ID: 1029736853

View in Genome Browser
Species Human (GRCh38)
Location 7:102469841-102469863
Sequence CTGCTGCTGGGACGTGCGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 223}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029736837_1029736853 23 Left 1029736837 7:102469795-102469817 CCTCCTGCCCGGACGCCCGCCTG 0: 1
1: 0
2: 1
3: 38
4: 430
Right 1029736853 7:102469841-102469863 CTGCTGCTGGGACGTGCGGCTGG 0: 1
1: 0
2: 0
3: 19
4: 223
1029736844_1029736853 7 Left 1029736844 7:102469811-102469833 CCGCCTGCTGGCCGGCTGCGAGG 0: 1
1: 1
2: 2
3: 9
4: 190
Right 1029736853 7:102469841-102469863 CTGCTGCTGGGACGTGCGGCTGG 0: 1
1: 0
2: 0
3: 19
4: 223
1029736849_1029736853 -4 Left 1029736849 7:102469822-102469844 CCGGCTGCGAGGGCGGCTGCTGC 0: 1
1: 0
2: 1
3: 41
4: 893
Right 1029736853 7:102469841-102469863 CTGCTGCTGGGACGTGCGGCTGG 0: 1
1: 0
2: 0
3: 19
4: 223
1029736836_1029736853 30 Left 1029736836 7:102469788-102469810 CCTGTCGCCTCCTGCCCGGACGC 0: 1
1: 0
2: 1
3: 9
4: 163
Right 1029736853 7:102469841-102469863 CTGCTGCTGGGACGTGCGGCTGG 0: 1
1: 0
2: 0
3: 19
4: 223
1029736838_1029736853 20 Left 1029736838 7:102469798-102469820 CCTGCCCGGACGCCCGCCTGCTG 0: 1
1: 0
2: 1
3: 26
4: 271
Right 1029736853 7:102469841-102469863 CTGCTGCTGGGACGTGCGGCTGG 0: 1
1: 0
2: 0
3: 19
4: 223
1029736843_1029736853 8 Left 1029736843 7:102469810-102469832 CCCGCCTGCTGGCCGGCTGCGAG 0: 1
1: 1
2: 0
3: 18
4: 177
Right 1029736853 7:102469841-102469863 CTGCTGCTGGGACGTGCGGCTGG 0: 1
1: 0
2: 0
3: 19
4: 223
1029736841_1029736853 15 Left 1029736841 7:102469803-102469825 CCGGACGCCCGCCTGCTGGCCGG 0: 1
1: 0
2: 0
3: 8
4: 166
Right 1029736853 7:102469841-102469863 CTGCTGCTGGGACGTGCGGCTGG 0: 1
1: 0
2: 0
3: 19
4: 223
1029736847_1029736853 4 Left 1029736847 7:102469814-102469836 CCTGCTGGCCGGCTGCGAGGGCG 0: 1
1: 0
2: 1
3: 12
4: 118
Right 1029736853 7:102469841-102469863 CTGCTGCTGGGACGTGCGGCTGG 0: 1
1: 0
2: 0
3: 19
4: 223
1029736840_1029736853 16 Left 1029736840 7:102469802-102469824 CCCGGACGCCCGCCTGCTGGCCG 0: 1
1: 0
2: 1
3: 17
4: 191
Right 1029736853 7:102469841-102469863 CTGCTGCTGGGACGTGCGGCTGG 0: 1
1: 0
2: 0
3: 19
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029736853 Original CRISPR CTGCTGCTGGGACGTGCGGC TGG Exonic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
900366108 1:2312607-2312629 CAGGTGCTGGGACGTGGGGGTGG - Intergenic
900369499 1:2325002-2325024 CTGCTGCAAGGACGAGGGGCTGG + Intronic
901022188 1:6261078-6261100 CCGCTGCTGCGCCGGGCGGCCGG + Intergenic
901528068 1:9836427-9836449 CTGCTGCTGAGACGGGCACCAGG + Intergenic
901660626 1:10796045-10796067 CTGCTGCTGGGGGGTGGGGTGGG + Intronic
901691032 1:10973618-10973640 CTGCAGCAGGGAGGTGTGGCTGG + Intronic
