ID: 1029741269

View in Genome Browser
Species Human (GRCh38)
Location 7:102493072-102493094
Sequence CAAGTGGGGCTCTGAGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 481
Summary {0: 4, 1: 0, 2: 2, 3: 35, 4: 440}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029741269_1029741287 30 Left 1029741269 7:102493072-102493094 CCGGCCTCTCAGAGCCCCACTTG 0: 4
1: 0
2: 2
3: 35
4: 440
Right 1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG 0: 4
1: 0
2: 0
3: 0
4: 36
1029741269_1029741286 29 Left 1029741269 7:102493072-102493094 CCGGCCTCTCAGAGCCCCACTTG 0: 4
1: 0
2: 2
3: 35
4: 440
Right 1029741286 7:102493124-102493146 TGGGCGTCTTCGCGAAGCTGAGG 0: 4
1: 0
2: 0
3: 5
4: 42
1029741269_1029741280 9 Left 1029741269 7:102493072-102493094 CCGGCCTCTCAGAGCCCCACTTG 0: 4
1: 0
2: 2
3: 35
4: 440
Right 1029741280 7:102493104-102493126 CTCCTTACCCACCTTGGAGCTGG 0: 4
1: 0
2: 1
3: 14
4: 160
1029741269_1029741276 3 Left 1029741269 7:102493072-102493094 CCGGCCTCTCAGAGCCCCACTTG 0: 4
1: 0
2: 2
3: 35
4: 440
Right 1029741276 7:102493098-102493120 GCCTCCCTCCTTACCCACCTTGG 0: 4
1: 0
2: 0
3: 47
4: 406
1029741269_1029741281 10 Left 1029741269 7:102493072-102493094 CCGGCCTCTCAGAGCCCCACTTG 0: 4
1: 0
2: 2
3: 35
4: 440
Right 1029741281 7:102493105-102493127 TCCTTACCCACCTTGGAGCTGGG 0: 4
1: 0
2: 0
3: 9
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029741269 Original CRISPR CAAGTGGGGCTCTGAGAGGC CGG (reversed) Intronic
900098177 1:948825-948847 CGAGTGGGGCTCTGATCAGCAGG + Intronic
900108742 1:996934-996956 CGAGGGGGGCTCTGAGAAGGGGG + Intergenic
900125434 1:1067030-1067052 CAAGGGGTCCTCAGAGAGGCTGG + Intergenic
900447891 1:2690623-2690645 CAGGTGAGCATCTGAGAGGCTGG + Intronic
900450742 1:2748403-2748425 CAGGTGAGCATCTGAGAGGCTGG + Intronic
900557150 1:3286367-3286389 CACCTGGGGCTCTGCCAGGCAGG - Intronic
902226014 1:14996823-14996845 CATGTGGGGCACTGGGAGGGAGG + Intronic
902616747 1:17627853-17627875 CAAGTGAGGTTCAGAGAGGGTGG - Intronic
902686335 1:18080039-18080061 GAACTGGGGGTCTGAGTGGCGGG - Intergenic
902729580 1:18360674-18360696 CAAGTGAGGCTCTAAGATTCTGG + Intronic
903321266 1:22544673-22544695 CCTGTGGGGCTCTCAGAGACAGG - Intergenic
903370433 1:22831815-22831837 CAAGAGGGGCTGTGTTAGGCTGG + Intronic
903515594 1:23908904-23908926 CAAGGGAGCCTCTGAGAGACAGG + Intronic
903733647 1:25516427-25516449 AAACTGAGGCTCAGAGAGGCAGG + Intergenic
904260091 1:29283268-29283290 GAGGTGGGGCTGTGGGAGGCGGG - Intronic
904830734 1:33305045-33305067 AAACTGGGGCCCTGAGAGACTGG - Intergenic
905227398 1:36488218-36488240 GAGCTGGGGGTCTGAGAGGCAGG - Intergenic
907388708 1:54142384-54142406 CCAATGAGGCTCAGAGAGGCTGG - Intronic
907749276 1:57246601-57246623 CTAGTGGAGCTGTGAGAGGAGGG + Intronic
909360844 1:74757203-74757225 CTAGTGGAGCTGTGAGAAGCGGG + Intronic
910350295 1:86288647-86288669 CTAGTGGGGTTCTTAGTGGCAGG + Intergenic
911855300 1:102868947-102868969 CTAGTGGGGCTGTGAGAAGACGG - Intergenic
912937975 1:114020461-114020483 CTAGTGGAGCTGTGAGAGGAGGG + Intergenic
913316566 1:117558761-117558783 CTAGTGGAGCTGTGAGAGGAGGG - Intergenic
913550354 1:119911184-119911206 CAACTTGAGCTCTGAGTGGCCGG + Intergenic
915473647 1:156139885-156139907 CAAGTGGGGTGCTGGGAGGAGGG + Exonic
915710903 1:157897086-157897108 CTAGTGGAGCTATGAGAGGAGGG - Intronic
916662726 1:166936886-166936908 CAAGAGGAACTCTGAGAGTCAGG + Intronic
916689929 1:167180371-167180393 GAATTGGGGGTCTGAGAGGGTGG + Intergenic
917979501 1:180260247-180260269 CAAGTGGGTCACTGAGACGCTGG - Intronic
918591370 1:186245134-186245156 CAAGTGGAGCTGTGAGAAGAGGG - Intergenic
918638017 1:186803041-186803063 CATTTGGGGTTCTGAGAGGCAGG + Intergenic
920860282 1:209700120-209700142 CTAGTGGAGCTGTGAGAGGAAGG - Intronic
921786071 1:219230907-219230929 CAAGTGGGATTCTGTGAGTCTGG - Intergenic
922729481 1:227942304-227942326 CAGGTGGGGCAGGGAGAGGCTGG + Intronic
922934408 1:229412181-229412203 CAAGTGCAGCTCTGAAAGGCAGG - Intergenic
923033530 1:230268131-230268153 AAAGTGGAGCTCTGTGAGGGAGG + Intronic
924759201 1:246968532-246968554 CAAGTGGAGCTGTGAGAAGAGGG - Intronic
1062978542 10:1702696-1702718 AATGTGGGGCCCAGAGAGGCCGG - Intronic
1063087411 10:2832228-2832250 CACCTGGGGCTATGAGAGGCTGG - Intergenic
1063458439 10:6201391-6201413 GAACAGGGGCTCTGAGAGGGCGG + Intronic
1063661646 10:8038248-8038270 GGAGTGGGGCTGGGAGAGGCTGG - Intergenic
1065805260 10:29388266-29388288 AAAGTGCGGCTCTGAGAGTTAGG - Intergenic
