ID: 1029741273

View in Genome Browser
Species Human (GRCh38)
Location 7:102493087-102493109
Sequence AAGGAGGGAGGCCGGCAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 828
Summary {0: 4, 1: 0, 2: 5, 3: 41, 4: 778}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029741273_1029741290 30 Left 1029741273 7:102493087-102493109 CCCACTTGCCGGCCTCCCTCCTT 0: 4
1: 0
2: 5
3: 41
4: 778
Right 1029741290 7:102493140-102493162 GCTGAGGGCCTCGGTAGTGAGGG 0: 4
1: 0
2: 0
3: 7
4: 146
1029741273_1029741287 15 Left 1029741273 7:102493087-102493109 CCCACTTGCCGGCCTCCCTCCTT 0: 4
1: 0
2: 5
3: 41
4: 778
Right 1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG 0: 4
1: 0
2: 0
3: 0
4: 36
1029741273_1029741288 21 Left 1029741273 7:102493087-102493109 CCCACTTGCCGGCCTCCCTCCTT 0: 4
1: 0
2: 5
3: 41
4: 778
Right 1029741288 7:102493131-102493153 CTTCGCGAAGCTGAGGGCCTCGG 0: 4
1: 0
2: 0
3: 5
4: 117
1029741273_1029741280 -6 Left 1029741273 7:102493087-102493109 CCCACTTGCCGGCCTCCCTCCTT 0: 4
1: 0
2: 5
3: 41
4: 778
Right 1029741280 7:102493104-102493126 CTCCTTACCCACCTTGGAGCTGG 0: 4
1: 0
2: 1
3: 14
4: 160
1029741273_1029741289 29 Left 1029741273 7:102493087-102493109 CCCACTTGCCGGCCTCCCTCCTT 0: 4
1: 0
2: 5
3: 41
4: 778
Right 1029741289 7:102493139-102493161 AGCTGAGGGCCTCGGTAGTGAGG 0: 4
1: 0
2: 0
3: 10
4: 119
1029741273_1029741281 -5 Left 1029741273 7:102493087-102493109 CCCACTTGCCGGCCTCCCTCCTT 0: 4
1: 0
2: 5
3: 41
4: 778
Right 1029741281 7:102493105-102493127 TCCTTACCCACCTTGGAGCTGGG 0: 4
1: 0
2: 0
3: 9
4: 161
1029741273_1029741286 14 Left 1029741273 7:102493087-102493109 CCCACTTGCCGGCCTCCCTCCTT 0: 4
1: 0
2: 5
3: 41
4: 778
Right 1029741286 7:102493124-102493146 TGGGCGTCTTCGCGAAGCTGAGG 0: 4
1: 0
2: 0
3: 5
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029741273 Original CRISPR AAGGAGGGAGGCCGGCAAGT GGG (reversed) Intronic
901180791 1:7340541-7340563 AGGGAGGGAGGCAGGCAGGCAGG - Intronic
901519141 1:9769166-9769188 AAGGAGGGAGGGAGGTAAGGAGG + Intronic
902295389 1:15463440-15463462 CAGGAGGGAGGCAGGCCAGCTGG - Exonic
902298281 1:15483318-15483340 CAGGAGGGAGGCAGGCCAGCTGG - Exonic
902391970 1:16112255-16112277 TGGGAGGGAGGCTGGCAAGAGGG - Intergenic
902688922 1:18097423-18097445 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
903027847 1:20442371-20442393 AAGAAGGGAGGCCTGCAGGAAGG - Intergenic
903331743 1:22600155-22600177 AAGGAGGGAGGCAGGAAGGAAGG + Intronic
903331756 1:22600195-22600217 AAGGAGGGAGGGAGGAAGGTGGG + Intronic
903964315 1:27076983-27077005 AAGGAGGAAGGCAGGAAAGAAGG - Intergenic
904727189 1:32558144-32558166 AAGGAGGGAAGTAGGGAAGTAGG + Intronic
906380522 1:45329452-45329474 AAGGAGGGAGGCCTTGTAGTTGG + Intronic
907477317 1:54714415-54714437 AAGAGGTGTGGCCGGCAAGTGGG - Intronic
909156389 1:72083253-72083275 AAGGAGGCAGGCAGGCAGGCAGG - Intronic
909677909 1:78257991-78258013 CAGGAGGGAGCCAGGCAAATAGG + Intergenic
909897716 1:81094010-81094032 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
910408433 1:86914696-86914718 AGAGAGGGAGGCGGGCAAGCAGG + Exonic
910461104 1:87448790-87448812 ATGGAGGGAGGCTGCCAAGAAGG + Intergenic
910846799 1:91611930-91611952 AAGGAGGGAGGAGGGCAACTGGG + Intergenic
911068737 1:93814973-93814995 AAGAAGGCAGGCAGGCAAGGAGG - Intronic
911781590 1:101886395-101886417 AAGGGAGGAGGCCGGCTGGTAGG + Intronic
912308479 1:108595431-108595453 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
912430853 1:109627656-109627678 AAGGATGGAGGCTGCCAAGAGGG - Intronic
912703259 1:111894211-111894233 AAGGAGGGAGGCCGTGAGGCTGG - Intronic
913670737 1:121095316-121095338 GAGGAGGGAGGCAGGGAAGCAGG - Intronic
914022500 1:143882739-143882761 GAGGAGGGAGGCAGGGAAGCAGG - Intergenic
914318342 1:146535126-146535148 ATGGAGGGAGGCGGCCAAGAAGG + Intergenic
914496019 1:148198231-148198253 ATGGAGGGAGGCGGCCAAGAAGG - Intergenic
914660986 1:149790681-149790703 GAGGAGGGAGGCAGGGAAGCAGG - Intronic
914830881 1:151169967-151169989 AAGGAAGGAGGCAGGCAAAATGG + Exonic
915286430 1:154856244-154856266 AGGGAGGGAGGCTGGCCAGAAGG + Intronic
915722115 1:157993306-157993328 AGGGAGGGAGGCAGGCAGGCAGG + Intronic
915911785 1:159919989-159920011 GAGGAAGGAGGCTGGCAAGAAGG - Intronic
915915673 1:159939143-159939165 AGGCAGGGAGACTGGCAAGTAGG - Intronic
917739725 1:177950930-177950952 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
918018192 1:180659119-180659141 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
918405250 1:184205876-184205898 AGGCAGGGAGGCCAGCAAGGAGG + Intergenic
918469975 1:184861761-184861783 AAGGAGGGAGGGAGGAAAGAAGG + Intronic