902863141 1:19260178-19260200 CTGCTGTTGGGAGGTCAGGCTGG + Intergenic
903082203 1:20819975-20819997 CTGCAGCAGGGAGGTGCAGCTGG + Intronic
904047159 1:27615689-27615711 CTGCTTCGGGGATGTGTGGCTGG - Exonic
904314348 1:29650640-29650662 GTGCTGCTGGCACTTGCGGTGGG + Intergenic
904384843 1:30134548-30134570 GTGCTGCTGGCACTTGCGGTGGG - Intergenic
905665373 1:39760394-39760416 CTGCAGCTGGGCCGGGCGGGTGG + Exonic
906082574 1:43102778-43102800 CTGCAGCAGGGAGGTGCCGCTGG - Intergenic
906108575 1:43308809-43308831 CAGCTGATGGGATGTGGGGCTGG + Intronic
906691003 1:47792751-47792773 CTGCTCCTGGGTCCTGGGGCAGG + Intronic
907603517 1:55793777-55793799 CTGCAGCAGGGAAGCGCGGCTGG + Intergenic
912942931 1:114061072-114061094 CTGCAGCAGGGAGGTGTGGCTGG + Intergenic
915801125 1:158794561-158794583 CTGGTGCTGGTACCTGCTGCTGG - Intergenic
916214407 1:162383362-162383384 CGTCTGCTGGGACGTCAGGCTGG - Exonic
917790368 1:178495484-178495506 CTGCTGCTGGGACTAGCATCAGG + Intergenic
921902158 1:220462846-220462868 CTGCAGCAGGGAAGTGCAGCTGG + Intergenic
922416750 1:225428644-225428666 CCGATGCTGGGACCGGCGGCGGG + Intronic
1063119232 10:3093005-3093027 CTGCTCCTGGGATGTGTGGAAGG + Intronic
1065770415 10:29072866-29072888 CTGCTGCAGGCACGTGCAGGTGG + Intergenic
1066493994 10:35923195-35923217 TTGCTGCTGGGAAGTGGGGGAGG - Intergenic
1067269025 10:44773675-44773697 CCGCTGCTGGAAGGTGCCGCTGG + Intergenic
1069486612 10:68827761-68827783 CTGCTTCTGGAACGCGCGGCTGG + Exonic
1069486699 10:68828097-68828119 CTGCTTCTGGAACGCGCGGCTGG + Intronic
1072971454 10:100021053-100021075 CTGCAGCAGGGAGGTGCAGCTGG - Intergenic
1073323703 10:102630507-102630529 CTCCTGCTGGGCTGTGCGGCAGG - Exonic
1074768916 10:116720731-116720753 CTGCAGCTGGCACGTGCAGACGG - Intronic
1075071164 10:119320810-119320832 CTGCTGCTGGGACCTGAGCACGG + Intronic
1076549438 10:131268179-131268201 CTGCAGCAGGGAGGTGCAGCTGG - Intronic
1076783266 10:132736190-132736212 CTGCTGCTGGGATGTTCAGAGGG + Intronic
1076815632 10:132913441-132913463 CTGTTGATGGGACGGGAGGCGGG - Intronic
1076921661 10:133457532-133457554 CAGCGGCTGCGACCTGCGGCTGG + Intergenic
1077066637 11:643979-644001 TGGCTGCTGGGAGGTGCAGCAGG - Intergenic
1077079818 11:720285-720307 CTGCAGCCCGGATGTGCGGCCGG + Intronic
1082750212 11:57006524-57006546 CTGCAGCAGGGAGGTGTGGCTGG - Intergenic
1086340023 11:85839380-85839402 GTGCTGCTGGGAGGTGGGGATGG - Intergenic
1087129232 11:94654232-94654254 CTGCTGCTTGGAGGTGGGTCAGG - Intergenic
1088704417 11:112448429-112448451 CTGCAGCAGGGAGGGGCGGCTGG - Intergenic
1089560341 11:119340354-119340376 CTGCTCCTGGGCCTGGCGGCCGG - Exonic
1089713770 11:120336647-120336669 CCGGTGCTGGGACGAGCCGCTGG - Intergenic
1089823008 11:121246031-121246053 CTGCAGCGGGGAGGTGTGGCTGG + Intergenic