1065943824 10:30588952-30588974 AAAGTGCGGCTCTGAGAGTTAGG + Intergenic
1065991533 10:31014671-31014693 CAAGTGAGGCACTGGGAGGTTGG - Intronic
1067405995 10:46023678-46023700 CAAGTGGGGAGAGGAGAGGCTGG - Intronic
1067702020 10:48580562-48580584 CAGGCAGGGCTCTGAAAGGCTGG + Intronic
1069026980 10:63553152-63553174 GCAGTGTGGCTCTGAGAGGAGGG + Intronic
1069424542 10:68278112-68278134 CTAGTGGAGCTATGAGAGGAGGG + Intergenic
1069678303 10:70265453-70265475 CAAGTGGTCCACTGAGTGGCCGG + Intronic
1070536469 10:77381844-77381866 CAAGTGGGGCTCTGAGAGCAAGG + Intronic
1070651448 10:78239949-78239971 CAAGTGGGGTGCAGAGAGGAGGG - Intergenic
1070683055 10:78462530-78462552 CATGTGGGGCTCTGGCAGCCAGG + Intergenic
1071275381 10:84049386-84049408 GAAATGTGGCTCTGAAAGGCAGG + Intergenic
1071368115 10:84922166-84922188 GAGGTGGGGCACTGAGAAGCAGG + Intergenic
1073942247 10:108712446-108712468 CTAGTGGGGCTGTGAGAAGAAGG - Intergenic
1074037693 10:109757327-109757349 CAAGAGGGACCCTGGGAGGCTGG - Intergenic
1074863258 10:117529205-117529227 TAGGAGGGCCTCTGAGAGGCTGG + Intergenic
1075476233 10:122736749-122736771 CATGTGGGGCTCAGTGTGGCTGG + Intergenic
1075735648 10:124663160-124663182 CCACTGCAGCTCTGAGAGGCAGG - Intronic
1076689785 10:132217012-132217034 CTAGTGGAGCTCTGAGAAGAGGG + Intronic
1076814820 10:132909559-132909581 CTAGTGGGGCCCAGGGAGGCGGG - Intronic
1077463773 11:2723810-2723832 CAAATGGGACACAGAGAGGCTGG - Intronic
1077487181 11:2844403-2844425 CAACTGGGGCTTTGAGGGACTGG - Intronic
1077502805 11:2916935-2916957 GAAGTGGGGCTCCGGCAGGCAGG + Intronic
1077867361 11:6234350-6234372 AATGAGGGGCTGTGAGAGGCTGG - Intronic
1078490451 11:11763133-11763155 AAACTGAGGCTCAGAGAGGCTGG + Intergenic
1078516084 11:12023579-12023601 CAAGTGGAGCTGTGAGAAGATGG + Intergenic
1078748997 11:14142412-14142434 CAAGTGGGGATAGGAGGGGCAGG - Intronic
1078989904 11:16636066-16636088 CTAGTGGTGCTGTGAGAGGAAGG + Intronic
1079064316 11:17276515-17276537 GACGTGGCGCTCTGAGATGCGGG - Intronic
1079181919 11:18201371-18201393 CTAGTGGAGCTGTGAGAAGCGGG - Intronic
1079798984 11:24845028-24845050 CTAGTGGAGCTGTGAGAGGAGGG + Intronic
1081136889 11:39450143-39450165 CTAGTGGAGCTCTGAGAAGAGGG - Intergenic
1081606309 11:44529286-44529308 CAAGATGGCCTCTGAGAAGCGGG - Intergenic
1082788448 11:57330629-57330651 CCAGTGGGGCTGGGAGAGGGAGG - Intronic
1083134726 11:60661584-60661606 CAAGGGGGGCTGTGAGAGACAGG - Intergenic
1083665504 11:64271928-64271950 GGACTGGGGCTCTGAGAGGTGGG - Intronic
1083667512 11:64284055-64284077 AAACTGGGGCTCTGAGAGTTTGG + Intronic
1084304281 11:68271710-68271732 TGAGTGGGGCTGAGAGAGGCAGG - Intronic
1085448533 11:76617005-76617027 AAACTGAGGCTCAGAGAGGCTGG + Intergenic
1087918919 11:103843886-103843908 GAAGTGGGCCTTTGAGAAGCGGG + Intergenic
1088816727 11:113426246-113426268 TGCGTGGGGCTCTGGGAGGCTGG + Intronic
1088993588 11:114976453-114976475 CAAGACGGGCTCTGGGTGGCAGG + Intergenic
1089291300 11:117439246-117439268 AAGGTGAGGCTCTGTGAGGCAGG - Exonic
1089730187 11:120514380-120514402 AAACTGAGGCTCAGAGAGGCTGG + Intronic
1089783134 11:120888338-120888360 AAACTGAGGCTCTGAGAGGTTGG - Intronic
1090431426 11:126649790-126649812 CTAGTGGAGCTGTGAGAGGAGGG - Intronic
1090504678 11:127298305-127298327 CCAGTGGAGCTGTGAGAAGCGGG + Intergenic
1091128945 11:133127881-133127903 CAAACGGGGCTCTGAGTGACGGG + Intronic
1091322190 11:134659573-134659595 CAGGTGGGGCTGGGAGAGGTGGG + Intergenic
1091539718 12:1448800-1448822 CTAGTGGAGCTCTGAGAAGAAGG + Intronic
1092097001 12:5850981-5851003 CAACTGAGGCTCTGAGAGATGGG + Intronic
1092782793 12:12002871-12002893 GAAGTGGGGAGCTGAGAGGCAGG + Intergenic
1093014760 12:14144779-14144801 CAAGTGGAGCTGTGAGAAGAAGG - Intergenic
1093590414 12:20895722-20895744 CTAGTGGGGCTGTGAGAAGAGGG - Intronic
1093596874 12:20972750-20972772 CTAGTGGAGCTGTGAGAGGAGGG + Intergenic
1094510404 12:31092941-31092963 TGCGTGGGCCTCTGAGAGGCAGG + Intronic
1096024009 12:48345702-48345724 CAAGTGGGGCCATGAGAAGCTGG + Intronic
1096182315 12:49557639-49557661 CAGGGGGAGCTCTGAGACGCTGG - Exonic
1096231961 12:49901788-49901810 CATGTGGCCCACTGAGAGGCAGG + Intronic
1096566125 12:52480634-52480656 CTAGTGGGGCTGTCAGAAGCGGG + Intergenic
1097145658 12:56937703-56937725 CAACTGGGGCTCTCCAAGGCTGG - Intergenic
1097339906 12:58426020-58426042 CAAGTGTGGTTCTGAGAAGTTGG - Intergenic
1098055093 12:66496738-66496760 CACGTGGTGCTCTGAGATTCAGG + Intronic
