergenic
1080177515 11:29383808-29383830 AAACCTCAGCCTATGCCATGGGG - Intergenic
1082037667 11:47658424-47658446 AACCATGTTCATAGGCCAGGTGG + Intergenic
1083291448 11:61692598-61692620 AAACCTTTGCATCTGCCAGGGGG + Intronic
1084513310 11:69619765-69619787 AAACCTCTTCACAGGGCAGCAGG + Intergenic
1085351935 11:75803217-75803239 TAAGCTGTGCATAGGGCAGGGGG + Intergenic
1086345546 11:85892104-85892126 AAAGCTCTCAACAGGCCAGGAGG + Intronic
1089788458 11:120924915-120924937 AAACCACTGCAAAGGGCAGCAGG - Intronic
1091409042 12:227297-227319 TAACCTCTACATCAGCCAGGAGG + Intronic
1094182186 12:27603768-27603790 AAACCTCTGCTTAGCCCAAAAGG - Intronic
1095606216 12:44070818-44070840 AAACCCTTGCAGAGACCAGGTGG - Intronic
1096527879 12:52223268-52223290 AAACCTCTGCTGAGGAGAGGAGG - Intergenic
1097942494 12:65326981-65327003 AAAGCACTGCAGAGGGCAGGGGG - Intronic
1099006969 12:77245494-77245516 AAACCTATCCATTGGCCAGTTGG - Intergenic
1102803921 12:115762696-115762718 AGACTTCTGCAAAGGCCTGGAGG + Intergenic
1110744871 13:79040273-79040295 AACCCTCTGTATGGGCCATGGGG - Intergenic
1113149331 13:107243991-107244013 AAATTTCTGCAGAGTCCAGGAGG - Intronic
1113275953 13:108730274-108730296 ACACCTCTTCATAGGGCAGCAGG - Intronic
1113328084 13:109302153-109302175 AAGCCCCTGCTGAGGCCAGGGGG - Intergenic
1117275662 14:54190786-54190808 AACCCTGTGCATAGACCATGGGG - Intergenic
1118201496 14:63678304-63678326 AAACCTACGCACAGGCCATGAGG - Intergenic
1119603714 14:75996139-75996161 AACCCTCCCCATAGGCGAGGAGG - Intronic
1120789066 14:88562899-88562921 AAACCTGTGCTCAGGCAAGGAGG - Exonic
1123409558 15:20047227-20047249 AAATCTCTGCATAATGCAGGAGG + Intergenic
1123518888 15:21053935-21053957 AAATCTCTGCATAATGCAGGAGG + Intergenic
1126782266 15:52148970-52148992 ACACCCCTGCATAGTCCAGAAGG + Intronic
1127343808 15:58073014-58073036 AAACCTCTGGATTGGGCAGATGG + Intronic
1129188960 15:73926757-73926779 ACCCCTCTGCAGAGGCCTGGTGG - Exonic
1130306204 15:82713609-82713631 AAACCTCTGCTTGGCCCAGCAGG - Intergenic
1130529656 15:84736654-84736676 AAACATAAGAATAGGCCAGGTGG + Intergenic
1131731852 15:95290156-95290178 AAACTGCTGTATAGGCCAGCTGG - Intergenic
1133322795 16:4924758-4924780 AACCCTGTCCATAGGCCATGGGG + Intronic
1133631474 16:7626129-7626151 AAGCCTCTGCAAAGGCATGGAGG + Intronic
1133875864 16:9733793-9733815 AAGCCTCTGCAAAGGCCCTGGGG - Intergenic
1133994759 16:10740038-10740060 CAGCCTGTGCATTGGCCAGGTGG + Intergenic
1138567547 16:57844616-57844638 AGACCCCAGCACAGGCCAGGAGG - Intronic
1141819475 16:86434999-86435021 AAAGCTCTGCATAGTCCAGGTGG - Intergenic
1141951953 16:87345095-87345117 GAACCTGTGCAGAGGCCACGGGG + Intronic
1143042684 17:4050889-4050911 CATCCTCTGCACTGGCCAGGTGG + Exonic
1143927460 17:10384323-10384345 AAACCTCTGCCACAGCCAGGAGG + Intergenic
1144762348 17:17714454-17714476 AAACCTCTCCATAGGCCAGGAGG + Intronic
1147173815 17:38638650-38638672 AAGCCTCTAAATAGGCCATGGGG + Intergenic
1147808705 17:43151055-43151077 AGACCTCTGCAAAGGCCCTGAGG - Intergenic
1149203205 17:54212534-54212556 AAAACTCTGCCTAGGCAAAGAGG + Intergenic
