ID: 1029741270

View in Genome Browser
Species Human (GRCh38)
Location 7:102493076-102493098
Sequence CCGGCAAGTGGGGCTCTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 4, 1: 0, 2: 1, 3: 13, 4: 170}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029741270_1029741280 5 Left 1029741270 7:102493076-102493098 CCTCTCAGAGCCCCACTTGCCGG 0: 4
1: 0
2: 1
3: 13
4: 170
Right 1029741280 7:102493104-102493126 CTCCTTACCCACCTTGGAGCTGG 0: 4
1: 0
2: 1
3: 14
4: 160
1029741270_1029741276 -1 Left 1029741270 7:102493076-102493098 CCTCTCAGAGCCCCACTTGCCGG 0: 4
1: 0
2: 1
3: 13
4: 170
Right 1029741276 7:102493098-102493120 GCCTCCCTCCTTACCCACCTTGG 0: 4
1: 0
2: 0
3: 47
4: 406
1029741270_1029741281 6 Left 1029741270 7:102493076-102493098 CCTCTCAGAGCCCCACTTGCCGG 0: 4
1: 0
2: 1
3: 13
4: 170
Right 1029741281 7:102493105-102493127 TCCTTACCCACCTTGGAGCTGGG 0: 4
1: 0
2: 0
3: 9
4: 161
1029741270_1029741286 25 Left 1029741270 7:102493076-102493098 CCTCTCAGAGCCCCACTTGCCGG 0: 4
1: 0
2: 1
3: 13
4: 170
Right 1029741286 7:102493124-102493146 TGGGCGTCTTCGCGAAGCTGAGG 0: 4
1: 0
2: 0
3: 5
4: 42
1029741270_1029741287 26 Left 1029741270 7:102493076-102493098 CCTCTCAGAGCCCCACTTGCCGG 0: 4
1: 0
2: 1
3: 13
4: 170
Right 1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG 0: 4
1: 0
2: 0
3: 0
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029741270 Original CRISPR CCGGCAAGTGGGGCTCTGAG AGG (reversed) Intronic
900121572 1:1050597-1050619 CCGGCAAGGGTGGCTCTGGGAGG + Intronic
900461708 1:2804997-2805019 TTGGCAGCTGGGGCTCTGAGGGG - Intergenic
900936847 1:5771452-5771474 CTGGCAAGAGGAGCTCTGATAGG + Intergenic
901274598 1:7981361-7981383 CCAGAAAGTGAAGCTCTGAGAGG + Intronic
901624967 1:10618646-10618668 CCTGCAAGTGGAGATCTGGGTGG - Intronic
902226012 1:14996819-14996841 CCTGCATGTGGGGCACTGGGAGG + Intronic
902404218 1:16174243-16174265 CTGGCTAGTGAGGCTCTGGGTGG - Intergenic
902838962 1:19063429-19063451 CCGGAGGGTGGGGCGCTGAGAGG - Intergenic
904809248 1:33152746-33152768 GAGGAAACTGGGGCTCTGAGAGG + Intronic
904823099 1:33257685-33257707 CCGGCAAGAGGGGCTCAGAATGG + Intronic
905907817 1:41631306-41631328 CTGGCAAGTGGGGCTAAGAATGG + Intronic
912937972 1:114020457-114020479 CCGCCTAGTGGAGCTGTGAGAGG + Intergenic
913979913 1:143498680-143498702 CTGGCAAGGGCAGCTCTGAGGGG + Intergenic
915277195 1:154797370-154797392 CAGGAAAGTGAGGCTCAGAGAGG - Intronic
916509510 1:165459600-165459622 CAGGTGAGTGGGCCTCTGAGGGG - Intergenic
1063458437 10:6201387-6201409 GCGGGAACAGGGGCTCTGAGAGG + Intronic
1069744473 10:70706356-70706378 CTGGCAGGGAGGGCTCTGAGGGG + Intronic
1069796144 10:71053171-71053193 CTAGCAAGTGGGGCTCCCAGAGG - Intergenic
1073600332 10:104840156-104840178 CCTGCAGGTGGAGATCTGAGAGG + Intronic
1074807487 10:117068005-117068027 CCTCCAAGTGGAGCTATGAGAGG + Intronic
1076266652 10:129113978-129114000 CTGGGCAGTGGGGGTCTGAGAGG + Intergenic