1098294504 12:68990784-68990806 CTAGTGGAGCTGTGAGAGGAGGG + Intergenic
1098614696 12:72508206-72508228 CAAGTGGGGCTGTGAGAAGAGGG + Intronic
1098926851 12:76360524-76360546 CTAGTGGAGCTGTGAGAAGCGGG - Intronic
1100230287 12:92600136-92600158 CAAGTGGAGCTTTGAGAAGAGGG - Intergenic
1100395790 12:94185487-94185509 CAAGTAGGGCGGTGAGAGGCAGG - Intronic
1100898822 12:99215384-99215406 CAAGTGGAGCTGTGAGAAGAGGG + Intronic
1101473925 12:105025847-105025869 ACAATGGGGCTCAGAGAGGCTGG - Intronic
1102006684 12:109593472-109593494 CAGGGGGTGCTCTCAGAGGCAGG + Intronic
1102182003 12:110919906-110919928 CAACTGAGGCTCAGAGAGGTTGG + Intronic
1102247781 12:111366108-111366130 CAAGTGGTGGCCTGAGAGGTAGG - Exonic
1102536275 12:113583695-113583717 CAAGTGAGTCAGTGAGAGGCTGG - Intergenic
1102697288 12:114809777-114809799 CAAATGGGCATCTGAGAGGCTGG + Intergenic
1103058764 12:117842274-117842296 GAAGTGGGACTCTGAGAAGCTGG + Intronic
1103486018 12:121283135-121283157 CCAGTGGGGTTCGGAGAAGCCGG + Intronic
1103532496 12:121612067-121612089 CAGATGGGGCTCAGAGAGGCTGG + Intergenic
1103718026 12:122957412-122957434 GAAGTGAGGCTCAGAAAGGCTGG + Intronic
1104373888 12:128247426-128247448 CAAGTGTGGCACTGGCAGGCCGG - Intergenic
1104775848 12:131389755-131389777 CAAGTGGAGCCCTGGGAGGTGGG - Intergenic
1105202130 13:18190050-18190072 CCAGTGGGGGTCTCAGAAGCAGG + Intergenic
1105407783 13:20145894-20145916 CAGGTGGGGCTGTGGGAGGATGG - Intronic
1106929867 13:34652391-34652413 CTAGTGGAGCTCTGAGAAGAGGG + Intergenic
1108874243 13:55025378-55025400 CTAGTGGAGCTGTGAGAAGCGGG + Intergenic
1109963762 13:69665864-69665886 GAAGTGGGGTGCTGAGAGGGAGG + Intergenic
1111218783 13:85178545-85178567 CTAGTGGAGCTGTGAGAGGAGGG - Intergenic
1111572650 13:90107227-90107249 CAAGTTGGTCTTTCAGAGGCAGG + Intergenic
1111951536 13:94712516-94712538 CAAAGGGGGCTCTCAGCGGCTGG + Intergenic
1112146433 13:96705531-96705553 GAAGAGGGACACTGAGAGGCTGG - Intronic
1113061065 13:106323178-106323200 CTAGTGGAGCTGTGAGAGTCAGG + Intergenic
1113375240 13:109759281-109759303 CAAGCAGGTCTGTGAGAGGCAGG - Intronic
1113645328 13:111990920-111990942 CTAGTGGAGCTCTGAGAAGAGGG + Intergenic
1114527026 14:23372921-23372943 CAAGTGGGGCACTGACTGACAGG - Exonic
1115113709 14:29855126-29855148 CAAGTGGAGCTGTGAGAAGAAGG + Intronic
1115226895 14:31112505-31112527 CAAGTGGGGCTCTGCCAGACTGG - Exonic
1115896047 14:38088535-38088557 CAAGTGGGAATCACAGAGGCAGG - Intergenic
1115929788 14:38478215-38478237 CTAGTGGAGCTCTGAGAAGACGG + Intergenic
1116931319 14:50694084-50694106 CAAGTGGAGCTGTGAGAAGAGGG - Intergenic
1118327193 14:64789496-64789518 CAAGTGGGTCAGTGAGAGGAAGG + Intronic
1118747224 14:68782883-68782905 CTAGCTGGGCTCTGAGCGGCCGG - Intergenic
1119734737 14:76974762-76974784 CAGGTGGGGCAGTGAGAGGCAGG - Intergenic
1120996339 14:90421184-90421206 CAAGTGGGACTCTCTGGGGCAGG - Intergenic
1121128867 14:91427431-91427453 CTAGTGGAGCTGTGAGAGGAGGG + Intergenic
1122427634 14:101621013-101621035 CAAGTGGGGCTCTGGTTTGCAGG - Intergenic
1123760102 15:23425283-23425305 CAAGGGAGGCACAGAGAGGCTGG - Intergenic
1124247801 15:28085590-28085612 CAAGTGTGTCCTTGAGAGGCTGG - Intronic
1124496194 15:30188843-30188865 CAATTGAGGCTCAGAGAGGTTGG + Intergenic
1124747380 15:32349804-32349826 CAATTGAGGCTCAGAGAGGTTGG - Intergenic
1125230813 15:37453067-37453089 CAAGTGGAGCTGTGAGAAGAGGG + Intergenic
1126806407 15:52353767-52353789 CAAGTGGTGCTTGGATAGGCTGG + Intronic
1127123960 15:55794312-55794334 CTAGTAGGGCTGTGAGAAGCAGG + Intergenic
1127343212 15:58067374-58067396 CACTTTGGGTTCTGAGAGGCTGG - Intronic
1128889600 15:71318810-71318832 CAAGTGTGAACCTGAGAGGCAGG + Intronic
1129467601 15:75732608-75732630 CAATTGAGGCTCAGAGAGGGTGG + Intergenic
1129719613 15:77870981-77871003 CAATTGAGGCTCAGAGAGGGTGG - Intergenic
1129975942 15:79821781-79821803 CAAGAGGGCCTCAGAGTGGCTGG - Intergenic
1130399598 15:83537115-83537137 CAAGGGGGACTCAGGGAGGCTGG + Intronic
1131118469 15:89808690-89808712 CATGTGGGGCCCTGACATGCTGG - Intronic
1131967541 15:97859997-97860019 CAAGTGGGAATCTGAGGGCCAGG - Intergenic
1132740638 16:1410793-1410815 CAAATGGGGCTTTCAAAGGCAGG - Intronic
1132802028 16:1759218-1759240 CTTGTGGGGTTCAGAGAGGCTGG - Intronic
1132999281 16:2841010-2841032 CGAGTGGGGCTCTGAAAGTGAGG + Intergenic
1133170984 16:3982389-3982411 CTAGTGGGACTCTGCTAGGCCGG + Intronic
1133303744 16:4797818-4797840 CGAGTGGGGCTCTCAGCGCCTGG - Exonic
