ID: 1029741272

View in Genome Browser
Species Human (GRCh38)
Location 7:102493086-102493108
Sequence AGGAGGGAGGCCGGCAAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 693
Summary {0: 4, 1: 0, 2: 2, 3: 70, 4: 617}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029741272_1029741281 -4 Left 1029741272 7:102493086-102493108 CCCCACTTGCCGGCCTCCCTCCT 0: 4
1: 0
2: 2
3: 70
4: 617
Right 1029741281 7:102493105-102493127 TCCTTACCCACCTTGGAGCTGGG 0: 4
1: 0
2: 0
3: 9
4: 161
1029741272_1029741289 30 Left 1029741272 7:102493086-102493108 CCCCACTTGCCGGCCTCCCTCCT 0: 4
1: 0
2: 2
3: 70
4: 617
Right 1029741289 7:102493139-102493161 AGCTGAGGGCCTCGGTAGTGAGG 0: 4
1: 0
2: 0
3: 10
4: 119
1029741272_1029741287 16 Left 1029741272 7:102493086-102493108 CCCCACTTGCCGGCCTCCCTCCT 0: 4
1: 0
2: 2
3: 70
4: 617
Right 1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG 0: 4
1: 0
2: 0
3: 0
4: 36
1029741272_1029741288 22 Left 1029741272 7:102493086-102493108 CCCCACTTGCCGGCCTCCCTCCT 0: 4
1: 0
2: 2
3: 70
4: 617
Right 1029741288 7:102493131-102493153 CTTCGCGAAGCTGAGGGCCTCGG 0: 4
1: 0
2: 0
3: 5
4: 117
1029741272_1029741286 15 Left 1029741272 7:102493086-102493108 CCCCACTTGCCGGCCTCCCTCCT 0: 4
1: 0
2: 2
3: 70
4: 617
Right 1029741286 7:102493124-102493146 TGGGCGTCTTCGCGAAGCTGAGG 0: 4
1: 0
2: 0
3: 5
4: 42
1029741272_1029741280 -5 Left 1029741272 7:102493086-102493108 CCCCACTTGCCGGCCTCCCTCCT 0: 4
1: 0
2: 2
3: 70
4: 617
Right 1029741280 7:102493104-102493126 CTCCTTACCCACCTTGGAGCTGG 0: 4
1: 0
2: 1
3: 14
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029741272 Original CRISPR AGGAGGGAGGCCGGCAAGTG GGG (reversed) Intronic
900250989 1:1669615-1669637 AGAAGGCAGCCCGGCAAGTAAGG + Intronic
900479361 1:2890572-2890594 AGGAGGGAGACAGGAGAGTGAGG - Intergenic
900836755 1:5010816-5010838 AGGAGTGAGGCTGGCAGGGGTGG - Intergenic
900893976 1:5470152-5470174 AGCAGGGAGGCCAGCAGCTGAGG + Intergenic
900893980 1:5470169-5470191 CTGAGGGAGGCCAGCAACTGAGG + Intergenic
901237347 1:7674300-7674322 AGGAGGGAGCCCACCAAGTTAGG + Intronic
901540177 1:9910363-9910385 CGGAGGGAGGCGGGCGCGTGGGG + Intergenic
901635303 1:10667684-10667706 AGGAGGTAAGCAGCCAAGTGTGG + Intronic
902885802 1:19403877-19403899 AGGAGGGAGGCAGGCAGAAGGGG - Intronic
903279305 1:22241459-22241481 TGGAGGCAGGCAGGCCAGTGTGG + Intergenic
903420964 1:23217552-23217574 GGGAGGGAGCCCGGCGAGGGAGG - Intergenic
904310508 1:29626399-29626421 AGGAGGGAGGCTGGGAAGGGAGG + Intergenic
904463800 1:30696047-30696069 AGGGGTGAGGCCAGCAAGAGAGG + Intergenic
904541673 1:31238081-31238103 AAGACTGAGGCCGGCCAGTGGGG + Intronic
904837964 1:33350948-33350970 GAGAGGGAGGCAGGAAAGTGTGG - Intronic
905308190 1:37033311-37033333 ACGATGGAGGCCGCCCAGTGCGG - Intronic
906188686 1:43881539-43881561 AGGAAGGAGGGAGGGAAGTGGGG - Intronic
906667211 1:47630464-47630486 AGCTGAGAGGCAGGCAAGTGTGG - Intergenic
906688362 1:47777128-47777150 GGGAGGCAGGCAGGCCAGTGAGG - Intronic
906706040 1:47895848-47895870 AGGAGGCAGGCCTGGGAGTGGGG - Intronic
909531947 1:76691848-76691870 AGGAGCAAGGACAGCAAGTGGGG + Intergenic
909677910 1:78257992-78258014 AGGAGGGAGCCAGGCAAATAGGG + Intergenic
910601871 1:89040998-89041020 AGGAGGGAGGGAGGAAAGGGAGG + Intergenic
910846800 1:91611931-91611953 AGGAGGGAGGAGGGCAACTGGGG + Intergenic
910937342 1:92495232-92495254 AGGAGGGAGGAAGGCAAGGAAGG - Intergenic
910952535 1:92666449-92666471 AGGTGGGAGGCTGGGAGGTGGGG + Intronic
911863263 1:102983013-102983035 AGGAGGGAGACAGAGAAGTGCGG - Intronic
913193397 1:116432559-116432581 AGGAGGGAGTCAGGCAGGTTTGG - Intergenic
913670736 1:121095315-121095337 AGGAGGGAGGCAGGGAAGCAGGG - Intronic
914022499 1:143882738-143882760 AGGAGGGAGGCAGGGAAGCAGGG - Intergenic
914660985 1:149790680-149790702 AGGAGGGAGGCAGGGAAGCAGGG - Intronic
914862634 1:151399315-151399337 AGGAGGGAGGCATGAAGGTGGGG - Intergenic
915530692 1:156500672-156500694 AGGCGGGCGGCAGGCAAGCGGGG + Exonic
916710686 1:167404450-167404472 AGGAAGCAGGCAGGCAAGCGAGG + Intronic
917472040 1:175334226-175334248 AGGAGGGCAGCCAGCCAGTGAGG - Intronic
917735441 1:177915815-177915837 AGCAAGGAGGCCAGCATGTGGGG - Intergenic
918848476 1:189650669-189650691 AGGAGTGAGGAGGCCAAGTGTGG + Intergenic
919691519 1:200532206-200532228 TGGAGGGAGGCAGGAGAGTGAGG + Intergenic
920053164 1:203175505-203175527 AGGAGGGAGGCAGGCATGTCAGG - Intronic
920102558 1:203526424-203526446 AAGAGGGAGGCGGGTAAGAGAGG + Intergenic
920208749 1:204313075-204313097 AGGAGGGAGGGAGGGAAGGGAGG - Intronic
920912545 1:210232544-210232566 AGGAGGGAGGGCGGGAAGCAGGG + Intergenic
921060256 1:211578974-211578996 AGGAGGGCGGCGGGCGAGGGCGG + Intergenic
922616934 1:226966091-226966113 AGGAAGGAGGCTGGGCAGTGAGG + Intronic
922784428 1:228276068-228276090 AGGAGGGAGGCGGGGCATTGAGG + Intronic
923109448 1:230879571-230879593 GAGGGGGAGGCCGGCAAGGGGGG - Intergenic
923115531 1:230933730-230933752 AGGAGGGAGGCTGAAGAGTGGGG - Intronic
1063366412 10:5493601-5493623 AGGAGGGAGGTCGTCAAGCAGGG - Intergenic
1064231062 10:13529266-13529288 CGGAGGGAGGCCAGCGAGCGGGG - Intergenic
1066016233 10:31246663-31246685 AGGAAGGAGGGAGGCAAGGGAGG - Intergenic
1068120561 10:52779261-52779283 AGGAGGGAGGCAGGGAGGGGAGG - Intergenic
1068556882 10:58468233-58468255 AGGAAGAATGCAGGCAAGTGAGG - Intergenic
1068556892 10:58468271-58468293 AGGAGGGAGGGAGGGAAGGGAGG - Intergenic
1069911677 10:71763550-71763572 AGGAGGGAGGCAGCCTGGTGGGG + Intronic
1069994583 10:72334745-72334767 AGGAGGGCAGGCCGCAAGTGGGG - Exonic
1070509462 10:77147413-77147435 AGGAGGGAGGGAGGCTGGTGGGG - Intronic
1071501816 10:86209812-86209834 GGGAGGGAGCCAGGCAGGTGGGG - Intronic
1072209228 10:93231401-93231423 AGAAGGCAGGGCGGCAGGTGTGG + Intergenic
1073033808 10:100549104-100549126 AGTAGGGAGGCTGGCCAGTGTGG - Exonic
1073597687 10:104817327-104817349 AGGAGGGAGGCAGGGAAGGGAGG - Intronic
1074675115 10:115839648-115839670 CGGAGGGAGGCAGGCAGGAGAGG - Intronic
1076326489 10:129627386-129627408 AGGAGGGAAGCAGGGAAGAGAGG - Intronic
1076474514 10:130743070-130743092 GGGAAGGAGGCGGGCAGGTGGGG - Intergenic
1076474522 10:130743090-130743112 AGGAAGGAGGCGGGCAGGTGGGG - Intergenic
1076474530 10:130743110-130743132 AGGAAGGAGGCGGGCAGGTGAGG - Intergenic
1076474536 10:130743130-130743152 GGGAAGGAGGCGGGCAGGTGAGG - Intergenic
1076474542 10:130743150-130743172 GGGAAGGAGGCGGGCAGGTGGGG - Intergenic
1076815047 10:132910409-132910431 AGGACGGAGCCCCGAAAGTGGGG + Intronic
1076979581 11:197445-197467 AGGAGCCAGGCGGGCAGGTGGGG + Intronic