1081491855 11:43575534-43575556 CGGGCAAGCGGGGCCCCGAGGGG - Intronic
1081760700 11:45574807-45574829 CCTACAAGTGGGCCTCTGGGAGG - Intergenic
1081853707 11:46290936-46290958 CAGGCCAGTGGGACTCTGAGGGG - Intronic
1083755730 11:64790618-64790640 CTGGGAACTGAGGCTCTGAGAGG + Intronic
1083864846 11:65448158-65448180 CTGGAAAGGGGGCCTCTGAGAGG - Intergenic
1084004326 11:66315141-66315163 CTGGTTAGTGGGGCTCTGAGAGG + Exonic
1084115408 11:67040201-67040223 CGGGTAAGTGGGGCTCAGGGCGG + Exonic
1084570496 11:69956891-69956913 CCTGTAAGTGGGGGACTGAGAGG - Intergenic
1085046610 11:73357186-73357208 TCGGGGAGTGGGGCTCAGAGAGG - Intronic
1085645771 11:78221601-78221623 CTGGGAAGTGGGGAACTGAGGGG + Intronic
1085810069 11:79671935-79671957 GAGGCAATTGAGGCTCTGAGAGG + Intergenic
1089854953 11:121535442-121535464 AAGGCAAGTGGGGCACTGATCGG + Intronic
1090363124 11:126186954-126186976 CCTGCAGCTGGGGCTCTGTGGGG - Intergenic
1090931926 11:131305401-131305423 TAGGCAACTGAGGCTCTGAGAGG - Intergenic
1091322188 11:134659569-134659591 CCTGCAGGTGGGGCTGGGAGAGG + Intergenic
1091642135 12:2245480-2245502 CAGGCAACTGAGGCTCAGAGCGG + Intronic
1092115232 12:5996386-5996408 TAGGAAACTGGGGCTCTGAGAGG + Intronic
1096982099 12:55734095-55734117 CAGGAAAGTGGGGCTCAGAGAGG + Intergenic
1098460935 12:70732404-70732426 GCTGCACCTGGGGCTCTGAGGGG - Intronic
1100395791 12:94185491-94185513 CCTGCAAGTAGGGCGGTGAGAGG - Intronic
1100853696 12:98739685-98739707 CAGGAAAGTGAGGCTCTGAGGGG - Intronic
1101750862 12:107581371-107581393 CCGCCCAGCGGGGCTCTGATTGG - Intronic
1101898677 12:108774859-108774881 CCGTCACGTGGGGCTGGGAGAGG - Intergenic
1103518538 12:121522910-121522932 CCGGGAAGTCGGGCTCTGCATGG + Intronic
1103940419 12:124498441-124498463 CCGGCATGTGAGGCGCTGGGTGG - Intronic
1104440470 12:128789601-128789623 CCGGCAAGCTGAGCTCTGTGTGG - Intergenic
1104949524 12:132432952-132432974 CTGCCAAGTGGGGCCCCGAGAGG + Intergenic
1109519155 13:63485720-63485742 CTGGCAAGTTGGGCACTCAGCGG - Intergenic
1119737891 14:76995585-76995607 TCGGCAAGTGAGGCCCTGAAAGG - Intergenic
1121252146 14:92507201-92507223 CCAGCAAGTGGGGCTGAGACAGG + Intergenic
1123423385 15:20148763-20148785 CCGGCTTTGGGGGCTCTGAGTGG + Intergenic
1123532606 15:21155284-21155306 CCGGCTTTGGGGGCTCTGAGTGG + Intergenic
1126540312 15:49815361-49815383 CAGAAAAGTGGGTCTCTGAGAGG - Intergenic
1129188817 15:73926220-73926242 CTGGTAAGTGGGGCTCTGGCAGG - Intronic
1129270822 15:74418428-74418450 TGAGCAACTGGGGCTCTGAGAGG + Intronic
1129601231 15:76999753-76999775 CAGGCAAGGAGTGCTCTGAGAGG + Intronic
1130032903 15:80332262-80332284 CCGGCAAGGTAGGCGCTGAGAGG + Intergenic
1132754129 16:1474556-1474578 GCGGAATGTGGGGCGCTGAGGGG - Intronic
1136599873 16:31277945-31277967 CCTGAAGGTGGGGGTCTGAGAGG - Exonic
1137840968 16:51640551-51640573 ACGGCAAGTGTGGCCCTCAGTGG - Intergenic
1139908493 16:70382093-70382115 CCGGCAAGTGCTTCACTGAGTGG - Intronic