1134860712 16:17557851-17557873 ACAGTGGGTCTCTGAGATGCAGG - Intergenic
1135115343 16:19718639-19718661 AAACTGAGGCTCGGAGAGGCTGG + Intronic
1135198696 16:20418118-20418140 CAAGTGGAGCTTTGAGGAGCTGG + Exonic
1137044260 16:35641555-35641577 CAGCTGGGGTTCTGAGGGGCCGG - Intergenic
1139470800 16:67177211-67177233 GAGGTGAGGGTCTGAGAGGCTGG - Intronic
1139597942 16:67968845-67968867 CATCTGGGGCTCAGAGAGGGCGG - Intronic
1139959973 16:70711914-70711936 CACGGCGGCCTCTGAGAGGCCGG + Intronic
1139965742 16:70744460-70744482 CACCTGGAGCTCTGAGTGGCTGG + Exonic
1141158995 16:81616845-81616867 CAAGTGCTGCTGTGAGAGGCAGG + Intronic
1141463404 16:84191545-84191567 CAGGTGGGTCTTTGAGCGGCAGG - Exonic
1141597233 16:85104829-85104851 CAAAAGGAGCTCAGAGAGGCGGG - Intronic
1141831296 16:86511195-86511217 CAGGTGGGGCACCGAGTGGCTGG - Exonic
1141919852 16:87128421-87128443 CCAGTGGGGTTCTCAGAAGCTGG - Intronic
1142114691 16:88350493-88350515 AAACTGAGGCTCTGAGAGGGAGG - Intergenic
1142148499 16:88502550-88502572 ACAGTGGGGCTCTGGGAGGCTGG - Intronic
1142347377 16:89562443-89562465 CACGTGGGTATCTGAGATGCGGG + Intronic
1142390850 16:89798792-89798814 AATGTGGGGGGCTGAGAGGCAGG + Intronic
1142616658 17:1140388-1140410 CAGGTGTGGATCTGGGAGGCCGG + Intronic
1143756126 17:9068880-9068902 CAAAAGGGGCTCTAAGATGCAGG + Intronic
1144006714 17:11106946-11106968 AAAGTGGGGGTGTGAGAGCCAGG - Intergenic
1144285433 17:13769882-13769904 CTAGTGGAGCTGTGAGAAGCGGG - Intergenic
1145108357 17:20139262-20139284 CAAGTTGGGATCCGAGATGCAGG - Intronic
1145828147 17:27892992-27893014 CCCGTGAGCCTCTGAGAGGCTGG + Intronic
1146524309 17:33552996-33553018 GAAGAGGGGCTCTGAGCAGCAGG + Intronic
1147614995 17:41822394-41822416 CACGAGGAGCTCTGAGGGGCAGG + Exonic
1148846408 17:50532616-50532638 CAAGTGGTGCATTGAGAGGTGGG - Exonic
1149016808 17:51917247-51917269 CATGATGGGCTCTGAAAGGCAGG + Intronic
1149361329 17:55898814-55898836 CATGTGGGGCTCTCAGAGTTGGG - Intergenic
1150287371 17:63961840-63961862 GAGGTGGGGCTTTGAGGGGCGGG - Intronic
1150687418 17:67331845-67331867 CTAGTGGGGCTGTGAGAAGTGGG + Intergenic
1151289838 17:73141714-73141736 CAAGTGGGGCACTAGGGGGCGGG + Intergenic
1151337380 17:73447856-73447878 CAGGAGGGGCCCTGGGAGGCTGG - Intronic
1151999726 17:77637679-77637701 CAAGAGGAGCTCAGAGAGGCAGG - Intergenic
1152227764 17:79100590-79100612 CATGGGGGGCCATGAGAGGCTGG + Intronic
1152244850 17:79179940-79179962 CAAGTGGGGCTCCTGGAGGTGGG + Intronic
1152644522 17:81462702-81462724 GCAGGGTGGCTCTGAGAGGCCGG - Intronic
1154008678 18:10557387-10557409 CATGCTGGGCCCTGAGAGGCAGG - Intergenic
1155089454 18:22492429-22492451 CAACAGTGGCTCAGAGAGGCCGG - Intergenic
1155163979 18:23218248-23218270 CAAGTGAGGATGTGGGAGGCAGG - Intronic
1156571131 18:38254495-38254517 AAGATGGGGTTCTGAGAGGCTGG + Intergenic
1159083472 18:63760983-63761005 CTAGTGGGGCTGTGAGAAGAGGG + Intronic
1159892285 18:73964205-73964227 CTAGTGGAGCTGTGAGAGGAGGG - Intergenic
1160169267 18:76539284-76539306 GAAGTGGGTTTATGAGAGGCAGG + Intergenic
1160856667 19:1220952-1220974 CCTGTGGGGCTCTGGGAGGAGGG - Intronic
1161233517 19:3187097-3187119 CAAGTGGGGTTCTGGGAAGTGGG - Intronic
1161727122 19:5936044-5936066 CACTTGGGGCTCTCTGAGGCAGG - Intronic
1161845372 19:6709128-6709150 CAACTGGGGCCCTGAGAGGCTGG - Intronic
1161978563 19:7619229-7619251 ACAGAAGGGCTCTGAGAGGCAGG + Intergenic
1162588807 19:11577615-11577637 CACCGGAGGCTCTGAGAGGCTGG + Exonic
1163144168 19:15369604-15369626 CCACTGGGTCTTTGAGAGGCGGG - Intronic
1163356383 19:16814246-16814268 AAACTGAGGCTCTGAGAGGCTGG + Intronic
1163533363 19:17863352-17863374 AAAGGGGTGCTATGAGAGGCCGG + Intronic
1163688630 19:18726250-18726272 TGCATGGGGCTCTGAGAGGCAGG - Intronic
1163698141 19:18774306-18774328 CCAGCAGGGCTCTCAGAGGCAGG - Intronic
1164489376 19:28692630-28692652 CTAGTGGAGCTGTGAGAAGCAGG + Intergenic
1164541428 19:29124315-29124337 TTAGTGGGGCTCTGAGAAGAGGG - Intergenic
1165027390 19:32971791-32971813 CGCGTGGGGCTCTGTGGGGCCGG - Intronic
1165044449 19:33093717-33093739 CTGCTGGGGCTCTCAGAGGCTGG + Intronic
1165346021 19:35249218-35249240 GAAGCGGGGGTCTCAGAGGCTGG + Intronic
1165384144 19:35500633-35500655 AAACTGGGGCTCTGAAAGCCCGG - Intronic
1165685179 19:37813567-37813589 CAGCAGGGGCTGTGAGAGGCAGG - Intronic
1165815899 19:38642101-38642123 CAGGAGGGGCTCTGAGAGAAGGG - Intergenic
1165928852 19:39343192-39343214 CCTGTTGGGCTGTGAGAGGCAGG - Intronic