1077272216 11:1686719-1686741 AGGAGGGAGGCAGGGAAGGAGGG - Intergenic
1077272300 11:1686981-1687003 AAGAGGGAGGCAGGGAAGGGGGG - Intergenic
1077307220 11:1873818-1873840 AGGAGGGAGGCCGGCAGAGGAGG + Intronic
1077307226 11:1873835-1873857 AGGAGGGAGGCCGGCAGAGGAGG + Intronic
1077307232 11:1873852-1873874 AGGAGGGAGGCTGGCAGAGGAGG + Intronic
1077307248 11:1873903-1873925 AGGAGGGAGGCCGGCGGAGGAGG + Intronic
1077307254 11:1873920-1873942 AGGAGGGAGGCCGGCAGAGGAGG + Intronic
1077307259 11:1873937-1873959 AGGAGGGAGGCCGGCAGAGCAGG + Intronic
1077307273 11:1873971-1873993 AGGAGGGAGGCCGGCGGAGGAGG + Intronic
1077307283 11:1874005-1874027 AGCAGGGAGGCCGGCAGAGGAGG + Intronic
1077307289 11:1874022-1874044 AGGAGGGAGGCCGGCAGAGGAGG + Intronic
1077307299 11:1874056-1874078 AGCAGGGAGGCCGGCAGAGGAGG + Intronic
1077307304 11:1874073-1874095 AGGAGGGAGGCCGGCAGAGCAGG + Intronic
1077307310 11:1874090-1874112 AGCAGGGAGGCCGGCAGAGGAGG + Intronic
1077376182 11:2205923-2205945 AGGTGGCAGGCTGGGAAGTGAGG - Intergenic
1077496885 11:2890834-2890856 CGCAGGGAGGCCGGCACCTGCGG - Intronic
1078159571 11:8828913-8828935 AGGAGGGAGGCAGGGAAGGGAGG + Intronic
1079089211 11:17469065-17469087 AGGAGGGAGGGAGGGAAGGGAGG - Intronic
1079102569 11:17551015-17551037 ATGAGGGAGGCTGACATGTGAGG + Intronic
1079189371 11:18265060-18265082 AGGAGGGAGGGAGGGAAGGGAGG + Intergenic
1080458580 11:32435443-32435465 GGGAGGGAGGGCGGGAAGTGGGG + Exonic
1081616512 11:44594611-44594633 AGAAGGCAGGCAGGCCAGTGAGG - Intronic
1082162506 11:48900596-48900618 AGGTGGGAGGCCGGCTCTTGGGG + Intergenic
1082174908 11:49048589-49048611 AGGTGGGAGGCCGGCTCTTGGGG + Intergenic
1082243226 11:49892190-49892212 AGGTGGGAGGCCGGCTCTTGGGG + Intergenic
1082657726 11:55873015-55873037 AGGTGGGAGGCCGGCTCTTGGGG + Intergenic
1083623146 11:64058825-64058847 AAGAGGGCAGCCGGCAAGGGGGG + Intronic
1083780338 11:64914301-64914323 AGGCTGGGGGCAGGCAAGTGGGG - Intronic
1083816789 11:65137272-65137294 AGTGGGGAGGAAGGCAAGTGTGG + Intergenic
1084021523 11:66420829-66420851 GGGAGGGAGGCGGGCGAGGGGGG - Intergenic
1084546929 11:69819270-69819292 GGGCGGGAGGCCGGCGGGTGGGG + Intergenic
1084641764 11:70430493-70430515 AGGAGGGAGGCAGGAGTGTGAGG - Intronic
1085404650 11:76254729-76254751 CGGTGGGAGGCTGGCCAGTGTGG + Intergenic
1085516251 11:77113442-77113464 AGGAGGGAGGAGGGGCAGTGGGG + Intronic
1086393584 11:86391034-86391056 AGGAGGGAAGCCAGCAAAGGGGG + Intronic
1086690866 11:89787497-89787519 AGGTGGGAGGCCGGCTCTTGGGG - Intergenic
1086714934 11:90052158-90052180 AGGTGGGAGGCCGGCTCTTGGGG + Intergenic
1088457365 11:110047153-110047175 AGGAGGCAGGCAGGCAGATGGGG - Intergenic
1089254456 11:117186946-117186968 AGGAGGGAGGACAGAAAGAGAGG - Intronic
1090458044 11:126866622-126866644 AGGAGGGTGGCAGGCCAGAGTGG - Intronic
1090561271 11:127935442-127935464 AGGAGGGAGGCTGGGAAGTTTGG - Intergenic
1091108354 11:132943353-132943375 AGGAGGGAGGCGGCCAGGAGGGG + Exonic
1091449143 12:561932-561954 GGGCGGGAGGCCTGCACGTGGGG - Exonic
1091665513 12:2415889-2415911 AGAAGGGTGGCCGGGAAATGCGG - Intronic
1091918144 12:4283723-4283745 AGGAGGGAGGCGGGAATGTCGGG + Intronic
1091919689 12:4294281-4294303 AGGAGGGAAGGGGGCAAGGGAGG + Intronic
1092253620 12:6914883-6914905 GGGAGAGAGGCAGGCAAGGGTGG - Intronic
1092893228 12:12989053-12989075 AGCAGGGATGCCTTCAAGTGAGG + Intronic
1094008470 12:25781562-25781584 AGGAGGGAGGAGGGAAAGTGAGG - Intergenic
1094064655 12:26350172-26350194 CGGAGGGAAGCAGGTAAGTGAGG + Intronic
1095922646 12:47546218-47546240 AGGAGGCATGCAGGCAAGAGTGG - Intergenic
1096086260 12:48867054-48867076 ATGAGGGACTCTGGCAAGTGGGG + Intergenic
1097054407 12:56241136-56241158 TGGAGGGAGGTGGGCAAGAGGGG + Exonic
1097694981 12:62767101-62767123 AGGTGGGAGGCTGACAAGAGGGG + Intronic
1099499061 12:83389042-83389064 AGAAGGGAGGAAGGGAAGTGTGG + Intergenic
1101212740 12:102551011-102551033 AGGAAGGAGGGAGGGAAGTGGGG - Intergenic
1101675032 12:106909576-106909598 TGGAGGGAGCCAGGGAAGTGGGG + Intergenic
1102419334 12:112791621-112791643 AGGTGGGAGGCCGGGAGGGGAGG - Intronic
1102851214 12:116246845-116246867 AGGAGGGAGGTGGGGAGGTGGGG + Intronic
1103238942 12:119397849-119397871 GGGAGGGAGGGCAGAAAGTGGGG + Intronic
1103742063 12:123097640-123097662 GGCAGGCAGGCAGGCAAGTGAGG - Intronic
1103775700 12:123364920-123364942 AGGAGGGAGGAAGTCACGTGAGG - Intergenic
1103960452 12:124606076-124606098 AGGAGGGAGCGAGGGAAGTGAGG + Intergenic
1103985990 12:124767789-124767811 AGGAGGGAGGCAGGAAGGTGGGG - Intergenic
1104201391 12:126593139-126593161 TGGAGGGAGGCAAGAAAGTGAGG + Intergenic
1104554666 12:129788875-129788897 AGAAGGGAGTCTGGCATGTGTGG + Intronic
1104619647 12:130301650-130301672 TGGAGGGAGTCAGGCAAGAGAGG + Intergenic
1104737720 12:131148347-131148369 TGGAGGGAGGGAGGCAGGTGAGG - Intergenic
1104914068 12:132255679-132255701 AGGCGGGAGGACCGGAAGTGGGG - Intronic
1104952455 12:132447638-132447660 AGGTGGGGGGCAGGCACGTGAGG + Intergenic
1105048603 12:133027947-133027969 AGTAGGTAGGCAGACAAGTGAGG - Intergenic
1105420758 13:20249622-20249644 AAGATGGAGGCCGGGAAGGGTGG - Intergenic
1105511215 13:21053268-21053290 AGGAGTGAGCCAGGCAGGTGGGG - Intronic
1106364660 13:29066971-29066993 AGGAGGGAGGCTGTCAATTTGGG + Intronic
1106622078 13:31380376-31380398 AGGAGGGAGGAAGAGAAGTGTGG + Intergenic
1110253941 13:73410666-73410688 AGGAGGGTGGGAGGCAGGTGAGG - Intergenic
1111834240 13:93368259-93368281 AGGAGGGAGGGAGGAAAGGGAGG - Intronic
1113572862 13:111370972-111370994 AGGAGGGAGGCGGGGAAGACAGG - Intergenic
1113685100 13:112277600-112277622 AGGATGGAGTCAGGTAAGTGTGG + Intergenic
1113685105 13:112277634-112277656 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113685163 13:112277974-112277996 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113685231 13:112278382-112278404 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113685248 13:112278484-112278506 AGGATGGAGACAGGAAAGTGAGG + Intergenic
1113685264 13:112278586-112278608 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113685302 13:112278824-112278846 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113685340 13:112279028-112279050 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113685474 13:112279776-112279798 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113685493 13:112279878-112279900 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113685541 13:112280150-112280172 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113685574 13:112280354-112280376 AGGATGGAGTCAGGTAAGTGTGG + Intergenic