918665566 1:187146704-187146726 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
918895360 1:190336819-190336841 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
919123989 1:193374798-193374820 AAGGAGGGAGGGAGGAAAGGAGG - Intergenic
919509748 1:198447583-198447605 AAGGAGGGAGGGAGGAAGGTAGG - Intergenic
920154542 1:203937669-203937691 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
920748038 1:208647326-208647348 AAGGAGGGAGGGAGGGAAGGGGG - Intergenic
920912544 1:210232543-210232565 GAGGAGGGAGGGCGGGAAGCAGG + Intergenic
921553625 1:216569254-216569276 AAGGAGGGAGGAAGGAAAGAAGG + Intronic
922265588 1:223980773-223980795 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
922265595 1:223980789-223980811 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
923109449 1:230879572-230879594 AGAGGGGGAGGCCGGCAAGGGGG - Intergenic
923129668 1:231064613-231064635 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
923688786 1:236173420-236173442 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
924005138 1:239600732-239600754 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
924035644 1:239933813-239933835 AGGGAGGGAGGCAGGCAGGAAGG + Intergenic
924091605 1:240507312-240507334 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
924730675 1:246708828-246708850 AAGGAGGGAAGCAGGGAAGGAGG - Intergenic
1062822966 10:548457-548479 AGGGAGGGAGGCAGGCAGGCAGG + Intronic
1062822982 10:548512-548534 AGGGAGGGAGGCAGGCAGGCAGG + Intronic
1062989612 10:1803595-1803617 AAGGAGGGTGGCAGGCACATGGG + Intergenic
1063156291 10:3382179-3382201 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1063156298 10:3382195-3382217 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1063235998 10:4117299-4117321 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1063366413 10:5493602-5493624 CAGGAGGGAGGTCGTCAAGCAGG - Intergenic
1063576299 10:7265147-7265169 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1063620362 10:7641663-7641685 AGGGAGGGAGGCAGGGAAGGAGG + Intronic
1064009252 10:11722352-11722374 AAGGAGTGAGGCAGGAAAGAAGG - Intergenic
1064812920 10:19222108-19222130 AGGGAAGGAGGCTGGCAAGAAGG - Intronic
1064949225 10:20828695-20828717 AGGGAGGGAGGCAGGAAAGGAGG + Intronic
1065077644 10:22097583-22097605 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1065198160 10:23286627-23286649 AAGGAGGGAGGGAGGAAAGGAGG + Intronic
1065210108 10:23394803-23394825 AAGGAAGGAGGAAGGGAAGTAGG + Intergenic
1065292341 10:24243409-24243431 AAGGAGGGAGGGTGGGAAGGGGG - Intronic
1065784852 10:29203660-29203682 AAGGAGGGAGGAAGGAAAGGAGG + Intergenic
1066066079 10:31761810-31761832 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1066136020 10:32446893-32446915 AGGGAGGGAGGCAGGCAGGCAGG - Intronic
1066244341 10:33567972-33567994 AAGGGCTGAGGCCGGCAAGGTGG + Intergenic
1066533720 10:36367491-36367513 AAGGAGGGAGGAAGGGAAGGAGG + Intergenic
1067292892 10:44957466-44957488 AAGGAGGGAGGGAGGAAAGAGGG - Intergenic
1069590882 10:69641149-69641171 AAGGAGGGAGGCAGGGAGGGAGG + Intergenic
1069668717 10:70183477-70183499 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1070509463 10:77147414-77147436 AAGGAGGGAGGGAGGCTGGTGGG - Intronic
1070577356 10:77689282-77689304 AAGGAGGGAGGGAGGGAGGTGGG - Intergenic
1071444827 10:85736008-85736030 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1071735120 10:88290088-88290110 AAAGAGGTAGGCAGACAAGTAGG + Intronic
1073464886 10:103688842-103688864 AAGGAGGGAGGGAGGGAAGAAGG - Intronic
1073809204 10:107134290-107134312 AAGAAGGGAGGCTGGTCAGTAGG - Intronic
1074827994 10:117228483-117228505 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
1075153150 10:119953431-119953453 AAGGAGGGAGGGAGGAAAGGAGG - Intergenic
1075619223 10:123913658-123913680 AAGTAGAGAGGAGGGCAAGTGGG + Intronic
1075656244 10:124163013-124163035 AAGGAGGGAGGAAGGCAGGCAGG + Intergenic
1076077350 10:127545050-127545072 AAGGAGGGAGGGGAGCAAGAGGG - Intergenic
1076474523 10:130743091-130743113 GAGGAAGGAGGCGGGCAGGTGGG - Intergenic
1076815046 10:132910408-132910430 AAGGACGGAGCCCCGAAAGTGGG + Intronic
1077023459 11:429882-429904 AGGGAGGGAGGCAGGAAAGCCGG + Intronic
1077250609 11:1559059-1559081 TAGGAGGAGGGCCGTCAAGTGGG + Intronic
1077272217 11:1686720-1686742 GAGGAGGGAGGCAGGGAAGGAGG - Intergenic
1077376145 11:2205804-2205826 AGGCAGGGAGGCTGGGAAGTAGG - Intergenic
1077376203 11:2205987-2206009 AGGCAGGGAGGCTGGGAAGTAGG - Intergenic
1077376225 11:2206051-2206073 AGGTAGGGAGGCTGGGAAGTAGG - Intergenic
