ID: 1029737221

View in Genome Browser
Species Human (GRCh38)
Location 7:102471669-102471691
Sequence GTCTGCTTGGAGAAGTGTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029737221 Original CRISPR GTCTGCTTGGAGAAGTGTCC CGG (reversed) Intronic
900197907 1:1386435-1386457 GTGTGCTTGTGAAAGTGTCCAGG - Intronic
900575130 1:3379199-3379221 GTGTGCTGGGAGAGGTGTGCTGG - Intronic
902071715 1:13745355-13745377 GTCTGCTGGAAGAACAGTCCAGG + Intronic
902158900 1:14513106-14513128 GCCTGCTTGGGGATGTCTCCAGG + Intergenic
904499741 1:30907250-30907272 TTCTTGTTGGACAAGTGTCCAGG - Intronic
905325862 1:37151685-37151707 GTCTGCCTGGTGATGTGGCCTGG - Intergenic
905620089 1:39437711-39437733 CTCTTCTTGGAGAAGTGTTAGGG - Intronic
906460473 1:46032245-46032267 CCCTGCTTGGAGAAGAGTCCCGG - Exonic
910292479 1:85612855-85612877 CTCTTTTTGGAGAAGTTTCCAGG - Intergenic
911182373 1:94872547-94872569 GTCTCCTGGGAGAAGCTTCCAGG + Intronic
915164201 1:153939551-153939573 CTCTGCTTGGAGATGTATCATGG - Intronic
920334896 1:205238474-205238496 GTCTGCTGGGACAAAGGTCCTGG + Intronic
921104103 1:211959119-211959141 GGCTGCTTAGAGAAGTGTTAGGG + Intronic
921284259 1:213594895-213594917 TCCTGCTTGGAAAAGTGGCCTGG + Intergenic
1063254246 10:4308749-4308771 GTCTGCTTGTAGATGTGAACTGG - Intergenic
1063599212 10:7464819-7464841 GTCTCCTTGGAAACGTGTCAGGG + Intergenic
1063875946 10:10478752-10478774 GTCTGCTTCCAAAAGTGTCTGGG - Intergenic
1063961138 10:11306208-11306230 CTCTGCTTGAAGAGGTGTTCTGG + Intronic
1072415997 10:95247424-95247446 GTCTGCCTGGAGGAGGTTCCTGG - Intronic
1072460722 10:95616367-95616389 GTCTGCTTGTAGTAGTGTCTTGG + Intronic
1072621299 10:97081251-97081273 CTCTGCTCAGAGAAGTGACCAGG + Intronic
1073457317 10:103645529-103645551 GTCTGCTTGGATACCTGACCCGG + Intronic
1074482685 10:113839907-113839929 GTGTCCTTGGAGGAGTGACCTGG - Intronic
1075180383 10:120205793-120205815 CTCAGCATGCAGAAGTGTCCAGG - Intergenic
1075314201 10:121438990-121439012 CTCTGCTTGGAGCAGCCTCCAGG - Intergenic
1075592062 10:123699099-123699121 GTCTGCTTAGAACAGTGGCCTGG - Intergenic
1076734258 10:132451715-132451737 GTCTCCTGGGAGAAGGTTCCTGG - Intergenic
1077106394 11:844253-844275 GGCTTCTTGGAGGAGGGTCCAGG + Intronic
1081845411 11:46237683-46237705 GAGTGCCTGGAGAAGTGTTCAGG + Intergenic
1082193487 11:49274248-49274270 AGCTGCTTGGAGAAGTGTCAGGG - Intergenic
1089681343 11:120120611-120120633 GTCTCCTTGGTGAAGCGGCCAGG + Exonic
1090646588 11:128771349-128771371 GTCTGCTTTGTAAAGTGCCCAGG - Intronic
