ID: 1029741269

View in Genome Browser
Species Human (GRCh38)
Location 7:102493072-102493094
Sequence CAAGTGGGGCTCTGAGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 481
Summary {0: 4, 1: 0, 2: 2, 3: 35, 4: 440}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029741269_1029741280 9 Left 1029741269 7:102493072-102493094 CCGGCCTCTCAGAGCCCCACTTG 0: 4
1: 0
2: 2
3: 35
4: 440
Right 1029741280 7:102493104-102493126 CTCCTTACCCACCTTGGAGCTGG 0: 4
1: 0
2: 1
3: 14
4: 160
1029741269_1029741286 29 Left 1029741269 7:102493072-102493094 CCGGCCTCTCAGAGCCCCACTTG 0: 4
1: 0
2: 2
3: 35
4: 440
Right 1029741286 7:102493124-102493146 TGGGCGTCTTCGCGAAGCTGAGG 0: 4
1: 0
2: 0
3: 5
4: 42
1029741269_1029741281 10 Left 1029741269 7:102493072-102493094 CCGGCCTCTCAGAGCCCCACTTG 0: 4
1: 0
2: 2
3: 35
4: 440
Right 1029741281 7:102493105-102493127 TCCTTACCCACCTTGGAGCTGGG 0: 4
1: 0
2: 0
3: 9
4: 161
1029741269_1029741276 3 Left 1029741269 7:102493072-102493094 CCGGCCTCTCAGAGCCCCACTTG 0: 4
1: 0
2: 2
3: 35
4: 440
Right 1029741276 7:102493098-102493120 GCCTCCCTCCTTACCCACCTTGG 0: 4
1: 0
2: 0
3: 47
4: 406
1029741269_1029741287 30 Left 1029741269 7:102493072-102493094 CCGGCCTCTCAGAGCCCCACTTG 0: 4
1: 0
2: 2
3: 35
4: 440
Right 1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG 0: 4
1: 0
2: 0
3: 0
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029741269 Original CRISPR CAAGTGGGGCTCTGAGAGGC CGG (reversed) Intronic