1078125489 11:8557335-8557357 AAGGAGGGAGGGAGGAAAGAAGG + Intronic
1078488577 11:11747726-11747748 AAGGAGGGAGGCAGGGAGGAAGG + Intergenic
1079141586 11:17814059-17814081 AAGGAGGGAGGAAGGGAAGTTGG + Intronic
1079761600 11:24336021-24336043 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1080458579 11:32435442-32435464 TGGGAGGGAGGGCGGGAAGTGGG + Exonic
1080828390 11:35867456-35867478 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1081405988 11:42698320-42698342 AAGGAAGGAGGCAGGCAGGCAGG + Intergenic
1081405989 11:42698324-42698346 AAGGAGGCAGGCAGGCAGGTAGG + Intergenic
1081525385 11:43924502-43924524 AAGGACGGGGGCAGGCGAGTGGG + Intergenic
1081585247 11:44379773-44379795 GGGGAGGGAGGCTGGCAGGTGGG + Intergenic
1082735890 11:56855075-56855097 AAGGAGGGAGGGAGGAAAGAAGG + Intergenic
1082867184 11:57910865-57910887 AAGGGGGGAGGCTGGCAAGATGG - Intergenic
1083301664 11:61742787-61742809 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1083577288 11:63801234-63801256 AAGGAGGGAGGGAGGGAGGTTGG + Intergenic
1083633696 11:64108928-64108950 AAGGACAGAGGCAGGCAGGTGGG + Intronic
1083925745 11:65804920-65804942 AGGGAGGGAGGCAGGCAGGCAGG + Intergenic
1084021524 11:66420830-66420852 AGGGAGGGAGGCGGGCGAGGGGG - Intergenic
1084196319 11:67525090-67525112 AGGGAGGGAGGCAGGGAGGTGGG - Intergenic
1085186293 11:74578743-74578765 AAGGAGGGAGGGAGGCAGGGAGG + Intronic
1085329698 11:75637814-75637836 AGGGAGGGAGGGAGGGAAGTAGG + Intronic
1086307159 11:85493781-85493803 AAGGAGGGAGGAAGGAAAGGAGG + Intronic
1086393269 11:86388169-86388191 AAGGAGGGAGGGAGGGAGGTTGG - Intronic
1087400480 11:97659337-97659359 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1088579270 11:111299767-111299789 AAGGAGGGAGGAGGGCAAGATGG + Intronic
1089814634 11:121161510-121161532 AAGGAGGGAGGGAGGCAGGCCGG - Intronic
1090274504 11:125410086-125410108 AAGGAGGGAGGGGGGCAGGCAGG + Intronic
1090313427 11:125763873-125763895 AAGGCAGGAGGCTGGCAAGCTGG - Intergenic
1090425008 11:126601673-126601695 ATGGAGGAGGGGCGGCAAGTGGG - Intronic
1090531028 11:127591808-127591830 AAGAAGGAAGGGCGGCAAGGCGG + Intergenic
1091007396 11:131965920-131965942 AAGGAGGGAGGGAGGGAAGGGGG + Intronic
1091335129 11:134760957-134760979 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1091416856 12:295384-295406 AAGGAGGGAGGGAGGCAGGGAGG + Intronic
1091618966 12:2071197-2071219 AAGGAGGAAGGCAGGCAGGCAGG - Intronic
1091832082 12:3557108-3557130 AAGGAGGGAGGGCAGCAGATAGG + Intronic
1091857636 12:3752487-3752509 AAGGAAGGAGGTCAGGAAGTGGG - Intronic
1091918143 12:4283722-4283744 CAGGAGGGAGGCGGGAATGTCGG + Intronic
1092092275 12:5812719-5812741 AGGGAGGGAGGGAGGCAAGAGGG + Intronic
1092255710 12:6925930-6925952 AGGGAGGCAGGCTGGCAAGCCGG - Intronic
1092885772 12:12923350-12923372 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1093141620 12:15516538-15516560 AAGGAGGGAGGGAGGGAAGAAGG + Intronic
1093173236 12:15882462-15882484 AGGGAGGGAGGGAGGAAAGTAGG - Exonic
1093336159 12:17906562-17906584 AAGGAGGGTGGATGGCAAGATGG - Intergenic
1093643390 12:21554237-21554259 AAGGAGAGAGGCAGGGAAGGAGG + Intronic
1094023874 12:25942192-25942214 AAAGAAGGAGACAGGCAAGTAGG + Intergenic
1094272255 12:28629899-28629921 AAGCAGGGAGGCAGGCAGGCCGG + Intergenic
1094483306 12:30902399-30902421 AGGGAGGGAGGAAGGCAAGCAGG + Intergenic
1095288692 12:40448745-40448767 AAGGAGGGAGGGAGGAAAGAAGG - Intronic
1095506614 12:42905479-42905501 AGGGTGGGAGGCGGGCAACTGGG + Intergenic
1096086259 12:48867053-48867075 AATGAGGGACTCTGGCAAGTGGG + Intergenic
1096417891 12:51429402-51429424 AATGAGGGAGGCCAGCTAGGAGG + Intronic
1096726611 12:53568839-53568861 AAGAAGGCAGGCAGGCAGGTAGG + Intronic
1096781504 12:53994812-53994834 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1096890476 12:54765767-54765789 AAAGAGAGAGGCAGACAAGTAGG - Intergenic
1097965260 12:65572501-65572523 AAAGAGGGAGGGCGGCAAGAAGG - Intergenic
1100265139 12:92968605-92968627 AAGGAGGGAGGGAGGCAGGAAGG + Intergenic
1101212741 12:102551012-102551034 AAGGAAGGAGGGAGGGAAGTGGG - Intergenic
1101348191 12:103905355-103905377 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1101348198 12:103905371-103905393 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1101348205 12:103905387-103905409 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1101348232 12:103905469-103905491 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1101348239 12:103905485-103905507 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1101348246 12:103905501-103905523 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1101348253 12:103905517-103905539 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1101675031 12:106909575-106909597 ATGGAGGGAGCCAGGGAAGTGGG + Intergenic