1098205123 12:68100970-68100992 GTCTGCTGGAAGCAGTGTCTTGG - Intergenic
1098528965 12:71519094-71519116 GTAAGGTTGGAGAGGTGTCCAGG - Intronic
1100106371 12:91178508-91178530 TTCTGCTTGCACAAGTTTCCTGG - Exonic
1102177518 12:110886846-110886868 GTCTTCCTGGACAAGGGTCCAGG + Intronic
1104638814 12:130454395-130454417 GTCTGCAGGGAGGAGTGTCCTGG + Intronic
1107187923 13:37546345-37546367 CTCTGCTTGGTGAAGAGTCAGGG + Intergenic
1113629174 13:111869290-111869312 GTTTTGTTGGAGAAGGGTCCAGG + Intergenic
1113799643 13:113079779-113079801 GTCTGCACGGAGGAGGGTCCAGG + Intronic
1113799650 13:113079811-113079833 GTCTGAATGGAGGAGGGTCCAGG + Intronic
1113799686 13:113079971-113079993 GTCTGAATGGAGGAGGGTCCAGG + Intronic
1113799722 13:113080131-113080153 GTCTGAATGGAGGAGGGTCCAGG + Intronic
1113877418 13:113603011-113603033 GGCTGCATGCAGAGGTGTCCTGG + Intronic
1114184615 14:20391095-20391117 GGCTGATTGGACAAGTGTCAGGG + Exonic
1120348750 14:83326251-83326273 GTCTCCTTGGATAAGTGACCTGG - Intergenic
1120930790 14:89846256-89846278 GACTGGTAGGGGAAGTGTCCTGG - Intronic
1121909601 14:97776997-97777019 GTGTGGCTGGAGAAATGTCCAGG - Intergenic
1123017490 14:105382324-105382346 GCCAGCTTGGAGAACTGCCCTGG - Intronic
1123936052 15:25194589-25194611 GCGTGCTTGGAGAAGGATCCTGG + Intergenic
1124254189 15:28127650-28127672 GGCTCCTTGGAGAAATGGCCAGG + Intronic
1125825401 15:42672234-42672256 GTCACCTTGGGGAAGTGTCTTGG + Intronic
1125826639 15:42682113-42682135 GTCTGCTCAGAGAAGAGACCTGG + Exonic
1127181862 15:56429143-56429165 ATCTGCTTGGTGAAGAGTTCAGG - Exonic
1129614497 15:77087488-77087510 GCCTGGTTGCAGAAGTGTGCAGG - Intergenic
1131230188 15:90654031-90654053 GTCTGCTCTGGGAAGTGCCCAGG - Intergenic
1132055994 15:98650229-98650251 GGGCGCTTGGAGACGTGTCCTGG - Intronic
1134384479 16:13758951-13758973 ATCTCCCTGGAAAAGTGTCCTGG - Intergenic
1137586238 16:49665402-49665424 GTTTGCTAGGAGAAGTGTGTGGG + Intronic
1141479115 16:84294657-84294679 GCTTGCTTGGAGACGTGGCCGGG - Exonic
1141652754 16:85402328-85402350 GTCTGGTTGGAGAAGCTGCCAGG + Intergenic
1141705835 16:85663990-85664012 GTCTGCTGGGTGTTGTGTCCTGG + Intronic
1142315000 16:89338132-89338154 GGGTGCTTGGGGCAGTGTCCTGG - Intronic
1142521379 17:507277-507299 CTCTGCTTGCAGAAGTGAACAGG - Intergenic
1144703724 17:17354167-17354189 GCCTGCTTGGCGAAGTGAGCTGG + Intergenic
1151544996 17:74787298-74787320 GTCTGCTGGCAGAGTTGTCCTGG + Intronic
1152210620 17:79001281-79001303 GTCTCCTGGGAGAAGTGGGCCGG - Intronic
1156696561 18:39774689-39774711 GACAGCTGGGAGAAGTGACCAGG + Intergenic