1113685625 13:112280660-112280682 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113685664 13:112280898-112280920 AGGATGGAGTCAGGTAAGTGTGG + Intergenic
1113685729 13:112281272-112281294 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113685765 13:112281475-112281497 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113685784 13:112281577-112281599 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113685826 13:112281815-112281837 AGGATGGAGTCAGGTAAGTGGGG + Intergenic
1113685846 13:112281917-112281939 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113685866 13:112282019-112282041 AGGAGGGAGCCAGGTAAGTGTGG + Intergenic
1113685928 13:112282359-112282381 AGGATGGAGTCAGGTAAGTGGGG + Intergenic
1113685948 13:112282461-112282483 AGGAGGGAGCCAGGTAAGTGTGG + Intergenic
1113686007 13:112282801-112282823 AGGATGGAGACAGGAAAGTGTGG + Intergenic
1113686059 13:112283106-112283128 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113686096 13:112283310-112283332 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113686143 13:112283582-112283604 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113686179 13:112283786-112283808 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113686197 13:112283888-112283910 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113686258 13:112284228-112284250 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113686354 13:112284772-112284794 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113686391 13:112284976-112284998 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113686409 13:112285078-112285100 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113686448 13:112285316-112285338 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113686487 13:112285520-112285542 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113686507 13:112285622-112285644 AGGATAGAGGCAGGTAAGTGTGG + Intergenic
1113686622 13:112286267-112286289 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113686670 13:112286539-112286561 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113686703 13:112286743-112286765 AGGATGGAGTCAGGTAAGTGTGG + Intergenic
1113686737 13:112286947-112286969 AGGATGGAGACAGGAAAGTGTGG + Intergenic
1113686772 13:112287151-112287173 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113686807 13:112287355-112287377 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113686843 13:112287559-112287581 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113686861 13:112287661-112287683 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113686920 13:112288001-112288023 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113686974 13:112288307-112288329 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113686995 13:112288409-112288431 AGGAGGGAGCCAGGTAAGTGTGG + Intergenic
1113687107 13:112289055-112289077 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113687146 13:112289293-112289315 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113687181 13:112289497-112289519 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113687301 13:112290177-112290199 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113687335 13:112290381-112290403 AGGATGGAGTCAGGTAAGTGTGG + Intergenic
1113687427 13:112290925-112290947 AGGATGGAGTCAGGTAAGTGTGG + Intergenic
1113687513 13:112291401-112291423 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113687590 13:112291809-112291831 AGGATGGAGACAGGAAAGTGTGG + Intergenic
1113687642 13:112292114-112292136 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113687679 13:112292318-112292340 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113687739 13:112292658-112292680 AGGATGGAGTCAGGTAAGTGGGG + Intergenic
1113687837 13:112293202-112293224 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113687873 13:112293406-112293428 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113687891 13:112293508-112293530 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113687933 13:112293746-112293768 AGGATGGAGTCAGGTAAGTGGGG + Intergenic
1113687953 13:112293848-112293870 AGGAGGGAGCCAGGTAAGTGTGG + Intergenic
1113688047 13:112294392-112294414 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113688084 13:112294596-112294618 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113688119 13:112294800-112294822 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113688138 13:112294902-112294924 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113688200 13:112295243-112295265 AGGAGGGAGCCAGGTAAGTGTGG + Intergenic
1113688312 13:112295889-112295911 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113688350 13:112296093-112296115 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113688369 13:112296195-112296217 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113688411 13:112296433-112296455 AGGATGGAGTCAGGTAAGTGGGG + Intergenic
1113688430 13:112296535-112296557 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113688449 13:112296637-112296659 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113688502 13:112296943-112296965 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113688523 13:112297045-112297067 AGGAGGGAGCCAGGTAAGTGTGG + Intergenic
1113688675 13:112297929-112297951 AGGATGGAGTCAGGTAAGTGTGG + Intergenic
1113688761 13:112298405-112298427 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113688799 13:112298609-112298631 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113688854 13:112298915-112298937 AGGATGGAGACAGGAAAGTGTGG + Intergenic
1113688905 13:112299220-112299242 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113688942 13:112299424-112299446 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113688984 13:112299662-112299684 AGGATGGAGTCAGGTAAGTGGGG + Intergenic
1113689003 13:112299764-112299786 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113689057 13:112300070-112300092 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113689078 13:112300172-112300194 AGGAGGGAGCCAGGTAAGTGTGG + Intergenic
1113689174 13:112300716-112300738 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113689254 13:112301158-112301180 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113689309 13:112301464-112301486 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113689329 13:112301566-112301588 AGAAGGGAGCCAGGTAAGTGTGG + Intergenic