1102168462 12:110824430-110824452 AAGGAGGGAGGGAGGAAAGAAGG + Intergenic
1102229915 12:111255487-111255509 GAGGAGCCAGGCCGGCAGGTAGG - Intronic
1102451507 12:113045091-113045113 AAGGAGGGAGGAAGGAAAGAAGG + Intergenic
1102932431 12:116872860-116872882 AGGGAGGGAGGCAGGCAGGGAGG + Intronic
1102953335 12:117044499-117044521 AAGGAAGGAGGGCGGGGAGTTGG + Intronic
1103021982 12:117541330-117541352 AGGGAGGGAGGCAGGCAGGGAGG + Intronic
1103104384 12:118210184-118210206 AAAGAGGGAGGAAGGCAAGCAGG - Intronic
1103223416 12:119266104-119266126 AAGAAGGGAGGGAGGAAAGTAGG - Intergenic
1103917818 12:124385033-124385055 AAGGAGGGAGGAAGGGAAGGAGG + Intronic
1103985991 12:124767790-124767812 GAGGAGGGAGGCAGGAAGGTGGG - Intergenic
1104134361 12:125923332-125923354 AAGGAGGGAGGACGGGAAGAAGG + Intergenic
1104505793 12:129330999-129331021 AATGAGGGCAGCGGGCAAGTCGG - Intronic
1104559183 12:129828721-129828743 AAGGAGGGAGGGAGGAAAGGAGG + Intronic
1104580634 12:130008537-130008559 AGGGAGGGGGGCAGGCAAGCCGG + Intergenic
1104667690 12:130658992-130659014 AGGGAGGGAGGCTGGCATGGTGG - Intronic
1104914069 12:132255680-132255702 AAGGCGGGAGGACCGGAAGTGGG - Intronic
1104929464 12:132330034-132330056 AGGGAGGGAGGCCGGGAGCTCGG - Intergenic
1106364659 13:29066970-29066992 AAGGAGGGAGGCTGTCAATTTGG + Intronic
1106849592 13:33775287-33775309 AAGGAGGGGGGCAGGCAATGAGG - Intergenic
1106992774 13:35442031-35442053 AAGGAGGGAGGCAGGGAGGGAGG - Intronic
1108854632 13:54777261-54777283 AAGGAGGAAGGCAGGAAAGAAGG + Intergenic
1110229474 13:73153368-73153390 AAGGAGGGAGGGAGGGAAGTAGG - Intergenic
1110248461 13:73354525-73354547 AAGGAGGGAGGGAGGAAAGGAGG - Intergenic
1110325753 13:74213575-74213597 AAGGAGGGAGGGAGGAAAGGAGG - Intergenic
1111363632 13:87210839-87210861 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1111446176 13:88348046-88348068 AAGGAGGGAGGCAGGGAGGGAGG + Intergenic
1112109996 13:96285922-96285944 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1112569104 13:100577839-100577861 AAGGAGGGAGGGCAGCAGGGAGG + Intronic
1113680658 13:112242098-112242120 AAGGAGGGAGGGAGGAAAGGAGG + Intergenic
1115012597 14:28567601-28567623 AAGGAAGGAGGGAAGCAAGTTGG - Intergenic
1115033050 14:28821224-28821246 AAGGAGGGAGGGCGGAAAGAAGG - Intergenic
1115054669 14:29108822-29108844 AAAGAGGGAGGGAGGGAAGTAGG + Intergenic
1115356590 14:32454728-32454750 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1115356609 14:32454772-32454794 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1115508033 14:34111351-34111373 AAGGAGGGAGGGAGGAAAGGAGG + Intronic
1115962820 14:38854718-38854740 AAGGATGGTGGCAGGCAAGGAGG - Intergenic
1116808837 14:49519976-49519998 AAGGAGGGAGGCAGGAAAGGAGG + Intergenic
1117359537 14:54959434-54959456 AGGGAGGGAGGCAGGCAGGCAGG + Intronic
1117796415 14:59398788-59398810 AAGCAGAGAGGCCGGTAAGGAGG - Intergenic
1118249659 14:64147287-64147309 GAGGGAGGAGGCTGGCAAGTGGG - Intronic
1118854125 14:69608148-69608170 AGGGAGGGAGGCAGGGAAGGTGG + Intergenic
1119725631 14:76920390-76920412 AAGGATGGAGGCCGGAACCTGGG - Intergenic
1119996029 14:79254789-79254811 AGGGAGGGAGGCAGGCAGGGAGG - Intronic
1120360185 14:83490609-83490631 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1121612845 14:95293253-95293275 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1121612864 14:95293305-95293327 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1121624597 14:95374923-95374945 AAGGAGGGAGGGAGGAAAGAAGG - Intergenic
1121624628 14:95375026-95375048 AAGGAGGGAGGGAGGAAAGAAGG - Intergenic
1121624658 14:95375129-95375151 AAGGAGGGAGGGAGGAAAGAAGG - Intergenic
1121624670 14:95375178-95375200 AAGGAGGGAGGGAGGAAAGAAGG - Intergenic
1121935424 14:98014057-98014079 AAGGAGGGAGGGAGGCAAGGAGG - Intergenic
1121935430 14:98014073-98014095 AGGGAGGGAGGCAGGCAAGGAGG - Intergenic
1122155983 14:99750726-99750748 AAGGAGGGAGGAAGGCAGGATGG + Intronic
1122627341 14:103091258-103091280 GTGCAGGGAGGCCGGCACGTGGG + Intergenic
1122837632 14:104437842-104437864 AGGGAGGGAGGCAGGGAAGGAGG + Intergenic
1124652734 15:31485195-31485217 AAGGATGGAGGCCTTCAGGTGGG + Intronic
1127660745 15:61098096-61098118 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1127660770 15:61098169-61098191 AGGGAGGGAGGCAGGGAAGGGGG - Intronic
1128136016 15:65264057-65264079 AATGAGGGAGGCCGACATGCGGG + Intronic