1167647571 19:50713939-50713961 CAAGGGGGTCTCTGAAGGGCGGG + Exonic
1167921891 19:52788941-52788963 AAGGTGGGGCTCTGCGGGGCTGG - Intronic
924966985 2:86426-86448 CAAGTTGCTCTGTGAGAGGCAGG + Intergenic
925882059 2:8361163-8361185 GAATTTGGGCTCTGAGAGGCTGG - Intergenic
927714376 2:25342351-25342373 CTCGAGGGGCTCTGAGTGGCCGG - Intronic
928211900 2:29329611-29329633 CATGTGAGGCTCAGAGAGGCTGG - Intronic
929266880 2:39928420-39928442 CGAGTGGGGTGGTGAGAGGCTGG + Intergenic
929399565 2:41564245-41564267 CAAGTGGGGCTCTTAGATTGAGG - Intergenic
930144027 2:47982870-47982892 CAAGTGTTGCTCTGACAGCCAGG + Intergenic
930230162 2:48835182-48835204 CTAGTGGAGCTGTGAGAGGAAGG + Intergenic
930507774 2:52305563-52305585 CTAGTGGAGCTCTGAGAAGAGGG + Intergenic
931996831 2:67846587-67846609 CAAGTCTGGTTCTCAGAGGCCGG - Intergenic
932306489 2:70707333-70707355 CACGTGGGGCTCTGGCAGCCGGG - Intronic
932524017 2:72444428-72444450 CTAGTGGAGCTGTGAGAGGAGGG - Intronic
933947164 2:87296744-87296766 CTAGTGGAGCTCTGAGAAGAGGG - Intergenic
935385191 2:102492235-102492257 CTAGTGGGGCTGTGAGAAGAAGG - Intronic
935406699 2:102717556-102717578 CAAGCTGGGCTCTCAGAGGCAGG + Exonic
935497016 2:103794109-103794131 CAAGTGGAGCTATGAGAAGAGGG - Intergenic
936333027 2:111564824-111564846 CTAGTGGAGCTCTGAGAAGAGGG + Intergenic
936909392 2:117574920-117574942 CAAGTGGAACTCTGAGAAGAGGG - Intergenic
937972928 2:127564374-127564396 CAAGTGGGGACCTGGGTGGCAGG + Intronic
938243144 2:129758505-129758527 CGAGGGGGAATCTGAGAGGCTGG - Intergenic
938243996 2:129763550-129763572 CAAATGGCGCCCTGAGAGCCTGG + Intergenic
938792371 2:134688262-134688284 GAAGCAGGGCTCTGGGAGGCTGG - Intronic
939023955 2:136989702-136989724 CAAGATGAGCTCAGAGAGGCTGG + Intronic
941430578 2:165409176-165409198 CTAGTGGGGCTATGAGAAGAGGG + Intergenic
942846127 2:180428443-180428465 CTAGTGGAGCTGTGAGAGGAGGG - Intergenic
942991495 2:182208146-182208168 CTAGTGGGGCTGTGAGAAGAGGG + Intronic
943072162 2:183153776-183153798 CTAGTGGGGCTGTGAGAAGAGGG - Intronic
943205262 2:184886450-184886472 CTAGTGGAGCTGTGAGAGGAGGG - Intronic
943238066 2:185347915-185347937 CTAGTGGAGCTCTGAGAAGAGGG + Intergenic
943944752 2:194044809-194044831 CTAGTGGAGCTGTGAGAGGATGG + Intergenic
944540460 2:200749088-200749110 CAACTGGGTCTTGGAGAGGCTGG - Intergenic
945135063 2:206618226-206618248 GAAGTGGGGCTCCGAGAGGATGG - Exonic
945261099 2:207844144-207844166 CTAGTGTGGCTCTGAGAGTTGGG - Intronic
945767608 2:213999576-213999598 CTAGTGGGGCTGTGAGAAGAGGG + Intronic
946333927 2:219025245-219025267 CGAGGGGGACTCTGTGAGGCAGG + Intronic
947662695 2:231881867-231881889 TAAATGGGGCACTGAGTGGCAGG - Intergenic
947744767 2:232501910-232501932 CCCTTGGAGCTCTGAGAGGCTGG - Intergenic
1169072530 20:2742053-2742075 CAAAAGCAGCTCTGAGAGGCAGG - Intronic
1169609713 20:7364953-7364975 CTAGTGGAGCTGTGAGAGGAGGG + Intergenic
1170333157 20:15237700-15237722 CAAGTGGGGCTCTGTCTTGCTGG + Intronic
1170927775 20:20741534-20741556 CAAGTGGCACTCAAAGAGGCCGG - Intergenic
1171376803 20:24699446-24699468 CAAGTGAGGTTCTGAGAGGTTGG - Intergenic
1172608183 20:36229802-36229824 CAAGTGGGCCTTAGAGATGCTGG - Exonic
1174082431 20:47979933-47979955 AAACTGAGGCTCAGAGAGGCAGG + Intergenic
1174399452 20:50268079-50268101 GAAGTGGGGCCCTCAGAGGGTGG + Intergenic
1175727029 20:61325549-61325571 CAGGTGGGGGTCTGTGGGGCAGG + Intronic
1175985808 20:62763714-62763736 CATGAGGGGCTCAGAGTGGCTGG + Intergenic
1176237877 20:64062754-64062776 CAAACTGGGCTCTGGGAGGCTGG + Intronic
1177614392 21:23498951-23498973 CTAGTGGAGCTGTGAGAGGAGGG - Intergenic
1177620749 21:23590258-23590280 CTAGTGGAGCTGTGAGAGGAGGG + Intergenic
1178207514 21:30486754-30486776 CTAGTGGAGCTCTGAGAAGAGGG + Intronic
1178413774 21:32387316-32387338 CAAGTGATTCTCCGAGAGGCAGG - Intronic
1180048880 21:45322319-45322341 GAAGTGTGGCTCTCAGAGCCAGG - Intergenic
1181560275 22:23695971-23695993 CCAGTGGGGCTGGGATAGGCAGG + Intronic
1181915443 22:26276054-26276076 AAACTGGGGCTCTGAGAGAGAGG - Intronic
1183002712 22:34874965-34874987 CAGCTGGGGATCTGGGAGGCAGG + Intergenic
1183164811 22:36139663-36139685 AAACTGAGGCTCAGAGAGGCGGG + Intergenic
1184842123 22:47058225-47058247 CAAAGGTGGCTCTGAGGGGCTGG + Intronic
1185044831 22:48523637-48523659 CAAGTTGGGCACAGAGGGGCTGG - Intronic
1185277190 22:49954918-49954940 CCAGGGGGGCTTTGAGAAGCCGG - Intergenic
950453615 3:13079507-13079529 CAAGCAGGGCTGTGAGAGGCAGG + Intergenic