1113689427 13:112302110-112302132 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113689464 13:112302314-112302336 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113689500 13:112302518-112302540 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113689519 13:112302620-112302642 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113689579 13:112302960-112302982 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113689640 13:112303299-112303321 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113689678 13:112303503-112303525 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113689697 13:112303605-112303627 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113689721 13:112303741-112303763 AGGATGGAGTCAGGTAAGTGTGG + Intergenic
1113689807 13:112304217-112304239 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113689848 13:112304455-112304477 AGGATGGAGTCAGGTAAGTGTGG + Intergenic
1113689934 13:112304931-112304953 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113689974 13:112305135-112305157 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113690028 13:112305441-112305463 AGGATGGAGACAGGAAAGTGTGG + Intergenic
1113690080 13:112305746-112305768 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113690117 13:112305950-112305972 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113690194 13:112306392-112306414 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113690230 13:112306596-112306618 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113690248 13:112306698-112306720 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113690290 13:112306936-112306958 AGGATGGAGTCAGGTAAGTGGGG + Intergenic
1113690310 13:112307038-112307060 AGGAGGGAGCCAGGTAAGTGTGG + Intergenic
1113690369 13:112307378-112307400 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113690404 13:112307582-112307604 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113690423 13:112307684-112307706 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113690465 13:112307922-112307944 AGGATGGAGTCAGGTAAGTGGGG + Intergenic
1113690527 13:112308262-112308284 AGGATGGAGTCCGGTAAGTGTGG + Intergenic
1113690636 13:112308873-112308895 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113690654 13:112308975-112308997 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113690760 13:112309553-112309575 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113690795 13:112309757-112309779 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113690814 13:112309859-112309881 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113690869 13:112310165-112310187 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113691043 13:112311117-112311139 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113691095 13:112311423-112311445 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113691209 13:112312069-112312091 AGGATGGAGTCAGGTAAGTGTGG + Intergenic
1113691228 13:112312171-112312193 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113691247 13:112312273-112312295 AGGATGGAGCCAGGTAAGTGTGG + Intergenic
1113691670 13:112315470-112315492 AGGATGGAGCCTGCCAAGTGTGG + Intergenic
1113691688 13:112315572-112315594 AGGATGGAGCCTGCCAAGTGTGG + Intergenic
1113691708 13:112315708-112315730 AGGATGGAGCCTGCCAAGTGTGG + Intergenic
1113691882 13:112316861-112316883 AGGATGCAGGCAGGTAAGTGTGG + Intergenic
1113692205 13:112318929-112318951 AGGATGGAGCCAGGTAAGTGCGG + Intergenic
1114170032 14:20262897-20262919 AGGAGGGAGGGAGGAAAGTGAGG + Intronic
1114517604 14:23309811-23309833 AGGAGGGTGGCAGGCAGGTCCGG - Exonic
1114562459 14:23603165-23603187 AGGGAGGAGGCCGGCAGGGGAGG + Intergenic
1114866028 14:26597221-26597243 GGGAGGGAGGACGGCGAGGGAGG + Intronic
1115033049 14:28821223-28821245 AGGAGGGAGGGCGGAAAGAAGGG - Intergenic
1115399586 14:32941225-32941247 AGGAGGGAGGAGGGGAAGGGAGG - Intronic
1115991318 14:39153499-39153521 AGGAGGTAGGACTGCAGGTGTGG - Intronic
1116808838 14:49519977-49519999 AGGAGGGAGGCAGGAAAGGAGGG + Intergenic
1118994334 14:70822693-70822715 AGGAGGGAAGAAGGAAAGTGGGG - Intergenic
1119437805 14:74609615-74609637 AGGAGGGGGGCCTGGAGGTGAGG - Intronic
1119725630 14:76920389-76920411 AGGATGGAGGCCGGAACCTGGGG - Intergenic
1121319179 14:92981184-92981206 AGGATGGAGGCCAGAAATTGAGG - Intronic
1121550106 14:94792854-94792876 AGGAGGGAGGGAGGGAAGGGAGG + Intergenic
1121935423 14:98014056-98014078 AGGAGGGAGGGAGGCAAGGAGGG - Intergenic
1121935429 14:98014072-98014094 GGGAGGGAGGCAGGCAAGGAGGG - Intergenic
1122044303 14:99012316-99012338 GGGAGGGAGTTGGGCAAGTGAGG - Intergenic
1122409711 14:101519648-101519670 AGGAAGGAGGGCGGCGAGGGAGG + Intergenic
1122527122 14:102394930-102394952 AGGAGGGAGTGGGGCAAGTCAGG - Intronic
1122601900 14:102925635-102925657 AGTAAGGAGGCCGGCAGGGGAGG - Intronic
1122628907 14:103098587-103098609 AGGACGGAGGCGGGGATGTGGGG - Intergenic
1122771321 14:104099208-104099230 AGGCGGGAGGCCTGGAAGAGAGG + Intronic
1122817300 14:104320045-104320067 AGAAGCGTGGCCGGCAGGTGTGG - Intergenic
1123041943 14:105493917-105493939 CAGAGGGAGGCCAGCAGGTGAGG + Exonic
1124432642 15:29620365-29620387 AGGAGGTGGGCCGGCAGGTCAGG + Intergenic
1124652735 15:31485196-31485218 AGGATGGAGGCCTTCAGGTGGGG + Intronic
1124712853 15:32030100-32030122 AGGAGGGAGTCCGGGAAGACTGG + Intergenic
1126115872 15:45207101-45207123 GGGAGGGAGGCCGGGGAGGGCGG + Intergenic
1126151366 15:45526238-45526260 GGGAGGGAGGCAGGCAAGGAAGG - Intergenic
1126520723 15:49591376-49591398 AGGAGGGAGGGAGGGAAGGGAGG - Intronic
1127267954 15:57376436-57376458 AGGAGGGCGGGCGGCGACTGCGG + Intronic
1127858178 15:62969718-62969740 AGGAGGGAGATGGGGAAGTGAGG - Intergenic
1127975356 15:63993084-63993106 AGGAGAGGGGAGGGCAAGTGGGG - Intronic
1128136017 15:65264058-65264080 ATGAGGGAGGCCGACATGCGGGG + Intronic
1128515389 15:68338860-68338882 AGAGGGGAGGGCGGCAAGGGGGG - Intronic
1128636205 15:69304049-69304071 AGGAAGGAGACAGGCAGGTGAGG + Intronic
1128669745 15:69566194-69566216 AGGAAGGAGGCCGGGCAGGGTGG - Intergenic
1128692695 15:69737298-69737320 AAGAGGGAGGCAAGAAAGTGAGG + Intergenic
1129654063 15:77511024-77511046 AGCAGGGAGGTGGCCAAGTGAGG + Intergenic
1129912406 15:79239606-79239628 AGGAGTGAGCCAGGTAAGTGTGG - Intergenic
1130831626 15:87607107-87607129 AAGAGGGAAGCAGGCATGTGAGG + Intergenic
1131225942 15:90624463-90624485 AGGAGGGAGGGTGGCACATGGGG - Intronic
1131346719 15:91656381-91656403 GGGAGGGAGGCAGGGAAGCGGGG - Intergenic