1128968832 15:72087740-72087762 AAGGAGGAAGGTGGGCAAGATGG - Intronic
1129116634 15:73368519-73368541 AGGGAGGGAGGGAGGCAAGAAGG - Exonic
1129300202 15:74621053-74621075 CAGGAGGGAGGCAGGGAAGAGGG - Intronic
1130000481 15:80042228-80042250 AAAGAGGGAGGGAGGGAAGTAGG - Intergenic
1130068515 15:80627039-80627061 AAGCAGGCAGGCAGGCAAGCAGG - Intergenic
1130147047 15:81282399-81282421 AAGGAGGGAGGAAGGGAAGGAGG - Intronic
1130720311 15:86380232-86380254 AGGGAGGGAGGCAGGCAGGCAGG - Intronic
1130987535 15:88854593-88854615 AAGGAGGGAGGTAGGGAACTGGG - Intronic
1131096661 15:89659510-89659532 AAGGAGGGAGGCAGGGAGGGAGG + Intergenic
1131288255 15:91081163-91081185 AAGGAGGGAGGGAGGCAGGGAGG - Intergenic
1131346720 15:91656382-91656404 AGGGAGGGAGGCAGGGAAGCGGG - Intergenic
1131460052 15:92611307-92611329 AAGGAGGGAGGGAGGCAGGGAGG + Intergenic
1131593789 15:93775924-93775946 GAGGAGGGAGACCTGCAAGAGGG + Intergenic
1131857194 15:96609926-96609948 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1131901055 15:97088464-97088486 CAAGAGGGAGGCAGGCAAGCAGG - Intergenic
1132629891 16:912071-912093 CAGGAGGGAGCCCGGCCTGTGGG - Intronic
1132978430 16:2721602-2721624 AAGGAGGGAGGGCGAGGAGTGGG + Intergenic
1133559895 16:6941283-6941305 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1133601153 16:7341759-7341781 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1133605156 16:7379797-7379819 AGGGAGGGAGGCAGGCAGGCAGG - Intronic
1133647148 16:7775132-7775154 AAGGAGGGAGGGAAGGAAGTAGG + Intergenic
1133748151 16:8702909-8702931 AATGATGGAGGCAGGAAAGTGGG + Intronic
1134310359 16:13070610-13070632 AAGGCAGGAGGCCGGGAAGTGGG + Intronic
1134411067 16:14003629-14003651 AGGGAGGGAGGCAGGCAGGCAGG - Intergenic
1134656186 16:15949832-15949854 ACGGAGGGAGGCCGGCGGGGAGG + Intronic
1134991255 16:18701566-18701588 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1135335568 16:21598993-21599015 GAGGAGGGAGTCTGGCAGGTCGG + Intronic
1136026160 16:27470313-27470335 AATGCGGGCTGCCGGCAAGTTGG - Exonic
1136333473 16:29596343-29596365 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1136474396 16:30503552-30503574 AGGGAGGGAGGCAGGCAAGGAGG + Intronic
1137417056 16:48292510-48292532 AAAGAGGAAGGCAGGCAAATTGG + Intronic
1137509587 16:49087254-49087276 AAGGAGGCAAGGGGGCAAGTAGG + Intergenic
1137849286 16:51722614-51722636 AAGGAGGGAGGGAGGAAAGGAGG + Intergenic
1137863709 16:51871878-51871900 AAGGAGGGAGGGAGGCAGGCAGG + Intergenic
1137863711 16:51871882-51871904 AGGGAGGGAGGCAGGCAGGGAGG + Intergenic
1138288894 16:55830832-55830854 AGGCAGGCAGGCAGGCAAGTGGG + Intronic
1138498449 16:57423216-57423238 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1138501671 16:57449095-57449117 GAGGAGGGAGGAAGGCAGGTGGG + Intronic
1138900691 16:61265503-61265525 AAGGAGGGAGGCGGGGAAGAAGG - Intergenic
1139253530 16:65519558-65519580 AAGGAGGGAGGAAGGAAAGAAGG - Intergenic
1139398244 16:66658258-66658280 AAGGAGGGAGGCAGGCAGGGAGG + Intronic
1140257524 16:73349796-73349818 AAGGAGGGAGGGAGGGAAGAGGG - Intergenic
1140286704 16:73609658-73609680 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1140604773 16:76522558-76522580 AAGGAGGGCGGCAGGCAGGCAGG - Intronic
1141427099 16:83951765-83951787 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1141427109 16:83951789-83951811 AAGGAGGGAGGAAGGCAGGAAGG - Intronic
1141427158 16:83951939-83951961 AAGGAGGGAGGAAGGCAGGGAGG - Intronic
1141427199 16:83952047-83952069 AAGGAGGGAGGAAGGCAGGGAGG - Intronic
1141715573 16:85724994-85725016 AAGGAGGGAGGCCAGCAGGTGGG - Intronic
1141732844 16:85834157-85834179 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1141884171 16:86880425-86880447 AAGAAGGGAGGCCGGCTGGTGGG - Intergenic
1142193840 16:88730341-88730363 CAGGAGGGAGGCCTGTAATTTGG + Intronic
1142301066 16:89258000-89258022 CACGAGGGAGGCGGGCACGTTGG - Intergenic
1142488649 17:263159-263181 AAGGAGGGAGGTGGGCATGGGGG + Intronic
1142836873 17:2593895-2593917 AAGGAGGGAGGGAGGGAAGGAGG - Exonic
1142884850 17:2906090-2906112 AAGGAGGGAGGCAGGGAGGGAGG - Intronic
1143387796 17:6542377-6542399 TAGGAAGGGGGCTGGCAAGTGGG - Intronic
1143410823 17:6707370-6707392 AAGGAGGGAGGCAGGGAGGAGGG - Intronic
1144380179 17:14687190-14687212 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1144833308 17:18143650-18143672 AAGGAGGGAGGCTGGCAGGTGGG + Intronic
1145880172 17:28347449-28347471 GAGGAGGGAGGCAAGCCAGTCGG - Exonic
1145888579 17:28399160-28399182 AAGGAGGGAGGGAGGTAAGAGGG - Exonic
1146176532 17:30668986-30669008 AAGCAGGAAGGCTGGGAAGTGGG - Intergenic