1150136391 17:62697589-62697611 ACACCCCTGCATAAGCCAGCGGG - Intergenic
1151367339 17:73626150-73626172 AAACTTCAGGAGAGGCCAGGAGG + Intronic
1151977420 17:77490515-77490537 ACACCACTGCACAGGCCAGGCGG - Intronic
1152393250 17:80015554-80015576 AAAAGTCTGCAGAGGTCAGGGGG + Intronic
1153657586 18:7297870-7297892 AAATGTCTGCATAGGCTAGTTGG + Intergenic
1156054998 18:32991698-32991720 ACACCTCTGCATAAGCCTGAAGG - Intronic
1163034350 19:14562675-14562697 ATACCCCTCCATAGGGCAGGGGG - Intronic
1164412391 19:28016849-28016871 AAACCTGTGCATAGGGCGTGGGG - Intergenic
1167142439 19:47661369-47661391 CAACCTCTGCCTGGGCCACGTGG - Intronic
925032648 2:662786-662808 AAAGCTCTGCAGAGCCAAGGAGG + Intergenic
931844882 2:66193302-66193324 TGACCTCTGCATTGCCCAGGAGG - Intergenic
932733832 2:74240147-74240169 AAACCTGTGCAGAGGCTAGTGGG - Intronic
932988997 2:76763569-76763591 ACTCATCTGCATAGGCTAGGTGG - Intronic
935666751 2:105518911-105518933 AACCCTTAGCCTAGGCCAGGAGG + Intergenic
944851083 2:203719911-203719933 AACCCTCTGCATAGGTGGGGTGG - Intronic
945921762 2:215762220-215762242 CAACCTCTGCACAGGGAAGGAGG - Intergenic
1168738760 20:169366-169388 AAGTCTCTGCCTAGGCAAGGGGG + Intergenic
1170351274 20:15444516-15444538 ACATCACTGCATAGGCCAGCAGG - Intronic
1176133520 20:63507779-63507801 AAAAAGCTGCAGAGGCCAGGGGG - Intergenic
1176181690 20:63752470-63752492 AAGCCTCTGCAGGGGCCATGTGG + Intronic
1178024656 21:28452462-28452484 AAACCTCTGCATGGCACACGGGG - Intergenic
1178253105 21:31023454-31023476 AAGCATCAGCATTGGCCAGGAGG - Intergenic
1179980315 21:44892067-44892089 GGACCCCTGCAGAGGCCAGGAGG - Intronic
1180234541 21:46449911-46449933 AAACCTCTGGAGAGGGGAGGGGG - Intergenic
1182496108 22:30708806-30708828 AAACATATCCACAGGCCAGGGGG + Intronic
1183227290 22:36559194-36559216 AAACCACTGCTTAAGGCAGGAGG - Intergenic
1185346199 22:50311884-50311906 TAAGGTCTGCAGAGGCCAGGTGG + Exonic
950924566 3:16727636-16727658 AAACCTGCACATAGGCCAGCGGG + Intergenic
952667283 3:35922224-35922246 AGATATCTGCATAGGACAGGTGG + Intergenic
956638177 3:71387232-71387254 AAACATCAGAATAGGGCAGGAGG + Intronic
962102443 3:132356763-132356785 AAACCTCTCCAGAGGACAGCTGG - Exonic
962883123 3:139597884-139597906 AAACCTCAGAATAGGAGAGGAGG + Intronic
969489199 4:7489533-7489555 TAACATCTGCAGGGGCCAGGAGG - Intronic
971614039 4:28764488-28764510 AAATCTCTGTATAGGAAAGGTGG - Intergenic
972042277 4:34618104-34618126 TACCCTCTGCAAAGGCCTGGAGG - Intergenic
972839348 4:42913001-42913023 ACACCTCTTCATAGGGCAGCAGG - Intronic
972995201 4:44870529-44870551 AAACCTGTGCAGTGTCCAGGAGG - Intergenic
980744978 4:137001240-137001262 AAACCTCTGCTGGGTCCAGGGGG - Intergenic
981570617 4:146147073-146147095 AAACCTTTGCATTGCCTAGGAGG + Intergenic
982837600 4:160141345-160141367 AAAACTCTGCACAGAGCAGGTGG - Intergenic
985847742 5:2364795-2364817 AATCCTCTCCATTGGGCAGGGGG + Intergenic
986580120 5:9257168-9257190 AAAACTCTTCAAGGGCCAGGTGG - Intronic
988054965 5:26083099-26083121 AACCGTCTGCATAGGCTAAGAGG + Intergenic