950468534 3:13170434-13170456 CAAGTGGAGCTGTGAGAAGAAGG + Intergenic
950609110 3:14113623-14113645 CAAGAGGGGCTCAGGGGGGCAGG - Intronic
950843218 3:15987992-15988014 CTAGTGGAGCTGTGAGAGGAGGG - Intergenic
952105502 3:30065396-30065418 CAAGTGGAGCTGTGAGAAGAGGG - Intergenic
952899307 3:38099116-38099138 CAAGGGGGTCTCTGGGTGGCTGG - Intronic
953881993 3:46695428-46695450 TATGTGGGACTCTGAGAGGAGGG + Intergenic
956000803 3:64728136-64728158 GAATGGAGGCTCTGAGAGGCTGG + Intergenic
956185651 3:66559756-66559778 CTAGTGGAGCTGTGAGAGGAGGG - Intergenic
956363248 3:68471324-68471346 CTAGTGGGGCTGTGAGAAGAGGG + Intronic
956901963 3:73726225-73726247 AAACTGGGGCTCTGTGAGGGAGG + Intergenic
956971875 3:74536054-74536076 GAAGTGGGACACTGAGAGACAGG + Intergenic
958057191 3:88427901-88427923 CTAGTGGAGCTGTGAGAGGAGGG + Intergenic
959439849 3:106361594-106361616 CTAGTGGAGCTCTGAGAAGAGGG + Intergenic
960525551 3:118705628-118705650 CAGGCGGGGCCATGAGAGGCCGG + Intergenic
960564374 3:119118132-119118154 CAAGTGGAGCTGTGAGAAGAGGG - Intronic
961067599 3:123889720-123889742 CTAGTGGAGCTGTGAGAAGCAGG - Intergenic
963606885 3:147419857-147419879 CAAATGGGGCGGTGGGAGGCTGG - Intronic
963815971 3:149831195-149831217 CTAGTGGAGCTGTGAGAAGCAGG + Intronic
964076648 3:152700612-152700634 CTAGTGGAGCTGTGAGAGGAGGG - Intergenic
964966143 3:162495959-162495981 CTAGTGGGGCTCTGAGAAGAGGG - Intergenic
966787676 3:183635876-183635898 CCAGTCTGGCTCTGAGAGGCCGG - Intronic
967137583 3:186525488-186525510 AAACGGGGGCTCAGAGAGGCAGG + Intergenic
967929160 3:194678129-194678151 CACTTGGGTCTCTGAGAGTCTGG - Intergenic
967929388 3:194679737-194679759 CACTTGGGTCTCTGAGAGTCTGG - Intergenic
968295167 3:197570851-197570873 CTAGTGCGGCTGTGAGAGGAGGG + Intronic
968387542 4:155271-155293 CTAGTGGAGCTGTGAGAAGCAGG + Intronic
969116315 4:4872686-4872708 CAAGGGGAGCTGCGAGAGGCGGG + Intergenic
970557690 4:17251343-17251365 GAAGTCAGGCTCAGAGAGGCTGG + Intergenic
970681042 4:18508404-18508426 AAAGTGAGGCTCTGAGAGTTTGG - Intergenic
971220215 4:24698919-24698941 CCAGTGTGGTTCTGTGAGGCAGG - Intergenic
971277877 4:25215341-25215363 CAAGTGGAGCTGTGAGAAGAGGG - Intronic
972887471 4:43510145-43510167 CTAGTGGAGCTGTGAGAGGAGGG - Intergenic
974184104 4:58423904-58423926 CAAGAGGAGCTCTGAGAGATTGG + Intergenic
974748185 4:66103029-66103051 CCAGTGGAGCTCTGAGAAGAAGG + Intergenic
974904167 4:68035582-68035604 AATGAGAGGCTCTGAGAGGCAGG - Intergenic
975972245 4:80054051-80054073 CATGTTGGGCTCTGTGAGACTGG - Intronic
977996578 4:103502803-103502825 CAAGTGGAGCTATGAGAAGAGGG + Intergenic
978164191 4:105587104-105587126 AATCTGGGGCACTGAGAGGCAGG + Intronic
980368641 4:131838928-131838950 CTAGTGGGGCTGTGAGAAGAGGG + Intergenic
980396632 4:132223701-132223723 CTAGTGGGGCTGTGAGAAGAGGG + Intergenic
980495001 4:133578514-133578536 CAAGTGGAGCTGTGAGAGGAGGG + Intergenic
980646145 4:135644400-135644422 CTAGTGGGGCTATGAGAAGAGGG + Intergenic
981795407 4:148589743-148589765 CTAGTGGAGCTCTGAGAAGAGGG + Intergenic
981797054 4:148607294-148607316 GATGTGGGAGTCTGAGAGGCAGG - Intergenic
983723805 4:170893375-170893397 CTAGTGGAGCTCTGAGAAGAGGG - Intergenic
985837688 5:2282508-2282530 CAGGTGGGCCTGTGACAGGCAGG + Intergenic
986663731 5:10082125-10082147 CAGGGAGGGCTCTGAGAGGTAGG + Intergenic
987297283 5:16565101-16565123 CAACTGGGTGTATGAGAGGCGGG - Intronic
987433586 5:17865569-17865591 CTAGTGGAGCTCTGAGAAGAGGG + Intergenic
987488429 5:18548652-18548674 CAAGTGGAGCTGTGAGAAGAGGG - Intergenic
988422872 5:31027637-31027659 AAATTGGGGTTATGAGAGGCAGG + Intergenic
989753445 5:44922855-44922877 CTAGTGGAGCTGTGAGAGGAGGG + Intergenic
991005713 5:61826029-61826051 CAAATGTTGCTCTGTGAGGCAGG - Intergenic
991941773 5:71860328-71860350 AAAGAGGGGCTCTCAGGGGCTGG + Intergenic
993258653 5:85628223-85628245 CAGTAGGGGCTCTGGGAGGCAGG + Intergenic
994185099 5:96807759-96807781 CAAGTGGGGGGCTGAGGGCCTGG - Intronic
994338812 5:98601125-98601147 CAAGTGGAGCTTTGAGAAGAGGG + Intergenic
995190096 5:109310597-109310619 CAAGTGAAACTCTCAGAGGCAGG + Intergenic
996179328 5:120399804-120399826 CTAGTGGGGCTGTGAGAGGAAGG + Intergenic
996853404 5:127977867-127977889 GAAGTGGGGATCAGTGAGGCAGG - Intergenic
997036806 5:130202677-130202699 CTAGTGGAGCTGTGAGAAGCGGG - Intergenic
997046983 5:130330467-130330489 CTAGTGGAGCTGTGAGAAGCAGG + Intergenic
997739203 5:136239001-136239023 CAAGTCAGGCTCAGAGAGGCTGG - Intronic