1146349994 17:32085100-32085122 AAGCAGGAAGGCTGGGAAGTGGG - Intergenic
1148014269 17:44510013-44510035 AGGGAGGGAGGCAGGCAGGTAGG + Intergenic
1148027791 17:44600385-44600407 AAGGAGGGAGGTGGGCAGGGTGG - Intergenic
1148084792 17:44987575-44987597 AGGGAGAGAGGCCGGCAGGATGG - Intergenic
1148855983 17:50579574-50579596 AAGGAGAGAGGCTAGCAAGCAGG + Intronic
1148872354 17:50666130-50666152 AAGGAGTTAGGCAGGCAAGAGGG - Intronic
1149066734 17:52489410-52489432 GAGAAGGGAGGCGGGCAGGTGGG + Intergenic
1150216735 17:63475596-63475618 CAGGAGGGAGGCTGGCAAAGCGG + Intergenic
1150293246 17:63993477-63993499 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1150859430 17:68786268-68786290 AAGGAGGGAGGAAGGAAGGTGGG - Intergenic
1150859447 17:68786326-68786348 AAGGAGGGAGGGAGGGAAGAGGG - Intergenic
1151144764 17:72030589-72030611 AAGGAGGGAAGCAGGCAGGAGGG + Intergenic
1151169756 17:72236622-72236644 AGGGAGGGAGGCAGGCAGGGAGG + Intergenic
1151169764 17:72236642-72236664 AGGGAGGGAGGCAGGCAGGGAGG + Intergenic
1151169776 17:72236670-72236692 AGGGAGGGAGGCAGGCAGGGAGG + Intergenic
1151169784 17:72236690-72236712 AGGGAGGGAGGCAGGCAGGGAGG + Intergenic
1151169796 17:72236718-72236740 AGGGAGGGAGGCAGGCAGGGAGG + Intergenic
1151169806 17:72236742-72236764 AGGGAGGGAGGCAGGCAGGGAGG + Intergenic
1151169818 17:72236770-72236792 AGGGAGGGAGGCAGGCAGGGAGG + Intergenic
1151169832 17:72236802-72236824 AGGGAGGGAGGCAGGCAGGGAGG + Intergenic
1151169842 17:72236826-72236848 AGGGAGGGAGGCAGGCAGGGAGG + Intergenic
1152013346 17:77734493-77734515 AAGGAGGGAGGAAGGCAGGCGGG - Intergenic
1152013706 17:77735943-77735965 ATGGAGGGAGGCGGGGAGGTCGG + Intergenic
1152021518 17:77782230-77782252 CAGGAGGGAGGTCAGCAAGCGGG - Intergenic
1152044939 17:77929609-77929631 AAGGAGGGAGACTGGCACTTGGG - Intergenic
1152388906 17:79991623-79991645 AAGGAGGCAGGGAGGCAAGAGGG + Intronic
1152539554 17:80968043-80968065 GAGGAGGGAGGCAGGCGAGCCGG - Intergenic
1153814786 18:8783037-8783059 AAAGAGGGAGGTCTGCACGTTGG + Intronic
1155078074 18:22380527-22380549 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1155630544 18:27887544-27887566 AGGGAGGGAGGCAGGGAAGGAGG - Intergenic
1155878665 18:31117507-31117529 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
1156017347 18:32561176-32561198 AGGGAGGGAGGCAGGGAAGGAGG - Intergenic
1156071940 18:33222252-33222274 AAGGAAGGAGGCAGGAAAGGAGG - Intronic
1156864435 18:41873205-41873227 GAGGAGGGAGGCCTTTAAGTGGG - Intergenic
1157850270 18:51042280-51042302 AAGGAGGGAGGGAGGCAGGCAGG - Intronic
1158103762 18:53861326-53861348 AAGGAGGGAGGGAGGAAAGAAGG + Intergenic
1158103769 18:53861345-53861367 AAGGAGGGAGGGAGGAAAGGAGG + Intergenic
1158103838 18:53861523-53861545 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1158240041 18:55367334-55367356 AAGGAGGGAGGATGGCAGATAGG - Intronic
1158976382 18:62715318-62715340 AAGGCGGGAGGCTGGCAGGGCGG - Intergenic
1159134300 18:64318973-64318995 AGGGAGGGAGGCAGGCAGGCAGG - Intergenic
1159776846 18:72612492-72612514 AAGGAGGGAGGGAGGTAAGGGGG - Intronic
1160668674 19:345362-345384 AAGGCGGGAGGCAGGGAGGTGGG + Intergenic
1161095998 19:2391046-2391068 AGGGAGGGAGGCAGGCAGGCAGG + Intronic
1161095999 19:2391050-2391072 AGGGAGGCAGGCAGGCAGGTAGG + Intronic
1161191471 19:2959434-2959456 AGGGAGGGAGGCAGGCAGGCAGG + Intergenic
1161377847 19:3949411-3949433 AAGGAGGGAGGCCCCCAGGCAGG - Intergenic
1161638081 19:5401835-5401857 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1162451605 19:10758422-10758444 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1162569269 19:11461530-11461552 AAGGAGGGAGGGAGGAAAGAGGG - Intronic
1162826516 19:13255732-13255754 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1162982291 19:14247903-14247925 AAGCAGGAAGGCTGGGAAGTGGG + Intergenic
1163207212 19:15812491-15812513 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1163207233 19:15812580-15812602 AAGGAGGGAGGGAGGCAGGAAGG + Intergenic
1163763583 19:19150153-19150175 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1164588696 19:29494528-29494550 AAGGAGGGAGGCAGGGAAGAAGG + Intergenic
1164654588 19:29910869-29910891 AAGGAGGGAGGGAGGAAAGAAGG - Intergenic
1164741123 19:30576228-30576250 AAGGTAGGAGGCCGGGAAGGAGG + Intronic
1164966194 19:32486904-32486926 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1164975623 19:32570937-32570959 AAGGAGGGAGGCAGGGATGGAGG - Intergenic
1165031063 19:32998675-32998697 AAGGAGGGAGGACGGGTAGATGG + Intronic
1165331394 19:35142803-35142825 AAGGAGGGAGGAAGGAAAGGCGG + Intronic