1141181343 16:81755003-81755025 CAGGCAATGGGGGCTCAGAGAGG - Intronic
1141312187 16:82925268-82925290 CCAGCTAGGGGTGCTCTGAGGGG - Intronic
1141463405 16:84191549-84191571 CTGGCAGGTGGGTCTTTGAGCGG - Exonic
1142189917 16:88712996-88713018 CGGGGAAGGGGGGCTCTCAGGGG - Intronic
1142189936 16:88713039-88713061 CGGGGAAGGGGGGCTCTCAGGGG - Intronic
1142189972 16:88713122-88713144 CGGGGAAGGGGGGCTCTCAGGGG - Intronic
1142190008 16:88713206-88713228 CGGGGAAGGGGGGCTCTCAGGGG - Intronic
1142814474 17:2414515-2414537 CTCGCAAATGGTGCTCTGAGAGG - Intronic
1146275406 17:31512871-31512893 CAGGAAACCGGGGCTCTGAGAGG + Intronic
1146578313 17:34013663-34013685 GAGGAAACTGGGGCTCTGAGAGG + Intronic
1147458290 17:40552366-40552388 CCGGGAATTGGCGCCCTGAGAGG - Intergenic
1147596478 17:41721294-41721316 CTGGCCTGTGGGTCTCTGAGGGG - Intronic
1148218885 17:45848926-45848948 CTGGCAAGCGGGGCTTTGAGAGG - Intergenic
1148489628 17:48014667-48014689 CTGGAAACTGGGGCTCTCAGGGG - Intergenic
1148846410 17:50532620-50532642 CAGGCAAGTGGTGCATTGAGAGG - Exonic
1149306129 17:55348283-55348305 GAGGCAAGTGGGGCTCAGAAAGG + Intergenic
1149416014 17:56460797-56460819 GGGGCATGTGGGGCTATGAGAGG - Intronic
1151830456 17:76546249-76546271 CCTGCAACTGAGGCTCAGAGCGG + Intronic
1152067856 17:78121389-78121411 CTGAGAAGTGGGGCTCGGAGGGG + Intronic
1152350979 17:79784050-79784072 CCTGCAACGGGGGCGCTGAGTGG - Exonic
1152683913 17:81684301-81684323 TTGGCAAATGGGGCTCTGCGAGG + Intronic
1152750991 17:82062319-82062341 CAGGCTAGTGGGGCACTGGGGGG + Intronic
1153290671 18:3499000-3499022 ACGGGAAGTGGGGGGCTGAGGGG + Exonic
1153754302 18:8264360-8264382 GAGGCAAGTGAGGCTTTGAGGGG + Intronic
1155239753 18:23854043-23854065 CCTGCAAATGGGACCCTGAGTGG - Intronic
1156303983 18:35859610-35859632 CTGGCAAGTTGGGCACTCAGTGG - Intergenic
1157790181 18:50524448-50524470 CCAGCAAATGTGGCTCAGAGGGG + Intergenic
1158101955 18:53839851-53839873 CAGGCAAGAGGGGCTCCCAGAGG + Intergenic
1160824807 19:1074604-1074626 GCGGCATGTGGGGCTGTGGGTGG - Exonic
1160836493 19:1127066-1127088 CCCGCTAGTGGGGAGCTGAGAGG - Intronic
1160866417 19:1258227-1258249 CCGGGAAGGAGGGCTCGGAGGGG - Exonic
1162313052 19:9918850-9918872 CCTGCAAGTGGGGGTGGGAGTGG + Intronic
1163620609 19:18357609-18357631 CCGGCAGGTAGGGCCCTGTGGGG + Exonic
1167921892 19:52788945-52788967 CCAGAAGGTGGGGCTCTGCGGGG - Intronic
1168065271 19:53915617-53915639 AAGGAAAGTGGGGCTCAGAGAGG - Intronic
927718467 2:25367850-25367872 CTGGGAAGGGGCGCTCTGAGGGG - Intergenic
930050897 2:47215550-47215572 CCAGCAACTGGATCTCTGAGAGG + Intergenic
932774073 2:74516544-74516566 TCGGGAGCTGGGGCTCTGAGGGG + Exonic
933420868 2:82043581-82043603 CCATCAAGTGTGGCTCTCAGTGG - Intergenic
933658315 2:84906551-84906573 CCGGCCTGTGGGTCTCTGAAGGG + Exonic
933813562 2:86048404-86048426 CCTGGAAGTGGGGCTGTGAGGGG - Intronic
934534465 2:95121696-95121718 CCGGGAGCAGGGGCTCTGAGCGG - Intronic
935259873 2:101344737-101344759 CTGGAACGTGGGGCTCTCAGTGG - Intergenic