1156968808 18:43130252-43130274 GTCTGCTGGGAGCACTGTTCAGG + Intergenic
1160394484 18:78561848-78561870 GGCTGCTTGTGGAAGGGTCCAGG - Intergenic
1160402795 18:78622941-78622963 TTCTGACTGAAGAAGTGTCCGGG + Intergenic
1162384781 19:10354304-10354326 ATCTGCCTGGAGGAGTGGCCCGG - Intronic
925144302 2:1570559-1570581 CTCTGCTTGGTCAAGCGTCCTGG - Intergenic
925363088 2:3293254-3293276 GCCTGCTAGGAAAGGTGTCCTGG - Intronic
925385857 2:3461254-3461276 GCCTGCTCGGAGCAGTGCCCGGG - Intronic
927583141 2:24273406-24273428 CTAGGCTTGGAAAAGTGTCCCGG - Intronic
927910028 2:26890899-26890921 ATCTGCTAGGATTAGTGTCCTGG - Intronic
928111210 2:28510353-28510375 CTCTGCTTGGACCAGTGCCCTGG + Intronic
929804945 2:45136716-45136738 GTCTGCCTGGAGATGTGTCTTGG + Intergenic
933395041 2:81720417-81720439 GGCTCCTTGGTGAAGTTTCCCGG + Intergenic
933994127 2:87655429-87655451 GTCTGCATGGTGAAGGGCCCAGG + Intergenic
935184686 2:100721549-100721571 TTCTGACTGGAAAAGTGTCCAGG - Intergenic
936299738 2:111295484-111295506 GTCTGCATGGTGAAGGGCCCAGG - Intergenic
942861268 2:180615505-180615527 TTCTACTGGGAGGAGTGTCCAGG - Intergenic
946553139 2:220824135-220824157 ATCTGCTTGGAGAAGAGTACAGG - Intergenic
948325799 2:237119721-237119743 CTCTGCTTGGAGAAGTGCAGTGG + Intergenic
948500904 2:238393044-238393066 ATTTGTTTGGATAAGTGTCCAGG + Intronic
948601055 2:239107709-239107731 GTTTCCTTGGGGAAGTGACCCGG + Intronic
948660014 2:239501264-239501286 CCCAGCTTGGAGAAGTGCCCCGG + Intergenic
1169278889 20:4250608-4250630 GCCTGTTTGCAGAAGTGTCTGGG + Intergenic
1171030149 20:21669669-21669691 CTCTGCTTGGGGCAGTGACCTGG - Intergenic
1171226251 20:23444251-23444273 GCCAGGTTGGAGAAGGGTCCAGG - Intronic
1171437629 20:25135502-25135524 GTCTGCTGTGAGGAGTGGCCTGG - Intergenic
1172789123 20:37490394-37490416 GTCTGATTGGAGATGTCTCAAGG - Intergenic
1173303216 20:41822780-41822802 AGCTGCTTGAAGAAGTTTCCAGG + Intergenic
1175989499 20:62780822-62780844 GTCTGCTCAGAGAAGAGCCCAGG + Intergenic
1179480636 21:41675423-41675445 GTCTTCTTGGAGAGGATTCCAGG + Intergenic
1179648822 21:42793372-42793394 TTCTGCTTGTAAGAGTGTCCAGG - Intergenic
1180009412 21:45040013-45040035 GTGTGCTGGGGGCAGTGTCCTGG + Intergenic
1180878182 22:19185077-19185099 GTCTTCCTGGAGGAGTGGCCAGG - Intronic
1182878632 22:33714079-33714101 GTCTGCATGGACCAGTTTCCAGG - Intronic
1184664505 22:45980718-45980740 GTCAGCATGGAGAACTGTCAAGG + Intergenic
1185159518 22:49214800-49214822 GTCTTCTTGGATTAGTGGCCTGG - Intergenic