1091054110 11:132402410-132402432 CTGCAGCTGGGATGTGAGGAGGG - Intergenic
1091253560 11:134164351-134164373 CTGCTGCCAGGACGTGCTCCGGG - Intronic
1093281664 12:17203594-17203616 CTGCAGCAGGGAGGTGTGGCTGG + Intergenic
1093460458 12:19402954-19402976 CTGGTGCTGGTACCTGCTGCTGG - Intergenic
1095850208 12:46795049-46795071 TTGCTGCTGGGAAGTGAGACTGG - Intronic
1096106209 12:48998235-48998257 CTGCTGCTGAGAGGTTCTGCCGG - Exonic
1096848023 12:54418621-54418643 GGGCTGCTGGGACCTGGGGCGGG - Intronic
1098395188 12:70010153-70010175 CTGCTGCTGGGAAATGAGGGAGG - Intergenic
1100444625 12:94649931-94649953 CGGCCGCCGGGACGTTCGGCGGG + Intronic
1101858765 12:108465474-108465496 TTGCTGCCGGGAGGTGGGGCAGG + Intergenic
1101900281 12:108786918-108786940 CTGCTGCTGGGAAGAGCTGGAGG + Exonic
1103462566 12:121116788-121116810 CTGCCCCTGGGACTTGCGGAAGG + Intergenic
1103918431 12:124387711-124387733 CTGCTGCTGGCGCGGGCGGAGGG - Intronic
1105014664 12:132778974-132778996 CTGCTGCTGGGCCGTGGTTCAGG - Intronic
1106620122 13:31364720-31364742 CTGCAGCAGGGAGGTGCAGCTGG + Intergenic
1107513418 13:41107215-41107237 CTGCAGCAGGGAAGTGCAGCTGG + Intergenic
1112357394 13:98685356-98685378 CTGCTGCTGGGACCTGGTGCAGG + Intronic
1114591302 14:23867131-23867153 GTGCTGCTGGAATGTGGGGCAGG - Intergenic
1114613274 14:24055597-24055619 CTACTGCAAGGACTTGCGGCTGG + Exonic
1118200205 14:63664106-63664128 CTGCAGCCGGGAGGCGCGGCTGG - Intergenic
1118354033 14:64996868-64996890 CTGCTTCTGGGAAGGGTGGCAGG - Intronic
1121013100 14:90533437-90533459 TGGCTGCTGGGACGTGCTGAGGG - Exonic
1121407179 14:93726170-93726192 TGGCTGCTGGCATGTGCGGCTGG - Intronic
1121507946 14:94490778-94490800 CTGGCTCTGGGACGTGGGGCTGG - Intronic
1121732821 14:96198112-96198134 CTGGTGCTGGGACGTCCGCCTGG - Intergenic
1122072161 14:99211969-99211991 CTTCTGCTGGGATGTGTGGAGGG - Intronic
1122614914 14:103010607-103010629 CTGCTGCTGGGATGTGACACAGG + Intronic
1122918776 14:104871066-104871088 TTGCTGCAGGGAGGGGCGGCAGG - Intronic
1123012481 14:105356107-105356129 CTGCTCCTGGGGCTTGGGGCTGG + Intronic
1123141375 14:106082378-106082400 CTGCTGCTGGGACATATGGGAGG + Intergenic
1123710197 15:22980816-22980838 CTGCAGCTGGGACCCGCGCCTGG - Intronic
1124139951 15:27068319-27068341 CTGCTGCAGGAGCCTGCGGCTGG + Intronic
1124168748 15:27353343-27353365 CTGCTGCAGGGTCCTGAGGCAGG - Intronic
1124375084 15:29124631-29124653 CGCCTGCTGGGAGGTGGGGCGGG - Intronic
1127586279 15:60381281-60381303 CTGCTGCTGGTTCGTGCCCCTGG - Intronic
1127880852 15:63157502-63157524 AAGCTGCTGGGAGGAGCGGCGGG + Exonic
1130653929 15:85778756-85778778 CTGGTGCTGGGACCTGCTGGTGG - Intronic
1130926022 15:88386520-88386542 GTGCTGCTGGGACCTGGGGAGGG - Intergenic
1132270399 15:100519307-100519329 CTGCTGCTGGAAGGTGGGGATGG - Intronic