1165790534 19:38489005-38489027 AAGGAGGGTGGATGGCAAGGCGG + Intronic
1165855605 19:38878008-38878030 AAGGAGGGAGGTGGGCAGGGAGG + Intronic
1166062434 19:40334999-40335021 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1166626919 19:44366367-44366389 AAGGAGGGAGGGTGGGAAGGAGG - Intronic
1166954669 19:46455336-46455358 AAGGAGGGAGGCGGGGAGGAAGG - Intergenic
1167056065 19:47112343-47112365 AAGGGGGGCGGCCGCCATGTTGG - Intronic
1167422382 19:49411897-49411919 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1167741823 19:51328628-51328650 ATGGAGGGAGGCCTGAGAGTGGG - Intronic
1168109079 19:54181732-54181754 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1168109099 19:54181784-54181806 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1168109119 19:54181836-54181858 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1168109130 19:54181864-54181886 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1168109141 19:54181892-54181914 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1168109179 19:54181988-54182010 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1168124781 19:54277388-54277410 AAGGAGAGAGGCCTGCAGGTGGG - Intronic
1168132813 19:54332014-54332036 AAGGAGAGAGGCCTGCGGGTGGG - Intergenic
1168181508 19:54665320-54665342 AAGGAGAGAGGCCTGCGGGTGGG + Intronic
1168266400 19:55226096-55226118 GAGGAGGGAGGGCGGCAAGGGGG - Intergenic
1168434045 19:56303519-56303541 AGGGAGGGAGGGAGGCAAGACGG + Intronic
1168573690 19:57490911-57490933 AAGGAGGGAGGCCTTCAAAGTGG + Intronic
925017600 2:543673-543695 AGGGTGGGAGGCAGGCAGGTTGG + Intergenic
925281339 2:2687446-2687468 GAGGAGGGAGGCGGGCCTGTGGG - Intergenic
925310841 2:2880541-2880563 GTGGAGGGAGCCCAGCAAGTGGG - Intergenic
925390458 2:3490559-3490581 AAGGATGGAGGCAGACAGGTGGG - Intergenic
925407953 2:3619157-3619179 AGGGAGGGAGGCGGGAAAGAAGG - Intronic
926175871 2:10591640-10591662 AAGGAGGGAGACAGGGAAGGAGG + Intronic
926688797 2:15718547-15718569 ATGAAGGGAGGCCAGCAGGTGGG - Intronic
926947699 2:18206163-18206185 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
927257642 2:21054158-21054180 AAGGAGGGAGGCGGAAAGGTGGG + Intergenic
927431710 2:23031818-23031840 AAGGAGGGAGGAAGGGAAGGAGG - Intergenic
927464292 2:23325441-23325463 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
927503946 2:23601236-23601258 ATTGAGGGGGCCCGGCAAGTCGG + Intronic
927552321 2:24010667-24010689 AAGAAGGGAGGAGGGCAGGTGGG + Intronic
927835871 2:26398474-26398496 AGAGAGTGAGGCAGGCAAGTAGG - Intergenic
927985794 2:27409548-27409570 AAGGCGCGAGGCCGGCCAGGAGG + Exonic
928602335 2:32915877-32915899 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
929305468 2:40356197-40356219 AAGGAGGGAGGCAGGCATGTAGG - Intronic
929635973 2:43521166-43521188 AAGGAGGGAGGGAGGGAAGAAGG + Intronic
930424960 2:51201618-51201640 AAGGAGGGAGGAAGGGAAGGAGG - Intergenic
931409845 2:62019018-62019040 AGGGAGGGAGGGAGGGAAGTTGG - Intronic
931421104 2:62128596-62128618 AAGGAGGGAGGGAGGGAGGTAGG - Intronic
931799746 2:65747299-65747321 ACGCAGGGAGGCCTGAAAGTGGG + Intergenic
932155801 2:69416032-69416054 AAGGAGGAAGGAAGGCAAGCAGG + Intronic
932221170 2:70000029-70000051 AAGCAGGGAGGCCAGCAGGGAGG - Intergenic
934576691 2:95406183-95406205 AAGGAGAGAGGACTGCAAGGAGG + Intronic
934638913 2:96014351-96014373 AAGGAGAGAGGACTGCAAGGAGG + Intergenic
934794738 2:97091060-97091082 AAGGAGAGAGGACTGCAAGGAGG - Intronic
935022771 2:99247584-99247606 AAGGAGGGAGGGAGGAAGGTAGG - Intronic
935063102 2:99624857-99624879 AAGGCGGGAGGGCAGCAAGTGGG + Intronic
936236471 2:110746782-110746804 AAAGGGGGAGGCCGACAAGCAGG - Intronic
936241349 2:110790988-110791010 AAGGAGGCAGACAGGGAAGTGGG - Intronic
936416702 2:112322100-112322122 AAGGAGGGAAGACGGGAAGGAGG - Intronic
936768865 2:115887559-115887581 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
937089363 2:119195815-119195837 AAGGAGGGAGGGAGGAAAGAAGG + Intergenic
937289540 2:120773886-120773908 AAGGAGGGAGGCAGGGAGGGAGG - Intronic
937372431 2:121309325-121309347 AAGGAGGGAGGGAGGCAAAGAGG + Intergenic
937464095 2:122114755-122114777 AAGGAGGGAGGGAGGCAGGAAGG - Intergenic
937574838 2:123407248-123407270 AAAGTGGGAGTCCTGCAAGTAGG - Intergenic
937615851 2:123921413-123921435 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
937683881 2:124674352-124674374 AAGGAGGGAGGGAGGGAAGAAGG - Intronic
937737277 2:125307234-125307256 AGGGAGGGAGGGAGGGAAGTGGG + Intergenic
937778124 2:125805383-125805405 AGGGAGGGAGGGAGGGAAGTAGG + Intergenic