1185184747 22:49392238-49392260 GTCTGCTTGAACAAGAGTCATGG - Intergenic
949217171 3:1583696-1583718 GTCTGCTTGGATAACAGCCCCGG + Intergenic
949382188 3:3458704-3458726 GTCTGGTTGGAAAAGGGGCCAGG + Intergenic
950620574 3:14202256-14202278 GGCTGCTTCTAGAAATGTCCTGG + Intergenic
954538216 3:51377097-51377119 GTCTGGTTGGGGTAGGGTCCTGG - Intronic
955778649 3:62461010-62461032 GTCTGCTTTGAGATGGGGCCTGG + Intronic
955824305 3:62929020-62929042 GTCTGCTGGGAGAATTGCTCTGG + Intergenic
958662315 3:97087056-97087078 GTCTGGCAGGAGTAGTGTCCAGG - Intronic
961492654 3:127266177-127266199 GTCTGCTCGGTGAAGTGGGCAGG - Intergenic
961963747 3:130880766-130880788 GTCTGTTTGGATGATTGTCCTGG + Intronic
963790432 3:149577558-149577580 CTCTGCTTAGAGAACTGCCCAGG + Intronic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
967873352 3:194250094-194250116 GGCTGCTGGGAGAAGTCTGCTGG - Intergenic
968006475 3:195246622-195246644 ATCAGCCTGGAGGAGTGTCCGGG - Intronic
969259294 4:6023439-6023461 GTCTGCTTAGAGATGGATCCTGG + Intergenic
972300084 4:37777064-37777086 GTATATTTGGAGATGTGTCCAGG + Intergenic
992794730 5:80245239-80245261 TTCTTCTTGGAAAAGTGTTCAGG + Intronic
992996313 5:82337406-82337428 ATGTGGTTGGAGAAGTGTCATGG + Intronic
993944032 5:94097006-94097028 AGCTGCTTGGAGAAGTGGCAGGG + Intronic
995853837 5:116573496-116573518 GTTTGCTCGAATAAGTGTCCGGG - Intronic
997404943 5:133638286-133638308 TTCTGCTTTGAGAATAGTCCTGG - Intergenic
997665578 5:135627301-135627323 GTCTGTTTGGGGCAGTGTCTAGG + Intergenic
1000867031 5:166526520-166526542 GTGTGCTTGGAGAAGTGTCCTGG - Intergenic
1001229001 5:169969747-169969769 GTCTGCTGGGAGACTTTTCCTGG - Intronic
1001346320 5:170902961-170902983 GCCTGCTGGGAGATGTCTCCCGG + Intronic
1003565000 6:7215251-7215273 GTCAGCTGGGAGAAGCATCCAGG + Intronic
1003975932 6:11344663-11344685 ATCTGCTTGGTGCTGTGTCCAGG + Intronic
1005725292 6:28641623-28641645 GTCTAATTGGAGCAGGGTCCTGG - Intergenic
1008130841 6:47719032-47719054 GTTTGCTTGGAGAGGTTTCGTGG + Intronic
1011965081 6:93145998-93146020 GTCTGCTTTAAGAAGTGTAATGG + Intergenic
1018695311 6:166386373-166386395 GTCTGCTTGTAGAAGGGGCTGGG + Intergenic
1018901371 6:168053484-168053506 GTCTGCTGGGAGACGTTTCGGGG - Intergenic
1021867363 7:24971470-24971492 GTCTGCTGCGAGATGTGTCATGG - Intronic
1024529993 7:50383690-50383712 TGCTGCTTGGAGAAGGGCCCTGG - Intronic
1025072806 7:55915737-55915759 GTGAGCTTGGAGAAGTGAGCAGG + Intronic
1026272268 7:68846862-68846884 GTTTGCTTGGTGAAGAGTGCAGG - Intergenic