1132629890 16:912070-912092 AGGAGGGAGCCCGGCCTGTGGGG - Intronic
1132878512 16:2150707-2150729 AAGAGGGAGGTGGGGAAGTGGGG - Intronic
1132883115 16:2171005-2171027 AGGAAGGAGGCGGGCGAGGGCGG + Intronic
1133063177 16:3188566-3188588 AGGAGGGAGGCGGGGAAGACCGG + Intergenic
1133236977 16:4392049-4392071 AGGAGGGAAGGGGGTAAGTGGGG - Intronic
1133237270 16:4393066-4393088 AGGAGGAAGGCTGGAAAGAGGGG + Intronic
1133647176 16:7775248-7775270 AGGAGGGAGGAAGGGAAGGGAGG + Intergenic
1133709111 16:8384130-8384152 AGGAGGAAGGAGGACAAGTGTGG - Intergenic
1134310360 16:13070611-13070633 AGGCAGGAGGCCGGGAAGTGGGG + Intronic
1134459077 16:14416104-14416126 AGGAGGGAGGGAGGTAAGGGAGG + Intergenic
1135913099 16:26579070-26579092 AGGAGGGAGGGAAGCAAGGGAGG - Intergenic
1135913127 16:26579162-26579184 AGGAGGGAGGGAGGGAAGGGAGG - Intergenic
1136096715 16:27962244-27962266 AGAAGGGAGGCTGGGAAATGTGG - Intronic
1136474397 16:30503553-30503575 GGGAGGGAGGCAGGCAAGGAGGG + Intronic
1136567867 16:31080710-31080732 AGGTGGGTGGCCGGTAGGTGGGG + Exonic
1137443020 16:48512026-48512048 AGGATGGAGACCAGGAAGTGAGG + Intergenic
1137530387 16:49275588-49275610 AGGAGGCAGGCTGGTAAGAGAGG + Intergenic
1137558003 16:49484770-49484792 AGGAGGGAGGGAGGGAAGGGAGG - Intergenic
1137718387 16:50612781-50612803 AGTGGGGTGGTCGGCAAGTGTGG + Intronic
1137915871 16:52429387-52429409 AGGAGGGAGGCAGTGAAGTATGG - Intergenic
1137959846 16:52871543-52871565 AAGAGGGTGGCCAGAAAGTGAGG - Intergenic
1137960433 16:52876922-52876944 AGGGGGGATGCAGGCAAGTTAGG + Intergenic
1138501672 16:57449096-57449118 AGGAGGGAGGAAGGCAGGTGGGG + Intronic
1139106463 16:63832704-63832726 AGGATGTAGGCCAGCTAGTGGGG - Intergenic
1139398245 16:66658259-66658281 AGGAGGGAGGCAGGCAGGGAGGG + Intronic
1139477360 16:67209401-67209423 AGGAGTAAGGCCGGGAAGAGAGG + Intronic
1139919315 16:70449330-70449352 AGTAGGGATGCCTGCAACTGCGG - Intergenic
1140186999 16:72783275-72783297 AGGGGGGAGGGGGGCAAGTTTGG - Exonic
1141097962 16:81176297-81176319 AGCACGGAGGCAGGAAAGTGTGG - Intergenic
1141597528 16:85106502-85106524 AAGAGGGAGGCGGGCAGGTCAGG + Intronic
1141884170 16:86880424-86880446 AGAAGGGAGGCCGGCTGGTGGGG - Intergenic
1142034426 16:87854794-87854816 AGGTGGGAGGCAGCCAGGTGAGG - Intronic
1142119216 16:88377651-88377673 AGGAGGGAGGATGGGGAGTGAGG - Intergenic
1142193841 16:88730342-88730364 AGGAGGGAGGCCTGTAATTTGGG + Intronic
1142211946 16:88812483-88812505 GGGAGGGAGGCCGGAAGGTGTGG + Intergenic
1142372058 16:89688024-89688046 AGAAGGGAAGCCGGGAAATGGGG + Intronic
1142737982 17:1913652-1913674 AGGAGGGAGGCTGGGGAGGGAGG + Intergenic
1143410822 17:6707369-6707391 AGGAGGGAGGCAGGGAGGAGGGG - Intronic
1143723123 17:8827606-8827628 AGGAGTAAGGACTGCAAGTGTGG + Intronic
1144445731 17:15326372-15326394 AGGAGGGAGTCAGACAAGAGAGG + Intronic
1144630088 17:16866970-16866992 AGTAGAGAGGCTGGGAAGTGCGG + Intergenic
1144833309 17:18143651-18143673 AGGAGGGAGGCTGGCAGGTGGGG + Intronic
1145828722 17:27897772-27897794 AGGAAGGAAGCGGGGAAGTGAGG + Intergenic
1145880171 17:28347448-28347470 AGGAGGGAGGCAAGCCAGTCGGG - Exonic
1145888578 17:28399159-28399181 AGGAGGGAGGGAGGTAAGAGGGG - Exonic
1145907682 17:28525140-28525162 AGCATGGAGGGGGGCAAGTGGGG + Intronic
1146059790 17:29598506-29598528 GGGAGGGAGGCAGGGAAGGGAGG - Intronic
1146176531 17:30668985-30669007 AGCAGGAAGGCTGGGAAGTGGGG - Intergenic
1146342563 17:32033365-32033387 AGGAGGGAGGGAGGGAAATGAGG + Intronic
1146349993 17:32085099-32085121 AGCAGGAAGGCTGGGAAGTGGGG - Intergenic
1146631723 17:34474841-34474863 AGAAGGGAGGCAGGGAAGTGAGG - Intergenic
1146927361 17:36754252-36754274 AGGAGGGAGGCCGGCATGGTAGG + Intergenic
1147930661 17:43978561-43978583 GGGAGAGAGGCTGGCAAGGGGGG - Intronic
1147933715 17:43999159-43999181 AGGAGGGAGGGAGGCAAAGGTGG + Intronic
1148872353 17:50666129-50666151 AGGAGTTAGGCAGGCAAGAGGGG - Intronic
1149066735 17:52489411-52489433 AGAAGGGAGGCGGGCAGGTGGGG + Intergenic
1150137006 17:62701621-62701643 AGGAGGGAGGGAGGCACTTGGGG + Exonic
1150164428 17:62927728-62927750 TGGAGGGAGTCCGGAAATTGAGG - Intergenic
1150216736 17:63475597-63475619 AGGAGGGAGGCTGGCAAAGCGGG + Intergenic
1150561874 17:66302161-66302183 AGGAGGCCGGGCGGCAAGAGCGG + Intergenic
1150786265 17:68165387-68165409 AGGAGGGAGGCGGGGAAGGAAGG + Intergenic
1151037782 17:70821341-70821363 AGGAGGCAGGGTGGCAAGAGTGG + Intergenic
1151358195 17:73572481-73572503 AAGAGGGAGGCTGGCATGAGAGG - Intronic
1151513307 17:74575704-74575726 AGGAGGGAGTACGGCAAATGAGG + Intergenic
1151643468 17:75413774-75413796 AGGAGGGAGGGAGGGAAGGGAGG - Intergenic
1152013345 17:77734492-77734514 AGGAGGGAGGAAGGCAGGCGGGG - Intergenic
1152021517 17:77782229-77782251 AGGAGGGAGGTCAGCAAGCGGGG - Intergenic
1152024134 17:77797758-77797780 AGAGGGAAGGACGGCAAGTGTGG + Intergenic
1152095378 17:78269098-78269120 AGGAGGGAGGACGGGAAGGGAGG + Intergenic
1152539553 17:80968042-80968064 AGGAGGGAGGCAGGCGAGCCGGG - Intergenic
1152558514 17:81066539-81066561 AAGAGGGAGGCCGACACCTGCGG - Intronic
1152599156 17:81252808-81252830 AGCAGGGAGGCCGGCAGGGGAGG - Intronic
1152703038 17:81828919-81828941 AGGGGGGAGGGCAGGAAGTGTGG + Intronic
1152870786 17:82752023-82752045 CGTAGCGAGGCCGGCGAGTGGGG + Intergenic
1153630742 18:7067512-7067534 GGGAGGGAGGAGAGCAAGTGGGG + Intronic
1154308914 18:13252771-13252793 TGGAGGGCCGACGGCAAGTGAGG - Intronic
1154358590 18:13641575-13641597 AGGAGGGAGGCCGGGGCCTGTGG + Intronic
1155076110 18:22357020-22357042 AGGAGGGAGGGAGGGAAGTAAGG - Intergenic
1156864434 18:41873204-41873226 AGGAGGGAGGCCTTTAAGTGGGG - Intergenic
1157222487 18:45837925-45837947 AGGCGGGAGGGCGGGAAGGGAGG - Intronic
1158005064 18:52662664-52662686 AGGAGGGAGGGAGGGAAGTAAGG + Intronic
1158741323 18:60145855-60145877 AAGAGAGAGGCCTGCAAGAGAGG - Intergenic
1159915926 18:74187669-74187691 GGAAGGGAGGCCGGGAGGTGAGG - Intergenic
1160393943 18:78558565-78558587 AGGAGGGAGGGCGGCCACGGGGG - Intergenic
1160579053 18:79873407-79873429 GGGAGGGGGGCCGGCAGGAGCGG - Intronic
1161316887 19:3621403-3621425 AGGAAGGTGGTCGGGAAGTGGGG - Intronic
1161491914 19:4566938-4566960 GGGAGTGAGGCTGGCGAGTGTGG - Intergenic
1162043570 19:7984725-7984747 AGCAGGAAGGCAGGCAGGTGAGG + Intronic
1162435339 19:10654648-10654670 GGGAGCGAGGCCGGCAAGGGAGG - Intronic
1162535985 19:11262854-11262876 AGGAGGGAGGGAGGGAAGGGAGG + Intergenic
1162588993 19:11578579-11578601 AGGAGGCAGGCAGGGAGGTGAGG - Exonic
1162982292 19:14247904-14247926 AGCAGGAAGGCTGGGAAGTGGGG + Intergenic
1163166616 19:15502482-15502504 TGGAGGGAGGGAGGAAAGTGAGG + Intergenic