937150720 2:119683858-119683880 CCTGCCAGGGGGGCTCTCAGTGG - Intronic
938679300 2:133673105-133673127 ACCTCATGTGGGGCTCTGAGTGG - Intergenic
938779804 2:134575026-134575048 CAGACATGTGGGGCTCTGTGGGG + Intronic
939032801 2:137096437-137096459 CTGGGAAGTGGGGATGTGAGTGG - Intronic
939180126 2:138794597-138794619 TCAGCAAGTGAGGCTCTGGGTGG - Intergenic
941000266 2:160195291-160195313 CTGGCAAGTGCAGCTCAGAGCGG + Intronic
943205265 2:184886454-184886476 CCGCCTAGTGGAGCTGTGAGAGG - Intronic
946164373 2:217854949-217854971 CCTGCAGGCCGGGCTCTGAGTGG - Intronic
947591319 2:231387695-231387717 CCTGCTAGTGGGGCTCAGGGAGG + Intergenic
947592199 2:231392251-231392273 CCCGCAGGTGGTGCTCTGACTGG - Intergenic
1170710280 20:18784551-18784573 CCAGCAAGTTGGGCCCTGATGGG - Intergenic
1171229778 20:23475176-23475198 GTGGCCAGTGGGGCTCTGAAGGG - Intergenic
1171462726 20:25308099-25308121 GTGGCCTGTGGGGCTCTGAGGGG + Intronic
1172014712 20:31866401-31866423 CAGGCAACTGAGGCTCAGAGGGG + Intronic
1173358819 20:42321008-42321030 CCAGCAAGAGTGGCTCTGACAGG + Intronic
1174270461 20:49364649-49364671 CCAGGAAGTGTGGCTCTGAGAGG + Exonic
1175856250 20:62122461-62122483 CGCGCGACTGGGGCTCTGAGAGG - Intronic
1176088720 20:63309593-63309615 CCGGCTCCTGTGGCTCTGAGGGG + Intronic
1176411128 21:6450159-6450181 CCGCGACGTGGGGCTCTCAGTGG + Intergenic
1176903938 21:14477300-14477322 TTGGCAAGTAGGGCTCAGAGAGG + Intergenic
1177010917 21:15729879-15729901 CCGGCGGGCGGGGCTCTGCGGGG + Intergenic
1179686621 21:43058481-43058503 CCGCGACGTGGGGCTCTCAGTGG + Intronic
1180188231 21:46150887-46150909 CCGACAAGTGCGGGGCTGAGGGG - Intronic
1180198163 21:46209525-46209547 CCGGTGCCTGGGGCTCTGAGGGG - Intronic
1181955336 22:26584169-26584191 ACGGAAACTGGGGCTCAGAGAGG + Intronic
1182393113 22:30015925-30015947 CAGGCATGTGGGTATCTGAGGGG - Intronic
1183107455 22:35624844-35624866 GGGGCAAGTGGGGCTGTGGGAGG + Intronic
1183248345 22:36710982-36711004 CAGGAGAGTGGGGCTGTGAGGGG - Intergenic
1184406384 22:44303100-44303122 CAGGCAACAGGGGCTCTGGGAGG - Intronic
1184455974 22:44609606-44609628 CCTGCAAGTGGGGATCTGTTCGG - Intergenic
1185175835 22:49326032-49326054 CCCGGCAGTGAGGCTCTGAGGGG + Intergenic
951492912 3:23292525-23292547 CAAGTGAGTGGGGCTCTGAGAGG - Intronic
954934260 3:54312405-54312427 CACGGAAGAGGGGCTCTGAGTGG - Intronic
954941380 3:54376152-54376174 CAGGCAAGTGGGACTCAGATAGG - Intronic
956163670 3:66380508-66380530 CGGTCAAGTGGGGGTCTGACAGG - Intronic
956655627 3:71547549-71547571 CCCTTAAGTGTGGCTCTGAGTGG - Intronic
958869211 3:99537521-99537543 CTCGCAAGTGGGGCTCTGGGAGG - Intergenic
960689567 3:120331269-120331291 CTGGGAAGTGGAGCTGTGAGAGG + Exonic
961459884 3:127043452-127043474 CCTCCCAGTGGGGCTCTGAGTGG + Intergenic
968881652 4:3303252-3303274 CCGGCAAGTGGGGTACAGCGGGG + Intronic
968976397 4:3824400-3824422 CCTGCAAGTGGGCATTTGAGGGG - Intergenic
