ID: 1029735009

View in Genome Browser
Species Human (GRCh38)
Location 7:102460774-102460796
Sequence GATAGGCACGGGCCAACCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 86}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029735009_1029735017 2 Left 1029735009 7:102460774-102460796 CCAGGGGTTGGCCCGTGCCTATC 0: 1
1: 0
2: 0
3: 7
4: 86
Right 1029735017 7:102460799-102460821 CAGCGTGAGGGTCACCTAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 99
1029735009_1029735018 3 Left 1029735009 7:102460774-102460796 CCAGGGGTTGGCCCGTGCCTATC 0: 1
1: 0
2: 0
3: 7
4: 86
Right 1029735018 7:102460800-102460822 AGCGTGAGGGTCACCTAGGAGGG No data
1029735009_1029735015 -1 Left 1029735009 7:102460774-102460796 CCAGGGGTTGGCCCGTGCCTATC 0: 1
1: 0
2: 0
3: 7
4: 86
Right 1029735015 7:102460796-102460818 CACCAGCGTGAGGGTCACCTAGG No data
1029735009_1029735013 -10 Left 1029735009 7:102460774-102460796 CCAGGGGTTGGCCCGTGCCTATC 0: 1
1: 0
2: 0
3: 7
4: 86
Right 1029735013 7:102460787-102460809 CGTGCCTATCACCAGCGTGAGGG 0: 1
1: 0
2: 0
3: 4
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029735009 Original CRISPR GATAGGCACGGGCCAACCCC TGG (reversed) Intronic
901818138 1:11806413-11806435 GATTGGCCCGGCCCCACCCCCGG - Intronic
902632753 1:17715395-17715417 GATAGGCCTGGGCCAAATCCTGG - Intergenic
903227072 1:21899913-21899935 GACAGGGACTGGCCAACCCTGGG - Intronic
903470076 1:23580696-23580718 GACAGGCAGGTGCCAACCCCAGG - Intergenic
903673152 1:25048184-25048206 GACAGGCAGGGGCCAGCCCCTGG + Intergenic
904611961 1:31730943-31730965 CATAGGCAGGGCCCAGCCCCAGG + Exonic
910054940 1:83022467-83022489 TATAGGCACATGCCAACACCTGG + Intergenic
911415030 1:97561033-97561055 AATAGGCAGGGGCCAAACCAAGG + Intronic
911543688 1:99189794-99189816 GAGAGGTACGGGTGAACCCCAGG + Intergenic
915477689 1:156162656-156162678 GACAGGCAGGGGCCACCCCAGGG + Intronic
916034271 1:160907001-160907023 GATACCCACGGGACAATCCCAGG + Intergenic
920166100 1:204037131-204037153 TGTAGGTACAGGCCAACCCCAGG - Intergenic
922555203 1:226527489-226527511 GATAGACTGGGGCCACCCCCAGG - Intergenic
922726261 1:227924400-227924422 GATCGGCCCTTGCCAACCCCAGG - Exonic
1071522390 10:86339368-86339390 GATTGGCACGGGCCTGCCCATGG + Intronic
1077672143 11:4166655-4166677 GAAAGGCACAGGCCAGGCCCAGG - Intergenic
1078464394 11:11539509-11539531 TATAGACACGAGCCAAACCCAGG + Intronic
1078464769 11:11541947-11541969 TATAGACACGAGCCAAACCCAGG + Intronic
1091600879 12:1916990-1917012 GATAGGAGAGGGCCAACTCCAGG - Intronic
1091714537 12:2767616-2767638 GATAGGCAGGGGCCAGACACGGG + Intergenic
1096103024 12:48980721-48980743 GAGCGGCAGGGGCCAACCTCGGG + Intronic
1096309142 12:50505063-50505085 GACAGACACGGGCCCACACCCGG - Intronic
1099459974 12:82910371-82910393 GACAGGCAGGCTCCAACCCCAGG + Intronic
1101991801 12:109491880-109491902 GATACGTTTGGGCCAACCCCGGG - Intronic
1103380161 12:120488005-120488027 AATAGGCACAGGCCAGACCCAGG - Intronic
1111044548 13:82797273-82797295 GAGAGGCCCTGGCAAACCCCTGG - Intergenic
1111559085 13:89920583-89920605 GATAAGCACCTGGCAACCCCAGG - Intergenic
1122129346 14:99596071-99596093 GAAAGACAGGGGCCCACCCCAGG - Intronic
1122228897 14:100295345-100295367 GATGGGAACGGACCCACCCCTGG + Intronic
1124510091 15:30316580-30316602 CACAGGCACAGCCCAACCCCAGG + Intergenic
1124732798 15:32213973-32213995 CACAGGCACAGCCCAACCCCAGG - Intergenic
1130879775 15:88045029-88045051 GATGGGCAGGTGCCAACACCTGG - Intronic
1132727437 16:1345097-1345119 GATAGGGACGGGGCACCCACCGG - Exonic
1133780618 16:8936241-8936263 GATACGCATGGGCCAACACCTGG + Intronic
1137577913 16:49615741-49615763 GTTAAGCCCAGGCCAACCCCTGG + Intronic
1142549155 17:727497-727519 AATAGGCAGGAGCCAACTCCGGG + Intergenic
1142549206 17:727695-727717 AATAGGCAGGAGCCAACTCCGGG + Intergenic
1142549240 17:727827-727849 AATAGGCAGGAGCCAACTCCGGG + Intergenic
1142549274 17:727959-727981 AATAGGCAGGAGCCAACTCCGGG + Intergenic