1163682044 19:18688349-18688371 AGCAGGGAGGAGGGCAGGTGAGG + Intronic
1164588697 19:29494529-29494551 AGGAGGGAGGCAGGGAAGAAGGG + Intergenic
1164732398 19:30516264-30516286 AGGACGGAGGACGGCAAAGGAGG - Intronic
1164849325 19:31468404-31468426 AGGAGGGAGGGGAGCAAGGGCGG + Intergenic
1165316598 19:35060000-35060022 AGGAGGGCAGCGGGCAGGTGGGG + Intronic
1165353910 19:35292110-35292132 AGGGGAGGGGCTGGCAAGTGGGG + Exonic
1165364704 19:35358429-35358451 AGGAGGGAGGCACGCAGTTGTGG + Intergenic
1165366522 19:35370898-35370920 AGGAGGGAGGCACGCAGTTGTGG + Intergenic
1165422290 19:35728191-35728213 AGAAGGGAAGCCGGGGAGTGAGG + Intronic
1165994424 19:39833888-39833910 AGGGGGGTGGCAGGCAGGTGCGG - Intronic
1166288527 19:41847333-41847355 AGGATGGAGACCTGCAGGTGTGG + Intronic
1166670844 19:44708777-44708799 AGGATGGAGGCCTGTAGGTGTGG + Intronic
1166679473 19:44758151-44758173 GGGTGGGTGGCCGGCACGTGGGG - Intronic
1166795100 19:45421152-45421174 AGGAGGGAGACGGAGAAGTGAGG - Intronic
1167113750 19:47476760-47476782 TGGAGGGAGGCCGGTGGGTGTGG + Intronic
1167254410 19:48418672-48418694 GGAAGGGAGGACGGCAAATGAGG + Intronic
1167423970 19:49420264-49420286 AGAATGGAGGCCAGCAGGTGGGG + Intergenic
1167741822 19:51328627-51328649 TGGAGGGAGGCCTGAGAGTGGGG - Intronic
1168430738 19:56277756-56277778 AGGAGGGTGGCAGGGAGGTGAGG + Intronic
1168468231 19:56621088-56621110 AGGAGGGAGGCATGGAACTGAGG - Intronic
925434701 2:3826931-3826953 GGGAGGGAGGCAGGGAAGGGAGG - Intronic
926221975 2:10942353-10942375 ATGAGGGTGGCAGGGAAGTGGGG - Intergenic
926253300 2:11168645-11168667 AGGAGGGAGGACTGCAGGGGAGG - Intronic
926688796 2:15718546-15718568 TGAAGGGAGGCCAGCAGGTGGGG - Intronic
928174472 2:29024478-29024500 GGGAGGGAAGCAGGCAAGTGAGG + Intronic
928902564 2:36336015-36336037 GGGAGGGAGGGAGGCAAGAGAGG + Intergenic
929589289 2:43134637-43134659 CCGAGGGAGGAGGGCAAGTGGGG + Intergenic
929992264 2:46800484-46800506 GGGAAGGAGGCAGGAAAGTGTGG + Intergenic
930622522 2:53658883-53658905 AGGAGGGAGGGGGGGGAGTGAGG + Intronic
931006698 2:57857945-57857967 GGGAGGGAGGGAGGAAAGTGTGG - Intergenic
931249747 2:60519533-60519555 GGCAGGCAGGCAGGCAAGTGAGG - Intronic
932012392 2:67991650-67991672 AGGAGGGTGGCTTTCAAGTGGGG - Intergenic
933454864 2:82507968-82507990 AGGAAGGAGGCCGGGGGGTGGGG + Intergenic
933897994 2:86828182-86828204 AAGATGGTGGCTGGCAAGTGGGG + Intronic
934588567 2:95526882-95526904 AGGTGGGAGGCCGGCTCTTGGGG - Intergenic
935593924 2:104865068-104865090 AGGAAGGAGGCAGGCCGGTGGGG - Intergenic
935761299 2:106322990-106323012 TGGACGGAGGCAGGTAAGTGGGG + Intergenic
936241348 2:110790987-110791009 AGGAGGCAGACAGGGAAGTGGGG - Intronic
936291359 2:111226393-111226415 AGGAGGGAGGCTGGCAGGTTTGG + Intergenic
937438393 2:121897486-121897508 AGGAGTGAGGCAGGCAGATGAGG - Intergenic
937447524 2:121971395-121971417 CAGAGGGAGGCTGGGAAGTGTGG + Intergenic
937977863 2:127592736-127592758 AGGGGGGTGGCTGGAAAGTGGGG + Intronic
938072926 2:128317896-128317918 GGGAGGGGTGCCGGCGAGTGGGG + Intronic
939144011 2:138390722-138390744 TGGAGGGAGGGCGGGAAGTGGGG - Intergenic
940575134 2:155493794-155493816 AGGAAGGAGGCAGGCAAGCAGGG - Intergenic
940623904 2:156148902-156148924 AGGTGAGCGGCAGGCAAGTGAGG + Intergenic
941919988 2:170840643-170840665 AGGAGGGAGGTAGGGAAGGGAGG + Intronic
941944086 2:171075925-171075947 AGGTGGGAGGGAGGCAGGTGCGG + Intronic
942383224 2:175415213-175415235 AGGAAGGAGGCTGGAAGGTGAGG - Intergenic
942629435 2:177939502-177939524 AGGAGGGAGGGAGGGAAGGGAGG + Intronic
943018447 2:182543955-182543977 TGGAGGGAGACTGGCAGGTGGGG - Intergenic
943333823 2:186590219-186590241 AAGAGAGCGGCCGGCAAGTTTGG + Exonic
944822437 2:203444063-203444085 GGGAGGGAGGGAGGGAAGTGAGG + Exonic
946818552 2:223606721-223606743 AGAAGGCAGGCAGGCAGGTGAGG - Intergenic
947323765 2:228952247-228952269 AAGAGGGAGGGCGGCCAGTGTGG + Intronic
947448078 2:230179883-230179905 TGGAGGCAGGCCATCAAGTGAGG + Intronic
947731778 2:232435264-232435286 GGGAGGGAGACTGGCAGGTGTGG - Intergenic
1168744107 20:221454-221476 AGGAGGGAGGGAGGAAAGGGAGG + Intergenic
1171191886 20:23164730-23164752 AGGAGGGAGAGCGGCTAGGGTGG - Intergenic
1171427732 20:25058811-25058833 AGGACGGAGGCCGGCAGCTGGGG - Intronic
1172194811 20:33084582-33084604 AGGAGGGAACCAGGCAAGAGGGG + Intronic
1172292961 20:33789381-33789403 AGGAGGTAGGGTGGGAAGTGAGG - Intronic
1172740672 20:37164212-37164234 AGGAGGGAGGCAGGGAAGGAAGG - Intronic
1172843598 20:37916342-37916364 GGGAGGGAGGGAGGCAAGCGCGG - Intronic
1173150166 20:40560512-40560534 AGGAGGAATGCCCGCAAGTGTGG - Intergenic
1174063007 20:47845685-47845707 AGGAGGGAGGGGTGAAAGTGGGG + Intergenic
1174151353 20:48488681-48488703 AGGAGGGAGGGGTGAAAGTGGGG + Intergenic
1175495373 20:59410801-59410823 AAGGAGGAGGCCGGCAAGGGAGG - Intergenic
1175651633 20:60729705-60729727 AGGTGAGTGGCAGGCAAGTGAGG + Intergenic
1175882606 20:62269576-62269598 ACCAGGGAGGCCGGGAAGTGCGG - Intronic
1175957786 20:62620597-62620619 AGAAGGGATGCCTGCAGGTGGGG - Intergenic
1175990179 20:62784777-62784799 GCGAGGGAGGGAGGCAAGTGTGG + Intergenic
1178698842 21:34816808-34816830 AGGAGGGAGGCTGGACACTGAGG - Intronic
1178967119 21:37131294-37131316 AGGAGGGGGGCTGGAAATTGAGG + Intronic
1179021470 21:37644883-37644905 AGGAGGGAGGGCAGGAAGTCCGG - Intronic
1179100993 21:38355531-38355553 AGGAGCGAGGCAGGCAGGAGTGG + Intergenic
1179544512 21:42105353-42105375 AGGAGGGAGGCAGGGAGGTGTGG - Intronic
1179547431 21:42122185-42122207 AGGAGGGTGGAGGGCACGTGCGG + Intronic
1179720913 21:43315608-43315630 AGGAGGGAGGCTGGCAGGAGGGG + Intergenic
1179952148 21:44714358-44714380 AGGAGGGAGGGAGGCAGGGGAGG + Intergenic
1179972784 21:44845680-44845702 AGGAGGGAGGCGGGGAGGAGTGG + Intergenic
1180151555 21:45950788-45950810 GGGAGGGAGGCGGGCAGGAGGGG - Intergenic
1180641082 22:17299902-17299924 AGGAGGGTGACAGGCAAGCGGGG - Intergenic
1180867124 22:19126106-19126128 AGAAGGGACGCCCCCAAGTGCGG + Intergenic
1181442008 22:22941597-22941619 AGGCAGGAGGGCTGCAAGTGGGG + Intergenic
1181486209 22:23233285-23233307 AGGAGAAAGGCCGGCAGGAGTGG - Intronic
1181848334 22:25731295-25731317 GGGATGGAGGGCGGGAAGTGGGG - Intergenic
1182480480 22:30605671-30605693 AGGAAGGAGGGAGGCCAGTGGGG - Intronic
1183059443 22:35327127-35327149 AGGAGGGAGGCTGCCTAGAGAGG + Intronic
1183206472 22:36422942-36422964 AGGAGGCAGGCGGGTCAGTGAGG + Intergenic
1183357671 22:37368286-37368308 GGGAGGGAGGGAGGGAAGTGTGG + Exonic
1183369905 22:37426722-37426744 AGGAGGGAGGCAGCCCAGGGAGG - Intronic
1184107510 22:42376766-42376788 AGGAGGGAGGCCATCTGGTGAGG + Intergenic