997786635 5:136719492-136719514 CAAGTGGGGCACTGCTAGGAAGG + Intergenic
998377581 5:141701529-141701551 CAAGTGAGGCTCTGAGATGGCGG - Intergenic
999314656 5:150575932-150575954 GGAGAGGGGCTCAGAGAGGCTGG - Intergenic
999655631 5:153807863-153807885 CTAGTGGGGGTGAGAGAGGCTGG - Intronic
999734979 5:154506277-154506299 CAAGCAGGACTCTGGGAGGCAGG - Intergenic
1000545577 5:162597004-162597026 GGAGTGGGGCTATGAAAGGCTGG + Intergenic
1000963915 5:167632146-167632168 CTACTGGGTCGCTGAGAGGCTGG - Intronic
1001175717 5:169467214-169467236 CAAGTCTGGCTCTAAGAGGAAGG + Intergenic
1001401464 5:171448880-171448902 CAAGTGGAGCCAAGAGAGGCTGG + Intronic
1001569507 5:172721007-172721029 CAAGGAGGGCTCTGATGGGCTGG - Intergenic
1001593390 5:172881745-172881767 CAGATGAGGCTCAGAGAGGCTGG - Intronic
1001656729 5:173356437-173356459 CAAGCGGGGCTGTGGCAGGCAGG - Intergenic
1003229999 6:4243372-4243394 CTAGTGGGGCTGTGAGAAGACGG - Intergenic
1003317615 6:5026385-5026407 CAGGAGAGGCTCTGGGAGGCGGG - Intergenic
1006520942 6:34570799-34570821 ACGGTGGGGTTCTGAGAGGCTGG + Intergenic
1007465721 6:42049733-42049755 CAAGTGGGCCATTGACAGGCGGG + Intronic
1007907719 6:45479439-45479461 CATGTGGGGCCTTGAGAGGACGG + Intronic
1007975241 6:46094789-46094811 CTAGTGGAGCTATGAGAGGATGG - Intergenic
1008685841 6:53925552-53925574 GAAGTGCTGCTATGAGAGGCTGG - Intergenic
1011088657 6:83570922-83570944 CAAGTGGAGCTATGAGAAGAAGG + Intronic
1011254371 6:85405794-85405816 CCAGGGTGCCTCTGAGAGGCAGG + Intergenic
1012019846 6:93904926-93904948 CAAGTGGAGCTGTGAGAAGAGGG - Intergenic
1012213725 6:96556773-96556795 CTAGTGGAGCTCTGAGAAGAGGG - Intergenic
1012239960 6:96860378-96860400 CTAGTGGGGCTGTGAGAAGAGGG + Intergenic
1013054800 6:106573265-106573287 CCAGTGGAGCTATGGGAGGCAGG - Intronic
1017458391 6:154624150-154624172 ATAGTGAGGCTCTCAGAGGCTGG + Intergenic
1017916488 6:158835711-158835733 GAGGTGGGGCTCTGTGACGCAGG - Intergenic
1018041038 6:159922340-159922362 CTAGTGGAGCTGTGAGAGGAAGG + Intergenic
1018357117 6:163029390-163029412 CATGAGGTGCTCAGAGAGGCTGG - Intronic
1018502161 6:164422719-164422741 CTAGTGGGGCTGTGAGAAGAGGG + Intergenic
1018564428 6:165136703-165136725 CTAGTGGAGCTCTGAGAAGAAGG + Intergenic
1018564461 6:165136873-165136895 CTAGTGGAGCTCTGAGAAGAAGG + Intergenic
1018903533 6:168062856-168062878 GACGAGGGGCTCTGTGAGGCTGG + Intronic
1019486907 7:1293589-1293611 CCAGCGAGGCTCTGAGAAGCCGG + Intergenic
1019632056 7:2054736-2054758 CAGGAGGGGCCCTGAGACGCTGG - Intronic
1019900437 7:4016250-4016272 CAAGTGTGGGACTGTGAGGCAGG + Intronic
1020546645 7:9541161-9541183 CTAGTGGGGCTGTGAGAAGTGGG + Intergenic
1021505966 7:21385407-21385429 CATTTGGGGCACTGAGAGACAGG + Intergenic
1022034527 7:26521108-26521130 CAAGGGAGGCTCTGAGATGGAGG + Intergenic
1022512856 7:30952317-30952339 CTAGTGGGGCTATGAGAAGAAGG - Intronic
1023830935 7:44038763-44038785 CAAGTGGGGCTCTGAGAGGCCGG - Intergenic
1024053730 7:45646344-45646366 CAAGCTGGGCCCTGAGGGGCTGG + Intronic
1026264890 7:68787681-68787703 CAAGTGTGGCTGCGAGAGTCTGG - Intergenic
1026532609 7:71212495-71212517 CTAGTGGAGCTCTGAGAAGAGGG + Intronic
1028048425 7:86152470-86152492 CTAGTGGAGCTATGAGAAGCAGG + Intergenic
1029249646 7:99226640-99226662 CTTGTGGGGCTGTGTGAGGCGGG + Intergenic
1029741269 7:102493072-102493094 CAAGTGGGGCTCTGAGAGGCCGG - Intronic
1029759259 7:102592241-102592263 CAAGTGGGGCTCTGAGAGGCCGG - Intronic
1029776628 7:102688151-102688173 CAAGTGGGGCTCTGAGAGGCCGG - Intergenic
1030468949 7:109938985-109939007 CAAGTGGAGCTGTGAGAAGTGGG - Intergenic
1031035665 7:116785285-116785307 CAGGTGGGGCTGTGAGAAGAGGG - Intronic
1031158222 7:118135613-118135635 CTAGTGGGGCTGTGAGAAGAGGG + Intergenic
1031186019 7:118481317-118481339 CAAGTGGAGCTGTGAGAAGAAGG - Intergenic
1031883617 7:127223047-127223069 CAAGAGGGGCTTTGACAGGAAGG + Intronic
1032689810 7:134273318-134273340 AATGTGGGACTCTGAGAGGAAGG - Intergenic
1032925881 7:136604096-136604118 CTAGTGGGGCTGTGAGATGAGGG + Intergenic
1033155064 7:138949793-138949815 CCTGTGGGTCTCTGAGAGTCTGG - Intronic
1033271454 7:139936497-139936519 CAAGTGGGGATATGGGAGGCTGG - Intronic
1033333374 7:140433302-140433324 CCACAGGGGCTCTGTGAGGCTGG - Intergenic
1033998705 7:147385791-147385813 CTAGTGGAGCTGTGAGAGGAGGG - Intronic
1034088153 7:148339172-148339194 CAAGGAGGGCTCTGAGAGCCCGG - Intronic
1034623111 7:152471550-152471572 CTAGTGGAGCTGTGAGAGGAGGG + Intergenic
1034893374 7:154859440-154859462 CAAAGGGGGCTCTGGAAGGCTGG + Intronic