1132579865 16:679941-679963 CTGCTGATGGGGCCGGCGGCTGG + Intronic
1132908373 16:2295929-2295951 CTCCTGCTGGGAAGAGCTGCTGG + Intronic
1132912838 16:2324387-2324409 CTGGCGGTGAGACGTGCGGCCGG - Exonic
1133442969 16:5836190-5836212 CTGCAGCTGGGGGGTGAGGCTGG + Intergenic
1134641064 16:15829651-15829673 CTGCAGCTGGGACTTGCTGGTGG - Intronic
1135223698 16:20637272-20637294 CTGGAGCAGGGAAGTGCGGCTGG + Intronic
1136399245 16:30008963-30008985 CTGCTGCTGGGTGGTGGGGAGGG + Intronic
1138023173 16:53502916-53502938 CTGCTGCTGGGGACTGCGGCTGG - Intronic
1138514641 16:57529227-57529249 CGGCTCCGGGGACGCGCGGCGGG + Exonic
1140442728 16:74999606-74999628 CTGCTGCTGAGAAGTGGGGGAGG + Exonic
1140760616 16:78105480-78105502 CTGCTGGTGGCACTTGGGGCTGG - Intronic
1141282282 16:82639476-82639498 CTGCTGCTGTGTCGTGTGGCTGG + Intronic
1142226890 16:88881877-88881899 CCCCTCCTGGGACGTGCTGCAGG + Intronic
1142431852 16:90032916-90032938 CTGCGGCTGGTAGGTGTGGCGGG + Exonic
1143164380 17:4890590-4890612 CTGCTGCAGGGACTTGAGGTAGG - Exonic
1143278268 17:5730838-5730860 CTCCTGCTGGGACTTGCTGCTGG - Intergenic
1143863032 17:9905037-9905059 CTGCTGCTGGGTGATGCGGCCGG + Exonic
1143967904 17:10770098-10770120 CTGCTCCTGGGGCATGTGGCTGG + Intergenic
1144170551 17:12655904-12655926 CTGCTGCTGGGACATTGGGCAGG + Intergenic
1144957440 17:19026115-19026137 CTCCTCCTGGGCCGTGAGGCAGG - Intronic
1144977716 17:19148401-19148423 CTCCTCCTGGGCCGTGAGGCAGG + Intronic
1145237046 17:21215345-21215367 CTCCTGCTGTGGCCTGCGGCGGG - Intergenic
1151449312 17:74188095-74188117 CTGAAGCTGGGAGGTGGGGCTGG - Intergenic
1152288156 17:79424273-79424295 GTGCTCCTGGGACGGGCGGGAGG - Intronic
1152372875 17:79901405-79901427 ATGCTGCTGGGGCGAGGGGCAGG - Intergenic
1152528307 17:80902314-80902336 CTGCTGCTGAGACGGGGGGCAGG - Intronic
1152700273 17:81815150-81815172 GAGCTGCTGGGAAGTGCTGCTGG + Intergenic
1154199192 18:12287663-12287685 CCTCTGCTGGGAGGAGCGGCTGG - Intergenic
1155218403 18:23662854-23662876 CTGCTGCCGGGCCGGGCGGCGGG - Exonic
1157866716 18:51194194-51194216 ATGCTGCTGGGACATGGGGGTGG + Intronic
1158314165 18:56192156-56192178 CTGCTGATGGCATGTGTGGCTGG - Intergenic
1158424386 18:57325992-57326014 CAGCTGCTGGGACGTGCCCAAGG - Intergenic
1160583182 18:79899211-79899233 CTGCTGCTGGGGCTGGCGGCAGG + Exonic
1160761910 19:789726-789748 CTCCTGCTGGGAGGTCCTGCGGG - Intergenic
1161128491 19:2573977-2573999 CAGCTGCTGCGAGGTACGGCCGG + Intronic
1161199242 19:3005472-3005494 GCGCTGCTGGGACCTGCGGGAGG - Exonic
1161518499 19:4710472-4710494 CTGCTGCTGGGAAGATGGGCTGG - Intronic
1163189602 19:15666898-15666920 CTGCTGATGGGAGGTGCTTCTGG + Intergenic
1163325413 19:16600177-16600199 CTGCTGCAGGGACCTGTGGCAGG - Intronic
1167013012 19:46821490-46821512 CTGCAGCAGGGAGGTGCGGCTGG + Intergenic