1184383614 22:44161815-44161837 AGGAGTGAGGACGGCCCGTGCGG - Intronic
1184458896 22:44626127-44626149 GGGAGGGAGGCCCCCAGGTGAGG - Intergenic
1184645738 22:45893905-45893927 AGGCGAGAGGCCGGCAAGGCTGG - Intergenic
1184846255 22:47089577-47089599 AGGAGTGAGGCCGGCAGGGTGGG + Intronic
1185087683 22:48749550-48749572 AGGAAGGAAGCCGGCAAGTGGGG + Intronic
1185297325 22:50060842-50060864 AGGACGTGGGCCGGCCAGTGTGG + Exonic
1185390469 22:50558464-50558486 AACAGGGAGGACGGCAAGAGGGG - Intronic
950037705 3:9899034-9899056 AGGAGAGAGATCAGCAAGTGAGG + Intergenic
950444689 3:13029816-13029838 AGGAGGCAGGGAGGCCAGTGAGG - Intronic
951095261 3:18621908-18621930 GGGAGGGAAGCCTGCAAATGGGG + Intergenic
951523411 3:23630477-23630499 AGGAGGGAGGAAGGGAAGGGAGG + Intergenic
954156650 3:48688778-48688800 AGGAGAGAGACCAGCAAGTCAGG + Intronic
954368122 3:50156736-50156758 AGGAGCCAGGCCCGGAAGTGGGG + Intronic
954454891 3:50592520-50592542 TGGAGGGAGGCTGGCAACAGGGG - Intergenic
958411099 3:93816931-93816953 AGGAGGGAGGACTTGAAGTGTGG + Intergenic
958522319 3:95205096-95205118 AGGAGGAAGGAAGGCCAGTGTGG - Intergenic
958929251 3:100191355-100191377 AGGAAGGAGGGCAGCAAGAGAGG - Intronic
960004448 3:112767619-112767641 AGGAGGGAGGGAGGGAAGTTGGG - Intronic
960713779 3:120556455-120556477 CGGTGGGAGGCGGACAAGTGAGG + Intergenic
961674405 3:128555871-128555893 GGGAGGGTGGCGGGCATGTGGGG - Intergenic
962414821 3:135172652-135172674 AGGAGGGAGACTGGCAATTTCGG + Intronic
964184429 3:153925268-153925290 AGGAGGCAGGCAGGCTAGAGTGG + Intergenic
964790365 3:160449372-160449394 AGGAGGGAGGCCTGGGAGAGTGG - Intronic
968161696 3:196432200-196432222 AGGAGGGAGGACGGCAGCTGTGG + Intronic
968434280 4:576666-576688 AGGCGGGTGGGCGGGAAGTGCGG - Intergenic
968441700 4:627680-627702 AGGAGGGTGGCAGGAGAGTGAGG - Intronic
968475500 4:804812-804834 AGCCTGGAGGCCGGCAAGCGTGG + Intronic
968593957 4:1473015-1473037 AGGTGGGAGGTGGGCAGGTGGGG - Intergenic
968870541 4:3239808-3239830 AGGAAAAAGGCCGGCAAATGAGG - Intronic
969143525 4:5100569-5100591 GGGAGGGAGGCAGGCAAGGGAGG - Intronic
969467432 4:7366127-7366149 AGGAGGGTGGCAGGGATGTGCGG - Intronic
969542915 4:7804845-7804867 AGGAGAGGGGCCTGCAAGAGGGG + Intronic
969962541 4:10959739-10959761 AGGAGGGAAGCCAGCAAGAGTGG + Intergenic
970194414 4:13541336-13541358 AGGAGGGGAGCCTCCAAGTGTGG - Exonic
971195003 4:24464810-24464832 AGGAGGGAAGCGGGCAGGGGAGG - Intergenic
972338715 4:38131604-38131626 AGGTGGGAGGCCAGGAACTGTGG + Intronic
973767216 4:54173593-54173615 AGGAGGGAGGGAGGGAAGGGTGG + Intronic
973846016 4:54914088-54914110 AGGTGGGGAGTCGGCAAGTGAGG - Intergenic
974047224 4:56908201-56908223 CCGAGGAAGGCCGGTAAGTGGGG + Exonic
974599205 4:64054558-64054580 AGGAGGGAGACAGGCGAGTCTGG - Intergenic
974644235 4:64671771-64671793 AGTAGGGAGGCTGGCAGGGGGGG - Intergenic
976962709 4:90998867-90998889 GGGAGGGAGGGAGGCAAGAGTGG - Intronic
977202801 4:94136740-94136762 AGGAGGGAGGAAGGGAAGGGGGG + Intergenic
978688244 4:111475309-111475331 AGAAGGTAGGGAGGCAAGTGAGG - Intergenic
979597205 4:122547295-122547317 GGGAGGGAGGGCGGCAAGGAAGG + Intergenic
979732725 4:124044833-124044855 AGGAGGGACCCAGGCAAGTAGGG - Intergenic
979865061 4:125744122-125744144 GGGAGGGAGGGAGGGAAGTGGGG + Intergenic
981033725 4:140151165-140151187 AGGAAGAAGGCGGGCAAGAGTGG + Intronic
984149405 4:176108027-176108049 AGGGGAGAGGGAGGCAAGTGGGG - Intronic
984464290 4:180078054-180078076 GTGAAGGAGGCTGGCAAGTGTGG + Intergenic
985313123 4:188625597-188625619 AGGTGGGAGGACTCCAAGTGGGG - Intergenic
985485457 5:146080-146102 AGGAGGGAGGACTCCAAGTGGGG - Intronic
985485464 5:146105-146127 AGGAGGGAGGACTGCAAGTAGGG - Intronic
986663290 5:10077895-10077917 AGAAGGGAGGGGGGCCAGTGAGG - Intergenic
987276012 5:16363458-16363480 AGGAGGGAACCAGGCAAATGAGG + Intergenic
988699969 5:33663440-33663462 AGGAGGGAGGAAGGAAAGGGAGG + Intronic
989238118 5:39172585-39172607 AGGAGGGAGGGAGGAAGGTGTGG - Intronic
991963474 5:72068260-72068282 AAGAGGGAGTGAGGCAAGTGTGG - Intergenic
991974774 5:72175031-72175053 AGGAGGGAGGGAGGGAAGGGAGG - Intronic
992104514 5:73438264-73438286 GGGAGGGAGGCCAGGAAGGGGGG + Intergenic
993992482 5:94676622-94676644 AGGAGAGAGACCCTCAAGTGTGG - Intronic
996214151 5:120847621-120847643 AGGAGAAAGGCCAGAAAGTGGGG - Intergenic
996409918 5:123146802-123146824 AGGAGGGAAGCTGGAAACTGTGG + Intronic
997258853 5:132449979-132450001 CGGAGGGAGGTAGGGAAGTGAGG - Intronic
997434770 5:133866475-133866497 GGGAGGGAGGCAGGGAAGAGAGG - Intergenic
997675977 5:135713814-135713836 AGGAGGGAGGCTCCCAGGTGAGG - Intergenic
998953584 5:147415680-147415702 AGGAGGGAGGACGGCATGTCCGG + Intronic
999396085 5:151229286-151229308 AGCATGGAGGCTGGCAAGTTAGG + Intronic
1000129692 5:158284442-158284464 TGGATGGAGGCAGGCAAGAGTGG - Intergenic
1000132184 5:158310207-158310229 AATAGGGAGGCAGGGAAGTGAGG - Intergenic
1000291901 5:159878413-159878435 AGGAGGGAGGCTGGGAAATAAGG + Intergenic
1000463319 5:161547863-161547885 AGGAGGGATGGCGGCGGGTGGGG - Intronic
1002377010 5:178796057-178796079 AGGAGGGAGGGAGGGAAGTGGGG + Intergenic
1002781809 6:372837-372859 GGGAGGGAGACAGGCCAGTGGGG - Intergenic
1002846353 6:948606-948628 AGGAGGGAGGCCTGAGCGTGAGG + Intergenic
1002917721 6:1542199-1542221 AGGAGGGAGGCAGGGAAGGAGGG + Intergenic
1003020157 6:2502655-2502677 AGGAGGGCGGGTGGCAAGAGTGG + Intergenic
1004160230 6:13206152-13206174 AGGAGGGAGGACGGGAGGAGAGG + Intronic
1004389564 6:15198676-15198698 AGGAGGGAGATGGCCAAGTGTGG + Intergenic
1004632274 6:17433447-17433469 AGGAAGGAGGCAGGTCAGTGCGG - Intronic
1005057560 6:21744226-21744248 AGGAGGGAGGCCGGGGCGGGTGG - Intergenic
1005816091 6:29553921-29553943 AGGAGGGCGGTGGGCACGTGTGG + Intergenic
1006513542 6:34534065-34534087 AGGAGGGAGGAGGGCATCTGCGG - Exonic
1007325040 6:41053292-41053314 AGGAGAGAGGCAGGCAGGTCTGG - Exonic
1007534790 6:42576806-42576828 AGGAGGGAGGCCGGGCACGGTGG - Intronic
1007762080 6:44139088-44139110 AGGAGGGAGGAAGGCAAGAGAGG - Intronic
1007899710 6:45399715-45399737 GGGAGGTAGGGAGGCAAGTGGGG + Intronic
1009588585 6:65637802-65637824 AGGAGGGAGGCTGGCGGGCGTGG + Intronic
1009594011 6:65711084-65711106 AAGAGGGAGGTGGGCAAGAGTGG - Intergenic
1010415059 6:75602522-75602544 AAGATGGCGGCCGGCAAGAGCGG + Exonic
1012300392 6:97580522-97580544 ATGAGGGAGGCGGGCAAGCAGGG - Intergenic
1014048781 6:116927124-116927146 GGCAGGGAGGCCCCCAAGTGTGG + Exonic
1014466681 6:121764424-121764446 AGGAGGGAGGAGGGAAAGTGAGG + Intergenic
1017609364 6:156168068-156168090 GGGAGGGAGGAAGGCAAGTGGGG + Intergenic