1035472271 7:159118050-159118072 CACGGGGAGCTCAGAGAGGCCGG + Intronic
1035476742 7:159149242-159149264 CAGGTGGGGCTCACAGAGACAGG + Intergenic
1035634163 8:1130935-1130957 GAAGGGTGGCTCTGAGGGGCCGG + Intergenic
1035654721 8:1296863-1296885 CATGCGGGGCTCAGAAAGGCCGG + Intergenic
1037473267 8:19231747-19231769 AAAGTGGAGCTTTGAGAGTCAGG - Intergenic
1038419375 8:27422518-27422540 CAGGTGAGGCTCTGAGGGGCTGG + Intronic
1040925875 8:52681973-52681995 CTAGTGGAGCTCTGAGAAGAGGG + Intronic
1043591111 8:81834895-81834917 CTAGTGGAGCTGTGAGAGGAGGG - Intronic
1043660641 8:82736321-82736343 CTAGTGGAGCTGTGAGAGGAGGG + Intergenic
1044206423 8:89496555-89496577 CAGCTGGGGCTCTGGGAGTCTGG + Intergenic
1044718606 8:95124054-95124076 CTAGTGGAGCTCTGAGAAGACGG + Intergenic
1045210878 8:100098488-100098510 CCAGTGGGGATCTGATATGCGGG - Intronic
1045326208 8:101119501-101119523 CAGGTGGGGCTCGGAGAGTTAGG - Intergenic
1046863165 8:119117457-119117479 CTAGTGGAGCTCTGAGAAGAGGG - Intergenic
1047149189 8:122241474-122241496 CCAGTGGAGCTGTGAGAGGAAGG + Intergenic
1047924540 8:129669803-129669825 CCAGTGGAGCTCTGAGAAGAGGG + Intergenic
1048330084 8:133465299-133465321 ACACTGAGGCTCTGAGAGGCAGG + Intronic
1048458946 8:134603740-134603762 CAACTGGGCCTCTGTGAGCCTGG + Intronic
1048909356 8:139119779-139119801 CAAGTGTGCCTCTGAGAGGGTGG + Intergenic
1049303030 8:141881836-141881858 GAAGTGGGGAGCTGAGGGGCAGG - Intergenic
1049446713 8:142634659-142634681 CAAGAGGGCCTCTGGAAGGCTGG - Intergenic
1050909980 9:11056042-11056064 CTAGTGGAGCTCTGAGAAGAAGG + Intergenic
1051372497 9:16370493-16370515 CAAGTGGTGCTGAGAGTGGCAGG + Intergenic
1051860792 9:21622988-21623010 CTAGTGGGGCTGTGAGAAGAGGG - Intergenic
1052220607 9:26017461-26017483 CTAGTGGAGCTGTGAGAGGAGGG - Intergenic
1052782523 9:32795847-32795869 CTAGTGGGGCTGTGAGAAGAGGG - Intergenic
1055698677 9:78917449-78917471 CCAGTGGGGCTGTGAGAAGAAGG + Intergenic
1056266909 9:84906311-84906333 CAAGAGCAGCTCTGAGGGGCAGG + Intronic
1057181898 9:93034987-93035009 CAACTGGGGCTCCAAGGGGCCGG - Intronic
1058682431 9:107451888-107451910 AAAGCGTGGCTCTGAAAGGCAGG - Intergenic
1060245963 9:121946455-121946477 CAGGTGGGGCTTACAGAGGCAGG + Intronic
1060473110 9:123965120-123965142 CAAGTGTGGCTTTGAGAAGTCGG - Intergenic
1060593613 9:124834810-124834832 AAAGTGTGGCTCAGAGGGGCAGG - Intergenic
1060789007 9:126473186-126473208 CAAGTAAGGCTCAGAGAGGTGGG + Intronic
1061188385 9:129068344-129068366 CAAGTGTGGGTCTGAGAGCAGGG - Intronic
1061222065 9:129258070-129258092 CAAATGAGCCTCTGAGAGGGTGG + Intergenic
1061663145 9:132143712-132143734 CAAGAGGGGCTCTGAGCTGGGGG - Intergenic
1061903308 9:133683991-133684013 CAGATGGAGCTCAGAGAGGCTGG - Intronic
1062616848 9:137401084-137401106 CTAGTGGGACTGTGAGAAGCAGG - Intronic
1187154586 X:16711921-16711943 CGAGCGGGGGTCTGCGAGGCTGG - Exonic
1189788750 X:44583519-44583541 CTAGTGGAGCTGTGAGAGGAGGG + Intergenic
1190265962 X:48827240-48827262 TAAGTCGGGGTCTGAGCGGCTGG - Intergenic
1191737974 X:64407303-64407325 CTAGTGGAGCTGTGAGAGGAGGG - Intergenic
1191783980 X:64897639-64897661 CAAGTGGAGCTGTGAGAAGAGGG - Intergenic
1192150142 X:68707001-68707023 CAAGGCAGGCTCTGTGAGGCTGG - Intronic
1193308004 X:79972415-79972437 CAAATGGAGCTGTGAGAAGCAGG + Intergenic
1193388225 X:80895376-80895398 CAAGTGGAGCTATGAGAAGATGG + Intergenic
1193887913 X:87006360-87006382 CTAGTGGGGCTGTGAGAAGAGGG - Intergenic
1194259684 X:91677907-91677929 CTAGTGGGGCTGTGAGAAGAGGG - Intergenic
1194339781 X:92694006-92694028 CTAGTGGAGCTCTGAGAAGAGGG - Intergenic
1194499211 X:94659001-94659023 CAAGTGGAGCTGTGAGAAGAGGG + Intergenic
1194824698 X:98547366-98547388 CAGGTGGGTCACTGAGATGCTGG - Intergenic
1195732171 X:107978947-107978969 CAACTGGGACTCTGAGGGGGTGG + Intergenic
1196246326 X:113404194-113404216 CTAGTGGAGCTGTGAGAGGAAGG + Intergenic
1197761831 X:130033466-130033488 AAAGTGGGGCTCAGAGAGGGAGG + Intronic
1197886540 X:131223912-131223934 CAGCTGTGGCCCTGAGAGGCAGG + Intergenic
1199220508 X:145310988-145311010 CTAGTGGAGCTCTGAGAAGAGGG - Intergenic
1199370519 X:147042505-147042527 CTAGTGGAGCTCTGAGAAGAGGG + Intergenic
1200076189 X:153552375-153552397 CCAGTGGGGCTGTGAGTGCCAGG - Intronic
1200314688 X:155119657-155119679 CAAGGGAAGGTCTGAGAGGCTGG + Intronic
1200578386 Y:4917100-4917122 CTAGTGGGGCTGTGAGAAGAGGG - Intergenic
1200648164 Y:5810789-5810811 CTAGTGGAGCTCTGAGAAGAGGG - Intergenic