1167293556 19:48636936-48636958 CTGCTGCTGGGCGGCCCGGCCGG - Exonic
1168303262 19:55419241-55419263 CTGCAGCAGGGAGGTGCAGCTGG + Intergenic
925381543 2:3430855-3430877 CTGTTGCTGGGACCTTCCGCTGG + Intronic
926095696 2:10079834-10079856 CTGGGGCGGGGACGCGCGGCCGG + Intronic
927267226 2:21163591-21163613 CTGCAGCAGGGAGGTGCGGGAGG - Intergenic
927485835 2:23487890-23487912 CTGCAGCTGGGCCGTGTGGTGGG + Intronic
928723805 2:34148442-34148464 CTGCAGCAGGGAGGTGCAGCTGG - Intergenic
930439803 2:51391279-51391301 CTGCTGCTGGGAAGGGAGGAGGG + Intergenic
930737468 2:54794180-54794202 CTGCTGCTTGGTCATGCAGCAGG + Intronic
934758462 2:96840357-96840379 CAGCTGCTGGGATGTGAAGCTGG + Intronic
935068080 2:99669063-99669085 CTGCTGGTGGGACTTTCGACTGG + Intronic
938403682 2:131015189-131015211 CTGCTGCAGAGACCTGCGTCTGG - Intronic
941440415 2:165528805-165528827 CTGCAGCAGGGAGGTGCAGCTGG + Intronic
941807788 2:169726188-169726210 CTGCTGCTGGGTACTGCTGCTGG + Intronic
942391908 2:175503424-175503446 CTGCTGCTGGGAGATGGGGGAGG + Intergenic
943470763 2:188291902-188291924 CGGCAGCTGGGACGCGGGGCTGG - Intronic
944146856 2:196515096-196515118 CTGCTGCAGGCACCTGCGTCTGG - Intronic
944668718 2:201977634-201977656 CTGTTTCTGGGACATGAGGCAGG - Intergenic
946175578 2:217920129-217920151 CTGCAGCTGGGAGCTGCGGAGGG + Intronic
946185100 2:217976374-217976396 CTCCTGCTGGGAAGGGCAGCGGG - Intronic
948674277 2:239587911-239587933 CTCCTGCTGGGCCGTGAGCCAGG + Intergenic
948901966 2:240960659-240960681 CTGGTGCTGGAGCGAGCGGCTGG + Intronic
1168949471 20:1786751-1786773 CTACTGCTGTGAGGTGAGGCAGG + Intergenic
1171299575 20:24048504-24048526 CCGCAGCTGAGACGTGCGCCTGG + Intergenic
1173876988 20:46379344-46379366 CTGATGTTGGGAGGTGGGGCCGG - Intronic
1175722009 20:61293294-61293316 CAGCTCCTGGGACGGGTGGCAGG + Intronic
1177771175 21:25518507-25518529 CTGCTGCTGGGGGATGGGGCAGG - Intergenic
1179718903 21:43304454-43304476 CTGCTGCTGGAGCCTCCGGCTGG + Intergenic
1179787060 21:43735907-43735929 GTGCTGCTGGGGAGTGAGGCTGG + Intronic
1180897993 22:19351221-19351243 CTGATGCTGGGACCTGAGGCTGG + Intronic
1182352954 22:29709170-29709192 CTCCTGCTGGGAAGTGCTGATGG - Intergenic
1183280672 22:36930433-36930455 CTGCTCCTGGGAGGTGAGGAAGG + Exonic
1183326871 22:37199148-37199170 TGCCTGCTGGGGCGTGCGGCTGG + Intronic
1184046647 22:41976553-41976575 CTGCGGCGGGGACGGGCGGAGGG - Intronic
1184980201 22:48090308-48090330 CTGCTGCTGGCACCACCGGCCGG - Intergenic
951492589 3:23288922-23288944 CTGCTGCTGGGGCATGGGGGAGG + Intronic
952088409 3:29854185-29854207 CTGCTGCAGGGACGCGGGGAGGG - Intronic
952688503 3:36176303-36176325 CTGCTGCTGGGGGGTGGGGGAGG + Intergenic
956668350 3:71663151-71663173 CTCCTGCTTGGAGGTGCGGGAGG + Intergenic
959006508 3:101026347-101026369 CTGGTGCTGGTACCTGCTGCTGG - Intergenic