1026734727 7:72942352-72942374 GTCTGCTTGAAGAAGGGAGCAGG - Exonic
1026785061 7:73297264-73297286 GTCTGCTTGAAGAAGGGAGCAGG - Intergenic
1027109018 7:75422666-75422688 GTCTGCTTGAAGAAGGGAGCAGG + Exonic
1027554679 7:79648462-79648484 AGCTGCTTGGAGAAGTGGCAGGG - Intergenic
1028471755 7:91213410-91213432 GTCTGCTTGGAGAAATCAACAGG + Intergenic
1029737221 7:102471669-102471691 GTCTGCTTGGAGAAGTGTCCCGG - Intronic
1036221667 8:6926107-6926129 GTCTGCTGGGAGAAGGCTCAGGG + Intergenic
1039001816 8:32989672-32989694 CTTTGCTTGGAGCAATGTCCTGG + Intergenic
1039672036 8:39612484-39612506 AGCTGCTTGGAGAAGTGGCAGGG + Intronic
1040537195 8:48320736-48320758 GTATGGCTGGAGAAGTGACCAGG + Intergenic
1040673520 8:49721266-49721288 TTCTGGTCAGAGAAGTGTCCTGG + Intergenic
1041451459 8:58010898-58010920 GTCTGCTTTGACAAATTTCCAGG + Intronic
1041707048 8:60857687-60857709 CACTGCTTGAAGAAGGGTCCAGG - Intronic
1042064829 8:64863210-64863232 GTCTTCTTGGAGAGAAGTCCAGG + Intergenic
1042254896 8:66792550-66792572 GTTTGCTTGGATAATTGCCCTGG - Intronic
1042889413 8:73590663-73590685 GTGTGCTTGGTAAGGTGTCCAGG - Intronic
1045033841 8:98162284-98162306 GACTGCATGGTGAAGCGTCCAGG + Intergenic
1045823334 8:106367901-106367923 GTATGCTTGGGGAACTGTCTAGG + Intronic
1046395394 8:113633344-113633366 GTCTGCAAGGAGACGTGGCCAGG - Intergenic
1046632080 8:116631255-116631277 GTCTCGGTGGAGAAGGGTCCTGG - Intergenic
1047025494 8:120819156-120819178 GTCTGCTTCCAGATGTGTTCTGG - Intergenic
1049554482 8:143275209-143275231 GCCTGGTTGGAGCTGTGTCCAGG + Intronic
1051265582 9:15306446-15306468 ACCTGCTAGGGGAAGTGTCCCGG + Intronic
1051791111 9:20803604-20803626 GGCTGCTTAGAGGAGTGTACAGG + Intronic
1056879794 9:90380188-90380210 GTCTCCTAGGAGATGAGTCCTGG - Intergenic
1061843617 9:133375238-133375260 GTCTCCTTCCAGAAGTGTCCAGG - Intronic
1062082977 9:134634151-134634173 GTCTGCAGGGAGAAGTGTCTAGG + Intergenic
1062088457 9:134661168-134661190 GTTTGGTTGGGGAAGTGTCGGGG + Intronic
1062479649 9:136745397-136745419 GTGTGCTTGGAGGGGTCTCCTGG - Intronic
1062679699 9:137772207-137772229 TTGTGCTTGGAGAGGTGTGCTGG - Intronic
1191680256 X:63833145-63833167 GCCTGCTTGGACAACTATCCTGG - Intergenic
1193350142 X:80454278-80454300 GTCTTCTGAGAGTAGTGTCCTGG + Intergenic
1194848318 X:98839257-98839279 AGCTGCTTGGAGAAGTGACAGGG - Intergenic
1195252625 X:103063698-103063720 GTCTGCGGGGCCAAGTGTCCCGG - Exonic
1199588603 X:149442957-149442979 TTCTCCTTGGAGAAGTGGACTGG + Intergenic
1200379551 X:155820241-155820263 GACTGCCTGGAGAATTCTCCTGG + Intergenic