1146476135 17:33164159-33164181 GACAGGCCTGGGCCAGCCCCAGG - Intronic
1147189618 17:38730899-38730921 GAGAGCCACGGGCTAACTCCAGG - Intronic
1154255534 18:12777967-12777989 GTTAGCCGCGGGCCAAGCCCCGG + Intergenic
1161394482 19:4037916-4037938 GAGGGGCACGGGCCAGCCTCGGG + Exonic
1162974394 19:14200190-14200212 TATAGGCACGGTCCAGCCCCAGG - Intronic
1163264024 19:16207490-16207512 GAAAGGCACAGCCCAACCCTTGG - Intronic
1163685163 19:18708416-18708438 GAGAGGAACGGGGCCACCCCGGG + Intronic
929165400 2:38876240-38876262 GAGGGGCACGGGGGAACCCCTGG + Intronic
934142484 2:89061062-89061084 GAAAGGCAGGGGCCCACCCTGGG + Intergenic
934226755 2:90139492-90139514 GAAAGGCAGGGGCCCACCCTGGG - Intergenic
945994480 2:216424509-216424531 GACAGACACGAGCCAACCCTGGG + Intronic
947538785 2:230959977-230959999 GATAGGGACGGGCAACCCCCAGG - Intronic
1175408648 20:58751845-58751867 GATGGGCACGGGCTCACCCCTGG + Intergenic
1175755289 20:61525768-61525790 GATAGGCAAGGGGCAGCCGCAGG - Intronic
1175840580 20:62024228-62024250 GACAGACACAGGCAAACCCCTGG + Intronic
1175891281 20:62317139-62317161 GACAGGCACGGGCAAAGACCTGG - Intronic
1179534366 21:42041895-42041917 GACAGGCAGGGGGCAGCCCCGGG - Intergenic
1179788789 21:43743807-43743829 GGTAGGCAGGGGCCCACCCTCGG + Exonic
1182257537 22:29049657-29049679 GAAAGGCACGGGCCGGGCCCCGG - Exonic
1184916697 22:47574468-47574490 GATGGGCACAGGCTATCCCCAGG + Intergenic
949916504 3:8968564-8968586 GAGTTGCACGGGCCAGCCCCTGG - Intergenic
950572731 3:13811940-13811962 GACACACACGGGCCACCCCCAGG - Intergenic
952530076 3:34254399-34254421 GGTAGGCAAGGGCCAAGCCTTGG + Intergenic
955536803 3:59932236-59932258 GATAGGCACTGGATAAACCCAGG + Intronic
962686882 3:137856558-137856580 GATAGGGATGGCCCAAACCCAGG + Intergenic
969533665 4:7742623-7742645 GACAGACACGGGCCCACGCCTGG - Exonic
971170568 4:24228929-24228951 GATATGCAGGCTCCAACCCCCGG + Intergenic
973871692 4:55172806-55172828 AATAGGCAGGGGCCAAGACCAGG - Intergenic
983670932 4:170237088-170237110 TATAGGCACGTGCCACCACCCGG - Intergenic
983921739 4:173353293-173353315 GATGTGCAGAGGCCAACCCCAGG + Intergenic
985787989 5:1909879-1909901 GAGAGGCAGGGGCCAACCTAGGG - Intergenic
988307320 5:29509348-29509370 GAGAGGCATGTGCCAACTCCGGG - Intergenic
990368594 5:55094506-55094528 GATGGGAGTGGGCCAACCCCTGG - Intergenic
994140550 5:96336138-96336160 GATAGACAAGGGACAGCCCCAGG - Intergenic
997020523 5:129995371-129995393 GATGTGCAGAGGCCAACCCCAGG - Intronic
997543339 5:134683161-134683183 TATAGGCGCGAGCCAACACCTGG + Intronic
1006682360 6:35806103-35806125 GGCAGGCAGGGGCCCACCCCGGG + Intronic
1011117149 6:83906060-83906082 GGTAGGCAGGGGCAATCCCCAGG + Intronic
1017385595 6:153879141-153879163 AATAGGCAGGTGCCACCCCCAGG + Intergenic
1022557828 7:31317376-31317398 AAGAGGCACAGGCCAACACCCGG + Intergenic
1022989621 7:35694916-35694938 GACCGGCACGGCCCAGCCCCGGG + Exonic
1024423608 7:49199914-49199936 AACAGGCACAGGCCAAACCCAGG + Intergenic
1025946021 7:66105212-66105234 TATAGGCACGTGCCAACAACCGG - Intronic
1026982360 7:74534270-74534292 GGAAAGCATGGGCCAACCCCTGG - Intronic
1029423275 7:100482891-100482913 GATAGGCACGGCCTGATCCCTGG - Intergenic
1029735009 7:102460774-102460796 GATAGGCACGGGCCAACCCCTGG - Intronic
1032265890 7:130369710-130369732 GATGGCCAAGAGCCAACCCCTGG + Intergenic
1032551911 7:132792112-132792134 CAGAGGCAAGGACCAACCCCAGG - Intronic
1039046571 8:33455847-33455869 GAAAGTCACGGGCCCTCCCCAGG - Intronic
1040304467 8:46204941-46204963 AATGGGCACGGGACAACCCCGGG - Intergenic
1042571824 8:70173640-70173662 GATAAGCAAGGGCCAACACTGGG + Intronic
1049586667 8:143435604-143435626 GATGGGCACAGGCCTAGCCCAGG + Intergenic
1062673207 9:137723622-137723644 GACAGACACGGGCACACCCCGGG - Intronic
1191248899 X:58249714-58249736 TAGAGGTACTGGCCAACCCCAGG + Intergenic
1195842280 X:109187317-109187339 TATAGGCAAGGGCCAAGCACAGG - Intergenic