960914185 3:122680561-122680583 CTGCGGTTGGGGCGAGCGGCAGG + Intergenic
961976026 3:131026473-131026495 CTGCTGCAGGTCCGGGCGGCGGG - Intronic
962358142 3:134712741-134712763 TTGCTGCAGGGACGTCAGGCAGG + Intronic
963860676 3:150307146-150307168 CTGGTGCTGGGACTTGCTGCAGG + Intergenic
964179208 3:153864225-153864247 CTGCTGCTGGGAGATGGGGGAGG - Intergenic
965415315 3:168385219-168385241 CTGCTGCTGGGAGGTGGGAGAGG + Intergenic
968951897 4:3699767-3699789 CTGCTGCAGGGACCCGCGGGTGG + Intergenic
969986520 4:11217313-11217335 CTGCAGCAGGGAGGTGTGGCTGG + Intergenic
970931609 4:21518449-21518471 CTGCTGGTGGGAGATGCAGCGGG + Intronic
971798544 4:31259290-31259312 CTGCTGCAGGGAGGTGTGGAGGG + Intergenic
972253665 4:37331819-37331841 CTGCTGCTGGGAGTTGGGGGAGG - Intronic
972358430 4:38303918-38303940 CTGCAGCAGGGAGGTGCAGCAGG - Intergenic
973238018 4:47926978-47927000 CAGGTGCTGGGACTTGCGGGAGG - Intronic
975918255 4:79350433-79350455 CTGCTGCTAGGAAGTGGGGATGG + Intergenic
977536563 4:98261378-98261400 CCGCGGCGGGGACGAGCGGCGGG - Intronic
981897862 4:149825413-149825435 CTACTGCTGGTACTTTCGGCAGG - Intergenic
982076026 4:151737967-151737989 CTGCTGCTGGGCAGTGCAGAAGG + Intronic
982187717 4:152819443-152819465 CTGCTGCTGGTACCTGCTGCTGG + Intronic
999695716 5:154187301-154187323 CTGCTGCTGGGACTTGCCTATGG - Intronic
1000209886 5:159099238-159099260 CTGCCGCGGGGCCGGGCGGCGGG - Intronic
1002664257 5:180810878-180810900 GTGCTGTTGGTACCTGCGGCCGG + Intronic
1004044735 6:12012595-12012617 CTGCAGCTGGGGAGGGCGGCGGG + Intronic
1006467306 6:34203243-34203265 CTGCAGCAGGGAGGTACGGCTGG - Intergenic
1006500743 6:34457549-34457571 CTGCAGCAGGGAGGTGTGGCTGG + Intergenic
1007820729 6:44558825-44558847 CTGCTGCTAGAAGGTGGGGCTGG + Intergenic
1008921127 6:56844348-56844370 CTGCTGCTGGGCTCCGCGGCGGG + Intronic
1014692316 6:124577340-124577362 CTGCTGCTGGGGGGTGCAGGAGG - Intronic
1018081612 6:160263673-160263695 GTGCAGCTGGGATGTGCTGCAGG + Intronic
1018182205 6:161234044-161234066 CTGCTCCTGAGATGTGAGGCGGG + Intronic
1018331042 6:162727725-162727747 CCGCTGGTGGGAGGCGCGGCTGG - Exonic
1019033606 6:169034888-169034910 CTGCTGCTGGGACTGGGTGCCGG + Intergenic
1019663454 7:2239168-2239190 CTGGTGCTGGTACCTGCGGGCGG + Intronic
1019814405 7:3189186-3189208 GTGCTGCTGGAACCTGCAGCAGG + Intergenic
1019898063 7:3998271-3998293 CTGTTGCAGGGAGGTGCTGCCGG - Intronic
1021609825 7:22446036-22446058 CTGCTGCTGTGACTTGCTTCTGG - Intronic
1024254638 7:47531716-47531738 CTGCAGCAGGGAGGTGAGGCTGG + Intronic
1026501164 7:70944548-70944570 GTGCTGCTGGGACTTGAGGATGG - Intergenic
1028207675 7:88034879-88034901 CTGCTGCTGGGGTGTGGGGAAGG + Intronic
1029112016 7:98217435-98217457 CTGCTCCTGGGACGAGCTCCGGG + Exonic