972676053 4:41260445-41260467 CCAGCCAGTGGGGCTCTGAGAGG - Intronic
975038118 4:69710024-69710046 CCCCCAAGTAGGGCTCTGTGTGG + Intergenic
980028665 4:127798314-127798336 GTGGGAAGTGGGGATCTGAGAGG + Intronic
980494998 4:133578510-133578532 CCACCAAGTGGAGCTGTGAGAGG + Intergenic
986710107 5:10482514-10482536 GTGGCATGTGGGGCTCTGAAAGG + Intergenic
990026766 5:51201216-51201238 CAGGCAGGTGGGTTTCTGAGAGG + Intergenic
990353167 5:54939043-54939065 AAGGAAAGTGGGGCTCTGAAAGG + Intergenic
994107274 5:95961539-95961561 CCGGCAGGCTGGGCTCAGAGAGG - Intronic
995210021 5:109527188-109527210 GCTGCAAGTGTGGATCTGAGTGG + Intergenic
996179326 5:120399800-120399822 CTGCCTAGTGGGGCTGTGAGAGG + Intergenic
999244700 5:150147635-150147657 CCGCCCAGGAGGGCTCTGAGGGG - Intronic
1001208220 5:169784378-169784400 CAGGAAAGTGTGGTTCTGAGGGG + Intronic
1001399030 5:171435905-171435927 AAGGCAACCGGGGCTCTGAGAGG - Intronic
1001527723 5:172440620-172440642 CTGGAAACTGGGGCTCTGACTGG + Intronic
1002938595 6:1696653-1696675 GCGGAAAGTGAGGCTCAGAGGGG + Intronic
1004116665 6:12775039-12775061 CCAGCTAGTGAGGCCCTGAGAGG - Intronic
1007783159 6:44265472-44265494 CCGGGCTGTGGGGCTCCGAGGGG + Exonic
1013425978 6:110012888-110012910 CCAGCAAGAGGGGCCCTGAGAGG + Intergenic
1017905843 6:158757113-158757135 CCGGGAAGTGGGGCCCTGGAAGG + Intronic
1018836514 6:167488256-167488278 CCGGCAGGTGCGGCTCTGGGAGG + Intergenic
1023830936 7:44038767-44038789 CCGGCAAGTGGGGCTCTGAGAGG - Intergenic
1025085793 7:56022393-56022415 CAGGTAAGTGGCCCTCTGAGTGG + Intronic
1026964657 7:74431426-74431448 CGGGGAACTGAGGCTCTGAGAGG + Intergenic
1029741270 7:102493076-102493098 CCGGCAAGTGGGGCTCTGAGAGG - Intronic
1029759260 7:102592245-102592267 CCGGCAAGTGGGGCTCTGAGAGG - Intronic
1029776629 7:102688155-102688177 CCGGCAAGTGGGGCTCTGAGAGG - Intergenic
1035176400 7:157055133-157055155 CCTGCAGGTGGGGCTGTGGGAGG - Intergenic
1035753293 8:2010641-2010663 CCAGCAAGATGGGCTCTGAAGGG - Intergenic
1038419374 8:27422514-27422536 GCAGCAGGTGAGGCTCTGAGGGG + Intronic
1038535801 8:28352091-28352113 CAGGCAGGTGGGGCCCAGAGAGG - Intronic
1045565740 8:103313135-103313157 GAGGCAACTGAGGCTCTGAGAGG - Intronic
1049818676 8:144621042-144621064 CTGCCAACTGGGGCTCTGGGTGG - Intergenic
1049831073 8:144700882-144700904 CCGGCATGAGGGGCTGTGAAGGG + Intergenic
1051606211 9:18919912-18919934 CAGGCAACTGAGGCTCAGAGAGG - Intergenic
1056880460 9:90386978-90387000 CTGGAAATTGGGGCTCTGACAGG - Intergenic
1059424430 9:114211828-114211850 CGGGAAACTGAGGCTCTGAGAGG + Intronic
1060660473 9:125402391-125402413 CTGGCAACTGAGGCTCAGAGAGG - Intergenic
1060816026 9:126635707-126635729 CAAGAAACTGGGGCTCTGAGAGG + Intronic
1061480632 9:130896260-130896282 CCGGCAGGTGGAGCCCTCAGCGG + Intergenic
1186556694 X:10567368-10567390 CCGGCAGGTGGGGCACTGGAAGG + Exonic
1190320529 X:49176980-49177002 GCTGCAAGTGGGGCTGTGACAGG + Exonic
1195435036 X:104833525-104833547 CCAGCCAGTCTGGCTCTGAGTGG - Intronic