1018301434 6:162406840-162406862 GGGAGGGAGGCAGGAGAGTGAGG - Intronic
1018799256 6:167210032-167210054 GGGAGGAAGGCAGGCACGTGGGG - Intergenic
1018873396 6:167799855-167799877 AGGAAGGAGGGAGGCAGGTGTGG + Intergenic
1018955986 6:168410907-168410929 AGGTGGGGGGCCGGGAGGTGGGG - Intergenic
1019276845 7:180219-180241 AGGAGGGAGGGAGGCAGGGGAGG + Intergenic
1019404921 7:877951-877973 AGGAGGGAGGCAGGGAGGTGGGG - Intronic
1019495480 7:1337750-1337772 AGGAGGGAGGGAGGGAAGGGAGG - Intergenic
1019773710 7:2899608-2899630 AGGAGGAAGGCCGTCAGGAGGGG - Intergenic
1021971058 7:25966592-25966614 AGGAGGGAAGGAGGCAAGAGAGG + Intergenic
1022114233 7:27248576-27248598 AGGAGGGAGGAGGGCATTTGAGG - Intergenic
1022488354 7:30797767-30797789 TGGAAGGAGGAAGGCAAGTGTGG + Intronic
1023745572 7:43319531-43319553 AGGAAGGAGGCCGGCGGGTGGGG - Intronic
1023830938 7:44038777-44038799 AGGAGGGAGGCCGGCAAGTGGGG - Intergenic
1023967389 7:44970002-44970024 TGGAGGGAGGCCAGGCAGTGGGG - Intronic
1024253290 7:47522017-47522039 AGGAAGAAGGCCAGCAAGGGTGG + Intronic
1024283184 7:47736220-47736242 AGGAGGGAGGGAGGGAAGAGAGG - Intronic
1024528857 7:50373859-50373881 AGGAGATAGGCAGGCAAGTGAGG - Intronic
1024983040 7:55173390-55173412 AGGAGGGAGGCCAGGAAGCCTGG + Intronic
1025231396 7:57205228-57205250 AGGAGGGAGGGGTGAAAGTGGGG - Intergenic
1026775851 7:73230554-73230576 AGGAGGGCTGCCTGGAAGTGGGG + Intergenic
1026871070 7:73852205-73852227 AGGAGGGAAGCAGGGAAGGGAGG - Intergenic
1026877174 7:73886490-73886512 AGGAGGGAGGCGGGCAGGCCTGG + Intergenic
1026954992 7:74371506-74371528 AGGAGGGAGGCGGGGGAGGGAGG + Intronic
1027016709 7:74783926-74783948 AGGAGGGCTGCCTGGAAGTGGGG + Intronic
1027071319 7:75162010-75162032 AGGAGGGCTGCCTGGAAGTGGGG - Intergenic
1027224155 7:76233584-76233606 AGGCGGGAAGCCAGCAGGTGTGG + Intronic
1027234559 7:76290440-76290462 ATGAGGCAGGCTGGCCAGTGAGG - Intergenic
1028123018 7:87078401-87078423 GGGAGGCTGGCCGGCAGGTGGGG + Intergenic
1029677093 7:102077262-102077284 AGGAAGGAGACCAGCAGGTGGGG + Intronic
1029741272 7:102493086-102493108 AGGAGGGAGGCCGGCAAGTGGGG - Intronic
1029759262 7:102592255-102592277 AGGAGGGAGGCCGGCAAGTGGGG - Intronic
1029776631 7:102688165-102688187 AGGAGGGAGGCCGGCAAGTGGGG - Intergenic
1033028627 7:137802722-137802744 AGGAGAGAGGCCGGTAGGAGAGG - Intronic
1033036328 7:137879346-137879368 AGGAGGGGGCCAGGCAGGTGTGG + Exonic
1033209060 7:139446813-139446835 AAGAGGGAGGCAGGCAGGTCAGG - Intergenic
1033279351 7:139994887-139994909 AGGTGGGATGCCCGCAAGGGAGG - Intronic
1033537296 7:142323873-142323895 AGGAGGGTGGCCAGGAAGGGAGG + Intergenic
1034459617 7:151191291-151191313 AGGAGAGAGGGCTGCAGGTGTGG - Intronic
1034465606 7:151226851-151226873 AGGAGGAAGCCCGGAAAGTGAGG - Intronic
1034492514 7:151401391-151401413 AGGAGGGAGGAAGGCAAGAGTGG - Intronic
1034995154 7:155572235-155572257 AGGAGGGAGGAAGGCAAGGGAGG + Intergenic
1035011322 7:155717945-155717967 AGAAGGGAGGAAGGGAAGTGAGG - Intronic
1036282753 8:7415739-7415761 GGCAGGGAGGCGGGCAGGTGGGG - Intronic
1037531487 8:19779103-19779125 AGTACGGAGGACTGCAAGTGTGG - Intergenic
1037776236 8:21837793-21837815 AGGAGGGAGGACCTCAGGTGGGG - Intergenic
1038043448 8:23746304-23746326 AGGAGGGAGGCAGGGAAGGAGGG - Intergenic
1038820937 8:30951263-30951285 AGGAGGGAGGGAGGGAAGGGAGG - Intergenic
1039386249 8:37138193-37138215 AGGGGTGAGGCAGGTAAGTGAGG + Intergenic
1039456825 8:37712710-37712732 AGGTGGGTGGAGGGCAAGTGGGG + Intergenic
1041411856 8:57564920-57564942 AGGAGGAAGCCCGGCAAGGCAGG + Intergenic
1042818524 8:72904829-72904851 AGGAGGGAAGGAGGCAAGTAAGG - Intronic
1046181022 8:110647785-110647807 AGGAGGGAGGCATGGAGGTGTGG + Intergenic
1047484868 8:125320218-125320240 AGGAGGGAGGGAGGGAAGGGAGG + Intronic
1047806004 8:128360466-128360488 AGGAGGTAAGAGGGCAAGTGTGG + Intergenic
1047833850 8:128666284-128666306 AGGAAGGAGGCAGGGAAGTGTGG + Intergenic
1048968024 8:139628153-139628175 AGGAGGGCGGCAGGAGAGTGAGG + Intronic
1049298395 8:141855904-141855926 AGAGGGGAGGGCAGCAAGTGTGG + Intergenic
1049407984 8:142460185-142460207 TGGAGGGTGGCGGGCAGGTGGGG + Intronic
1049435950 8:142586315-142586337 GGCAGGGAGGCTGGCAAGGGAGG + Intergenic
1049792465 8:144478276-144478298 AGGGAGGAGGCCGGGAAGGGCGG + Intronic
1050732412 9:8724464-8724486 TGGAGGGAGGCCAGCCAGAGTGG - Intronic
1051858768 9:21600257-21600279 AGGAGGGAGGGAGGGAAGGGAGG + Intergenic
1052412892 9:28145652-28145674 AGGAGGGAGGAAGAGAAGTGAGG - Intronic
1052914692 9:33915921-33915943 AGGAAGGAGCCAGGCATGTGTGG + Intronic
1052989432 9:34510529-34510551 AAGAGGGAGGGTGGTAAGTGAGG - Intronic
1053016801 9:34666369-34666391 GGGAGGAAGGCAGGCAAGAGAGG - Intergenic
1054452574 9:65411119-65411141 AGGAGGCTGGCAGGCCAGTGTGG + Intergenic
1054831750 9:69632925-69632947 AGGAGAGAGGCAGGAAAGTGAGG + Intronic
1055392187 9:75834766-75834788 AGGAGGGAGACCAGAAAGAGGGG + Intergenic
1056259491 9:84833641-84833663 AGGAGGGAGGCAGGGGAGGGAGG + Intronic
1056491081 9:87107881-87107903 AGGAGGGAACCCGGACAGTGTGG + Intergenic
1057186005 9:93058080-93058102 AGAAGGGAGGCCTCCAGGTGTGG + Intergenic
1057571997 9:96211531-96211553 AAGATGTAGGCAGGCAAGTGGGG - Intergenic
1057951564 9:99373207-99373229 AGGAGGGAGGGAAGCAAGTTTGG - Intergenic
1058860066 9:109107492-109107514 AGGAGGGAGGCAGGCAGGCAGGG - Intronic
1059310958 9:113388959-113388981 AGCAGGTAGGCAGGCAAGGGTGG - Exonic
1061233476 9:129328453-129328475 GGGAGGGAGGAAGGCAGGTGTGG + Intergenic
1061487248 9:130926132-130926154 AGGAGGGAAGACGGTAGGTGGGG + Intronic
1061720891 9:132550749-132550771 GGGATGGAGGCTGACAAGTGGGG - Intronic
1062144087 9:134979181-134979203 AGGAGGGAGGCAGGGAAGTAGGG + Intergenic
1062345098 9:136110910-136110932 GGGAGGGAGGCCTGGAGGTGGGG - Intergenic
1185488963 X:504878-504900 AGGAGGGAGGCAGGCAAGAAAGG - Intergenic
1186204354 X:7185932-7185954 AGGAGGGAGGTCTGCAAGCTTGG - Intergenic
1186223699 X:7375530-7375552 AGGAGGGAGGCCAAGGAGTGGGG - Intergenic
1189078444 X:37942914-37942936 AGAAGGGAGGCCAGCAAGAAGGG - Intronic
1189439164 X:41018918-41018940 GGTGGGGAGGCCGGCAAGTGGGG + Intergenic
1192331043 X:70175482-70175504 AGGAGGGAGGGAGGTAAGAGAGG - Intergenic
1192995172 X:76505675-76505697 AGCTGGGAGGCAGGTAAGTGGGG - Intergenic
1197271122 X:124425856-124425878 AGGAGGGAGGCAGGCATTTAGGG + Intronic
1198369093 X:135973987-135974009 AGGAAGGGCGCCGGCAAATGGGG + Exonic
1199794227 X:151179414-151179436 AGGAAGGAGGCTGGAGAGTGGGG - Intronic
1200289801 X:154860982-154861004 AGGAAGGAGGCCGGGCAGAGTGG - Intronic
1201741052 Y:17325209-17325231 AGGAGGGAGGCAGGAAAGAAAGG + Intergenic