1029488374 7:100856936-100856958 CTGCTGCTGGGCCTTGTGGGTGG + Exonic
1029621394 7:101692047-101692069 TTGCTGCTTGGATGTGCTGCTGG - Intergenic
1029736853 7:102469841-102469863 CTGCTGCTGGGACGTGCGGCTGG + Exonic
1030196564 7:106858976-106858998 CTCCTGCAGGGACCTGGGGCGGG - Intergenic
1034491949 7:151397596-151397618 CTGCTGCTGCAAAGTGCGGGAGG + Intronic
1034950970 7:155297260-155297282 CTGCTCCTGGGTGGTGCGGGTGG + Intergenic
1035382864 7:158450988-158451010 GTGCAGCTGCGACGTGGGGCGGG - Intronic
1037701889 8:21282953-21282975 CTGCTGCTAGGAAGTGGGGGAGG + Intergenic
1042162504 8:65911760-65911782 CTGCTGCTGGGGCATGGGGGAGG - Intergenic
1044296842 8:90537538-90537560 CAACTGCTGGGACGTTGGGCAGG + Intergenic
1048254648 8:132896532-132896554 CTCCTGCTGGCACTTGGGGCAGG - Intronic
1049200222 8:141336456-141336478 CTGGTGCTGGGAAGTGGGGTTGG + Intergenic
1049241727 8:141540778-141540800 CGGCTGCTGGGAAGTGGAGCAGG - Intergenic
1049434239 8:142579154-142579176 TTGCTGCTGGGGCGGCCGGCAGG + Intergenic
1049496257 8:142935191-142935213 CTGCTGCTGCCACCTGCAGCAGG - Intergenic
1049566995 8:143345480-143345502 CTCCTGCTGCCACGCGCGGCTGG + Intronic
1049659194 8:143812168-143812190 CTGCTGCTGGGGGGTGCTGGTGG - Intronic
1049674753 8:143884453-143884475 CAGCTGCTGGGACATGGGGGCGG + Intergenic
1049766650 8:144358235-144358257 CGGCTGCCGGGGAGTGCGGCGGG + Exonic
1049817824 8:144616131-144616153 CTGCTGCTTGGCCCTGGGGCTGG + Intergenic
1050907024 9:11016953-11016975 CTGCTGCTGGGAGGTGGAGAGGG + Intergenic
1051991956 9:23162640-23162662 CTGCTGCTGGGACAGGGGGTAGG - Intergenic
1052056285 9:23911163-23911185 CTGCTGGTGGGAGGTGGGGAGGG - Intergenic
1059566158 9:115385209-115385231 CTGCAGCAGGGAAGTGCAGCTGG + Intronic
1060044897 9:120332158-120332180 CTGCGGGTGGGGCGTGCTGCTGG - Intergenic
1061291177 9:129651123-129651145 CCGGTGCTGGGACCTGGGGCCGG - Intergenic
1061371831 9:130201736-130201758 CTGCAGCTTGGACTTGAGGCAGG - Intronic
1061391154 9:130317919-130317941 CTGCAGCTGGGCTCTGCGGCTGG + Intronic
1061939956 9:133878665-133878687 CTCCTCCTGAGACGGGCGGCAGG - Intronic
1062184591 9:135211274-135211296 CTGCAGCAGGGAGGTGTGGCTGG + Intergenic
1062346767 9:136118601-136118623 ATGGTGCTGGGGCGCGCGGCTGG + Exonic
1186879882 X:13854206-13854228 CTGCTGCAGGGAAGTGTGCCTGG + Intronic
1189360020 X:40343304-40343326 CTGCAGCAGGGAGGTGTGGCTGG + Intergenic
1193650141 X:84122179-84122201 CTGCTGCTGGGGCATGGGGAAGG - Intronic
1193808262 X:86019056-86019078 CTGCTTCTGGGAGGTGGGACAGG + Intronic
1197380944 X:125737592-125737614 CTGCTGCTGGGATATGGGGCAGG + Intergenic
1197435779 X:126426018-126426040 CTGCTGCTGGGGTGTGGGGGAGG + Intergenic
1199745699 X:150770875-150770897 CTGCTGCTGGGAGGAGCAGTTGG - Intronic
1200384948 X:155881219-155881241 CGGCTCCTGGGAAGTGCGGGGGG + Intergenic