992157685 5:73971092-73971114 TAACCTCTGCAAGGGGCAGGGGG + Intergenic
995616570 5:113971073-113971095 AAACAACTGCAGAAGCCAGGAGG - Intergenic
995672429 5:114621755-114621777 AAACCTGTGGACAGGCCATGAGG - Intergenic
997398288 5:133581923-133581945 AAACCTCTGCAGGTGCCAGTGGG + Intronic
998570327 5:143251132-143251154 AAACCTCACCAAATGCCAGGTGG - Intergenic
998864802 5:146487457-146487479 AAAAATCTGGATAGGCAAGGTGG + Intronic
1001965778 5:175908868-175908890 CAACATCTGCAGAGGCCTGGAGG - Intergenic
1002251167 5:177930328-177930350 CAACATCTGCAGAGGCCTGGAGG + Intergenic
1003879931 6:10470872-10470894 ACACCACTGGATAAGCCAGGAGG - Intergenic
1004652199 6:17620793-17620815 AAATCTTTGCCTAGGCCAGGGGG - Intronic
1006937658 6:37729539-37729561 AAACCTGGGTAAAGGCCAGGGGG + Intergenic
1007223854 6:40299369-40299391 AAGCTTATGCAAAGGCCAGGAGG - Intergenic
1014122198 6:117738449-117738471 AAAACTCTTCATTTGCCAGGTGG + Intergenic
1015382361 6:132583959-132583981 AAAGCTCTGCATAGGAGAAGGGG + Intergenic
1016220865 6:141668574-141668596 AGATCTCTGCACAGGACAGGTGG - Intergenic
1017075465 6:150613631-150613653 AAGCCTCTTCAGAAGCCAGGAGG - Intronic
1017503341 6:155045690-155045712 CAACCACTGCAGAGGCAAGGAGG - Intronic
1022186128 7:27971271-27971293 CAACCTCTGCACAGGCCAGACGG + Intronic
1026102454 7:67394383-67394405 AACCCCCTGCATAGGCCCAGAGG - Intergenic
1026928091 7:74207622-74207644 AGACCCCTGCAGAGGCCACGAGG + Intronic
1029731612 7:102442121-102442143 AAACCTCTGCATAGGCCAGGCGG + Intronic
1039543712 8:38392058-38392080 AAGACACTGCATAGGCAAGGCGG + Intronic
1040014855 8:42691777-42691799 AAACCTCCGCAAAGACCAGGAGG - Intergenic
1040806196 8:51398697-51398719 AAACCTATGCAAATGCAAGGCGG + Intronic
1041457468 8:58076245-58076267 AAACTTCTGACCAGGCCAGGTGG - Intronic
1041560915 8:59216356-59216378 AAACCTGTGCAGAGTCCAGAAGG - Intergenic
1042978835 8:74502515-74502537 GAAACTCTCCAAAGGCCAGGGGG - Intergenic
1046395254 8:113632654-113632676 AAACCTCTGCCTCAGCCAGATGG - Intergenic
1047779332 8:128098729-128098751 AAACCTCTGCAGAGGAGGGGTGG - Intergenic
1049096647 8:140552119-140552141 AAAGCTCTGTATAGAACAGGAGG - Intronic
1055646519 9:78366817-78366839 TAAACTCTGCAGAGGGCAGGGGG + Intergenic
1056834648 9:89944666-89944688 AACCCTCTGCAAAGCCCAGGGGG + Intergenic
1057912029 9:99026645-99026667 AACCATGTGCAAAGGCCAGGAGG - Intronic
1058935309 9:109764382-109764404 CAAGCTGTGCAAAGGCCAGGAGG - Intronic
1059488178 9:114643515-114643537 CAGCTTCTGCAAAGGCCAGGGGG - Exonic
1059681493 9:116590474-116590496 ACAGCTCTGCACAGGCCAGCAGG + Intronic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1061213409 9:129206417-129206439 AACCCTCTGCTTTGGCCAGAGGG - Intergenic
1188661220 X:32761199-32761221 AAATCCCTGGATAGGCCAGGTGG - Intronic
1189411514 X:40776766-40776788 ATATCTGTGGATAGGCCAGGTGG - Intergenic
1192142981 X:68660868-68660890 AAAACTCAGGATAGGCCTGGGGG + Intronic
1198775428 X:140173713-140173735 AAACCTCCACATAGGGCAGCAGG - Intergenic
1199448991 X:147958635-147958657 AAATCTCTGCAGAGACCATGGGG - Intergenic