937977862 2:127592735-127592757 AAGGGGGGTGGCTGGAAAGTGGG + Intronic
938459810 2:131490205-131490227 CAGGAGTGAGGCGGGCAAGGGGG + Intronic
938546587 2:132338173-132338195 AAGGAGGGAGGGTGGGAAGGAGG + Intergenic
938665053 2:133526246-133526268 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
938665060 2:133526262-133526284 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
938665067 2:133526278-133526300 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
938665074 2:133526294-133526316 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
938665081 2:133526310-133526332 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
939144012 2:138390723-138390745 GTGGAGGGAGGGCGGGAAGTGGG - Intergenic
940506514 2:154561189-154561211 AGGGAGGGAGGGAGGCAAGCAGG - Intergenic
940575135 2:155493795-155493817 AAGGAAGGAGGCAGGCAAGCAGG - Intergenic
941095827 2:161238813-161238835 AAGGAGGGAGCGCGGCAGGCAGG - Intergenic
941095833 2:161238832-161238854 GAGGAGGGAGGCCGGGAGGAAGG - Intergenic
941282273 2:163567886-163567908 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
942629386 2:177939339-177939361 AAGGAGGGAGGGCGGAAGGAGGG + Intronic
943060944 2:183040759-183040781 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
943232227 2:185268871-185268893 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
943499210 2:188666064-188666086 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
944398682 2:199300172-199300194 AAGGAGGGAGGGAGGCAGGGAGG + Intronic
944775578 2:202960774-202960796 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
945070486 2:205983919-205983941 GAGGGGGGAGGCCGACAAGCAGG + Intergenic
945371865 2:209028679-209028701 AAGGAGAGAGGAAGGCAAGAAGG + Intergenic
946312861 2:218892523-218892545 GAGGAGGGGAGCCGGCAGGTGGG + Intronic
946853197 2:223927933-223927955 AAGGAGGGAGGCAGGGAAAGAGG + Intronic
946996440 2:225397775-225397797 AGGCAGGGAGGCAGGCAAGTAGG + Intergenic
947256674 2:228173491-228173513 AAGGAGGGAGGCAGAAAAGGAGG + Intronic
947305330 2:228740285-228740307 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
948612046 2:239176175-239176197 AGGGAGGGAGGCCGGGCAGAGGG - Intronic
948612075 2:239176259-239176281 AGGGAGGGAGGCCGGGCAGAGGG - Intronic
948612083 2:239176278-239176300 AGGGAGGGAGGCCGGGCAGAGGG - Intronic
948612112 2:239176362-239176384 AGGGAGGGAGGCCGGGCAGAGGG - Intronic
1168925546 20:1576040-1576062 AAGGAGGGAGGTGGGGAAGGGGG - Intronic
1168929424 20:1609068-1609090 AAGGAGGGAGGTGGGGAAGGGGG - Intronic
1168933985 20:1647233-1647255 AAGGAGGGAGGCAGGGAAGGGGG - Intronic
1169132803 20:3174834-3174856 AAGTAGTGAGGGCGGCAGGTAGG - Intergenic
1169567213 20:6868313-6868335 AGAGAGGGAGGCTGGCATGTAGG - Intergenic
1169637907 20:7714996-7715018 AGGGAGGGAGGGAGGCAGGTAGG + Intergenic
1170369437 20:15632770-15632792 AAGGAAGGAGAACGGAAAGTAGG - Intronic
1170578130 20:17680228-17680250 GAGGAGGGAGGCGGGGCAGTGGG + Intronic
1170881006 20:20296371-20296393 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
1171231530 20:23490985-23491007 AAGGCCGGAGGCTGGCAAGTGGG + Intergenic
1171427733 20:25058812-25058834 CAGGACGGAGGCCGGCAGCTGGG - Intronic
1171770708 20:29320266-29320288 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1171875450 20:30570907-30570929 AAGGAGGGAGGGTGGGAAGGAGG + Intergenic
1172016184 20:31874786-31874808 AAAGAGGGAGGCAGGAGAGTAGG + Intronic
1172171796 20:32939992-32940014 AGGGAGGGAGGCAGGCAGGCAGG - Intronic
1172304091 20:33869427-33869449 AAGGAGGGAGGAAGGAAAGGAGG - Intergenic
1172350545 20:34235962-34235984 AAGGAGGGAGGGAGGGAAGAAGG + Intronic
1172762157 20:37330511-37330533 AGGCAGGGAGGCCAGCAAGGAGG - Intergenic
1172785972 20:37469255-37469277 AAGGAGAGAGGCAGGCAGGAAGG - Intergenic
1172858744 20:38030248-38030270 AAGGAGGGAGGGAGGGAAGCAGG + Intronic
1173089010 20:39952457-39952479 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1173397078 20:42689720-42689742 AAGAAGGGAGGCAGGAGAGTCGG + Intronic
1173502985 20:43566909-43566931 AGGGAGGGAGGCGGGCAGGCGGG + Intronic
1173929155 20:46804089-46804111 AAGGAGGAAGGGAGGAAAGTCGG + Intergenic
1173989794 20:47293177-47293199 AGGGAGGGAGGCAGGCAGGCAGG + Intronic
1174063006 20:47845684-47845706 AAGGAGGGAGGGGTGAAAGTGGG + Intergenic
1174151352 20:48488680-48488702 AAGGAGGGAGGGGTGAAAGTGGG + Intergenic
1174164547 20:48575614-48575636 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1174285420 20:49469293-49469315 AGGGAGGGAGACAGGCATGTGGG - Intronic
1174692080 20:52516082-52516104 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1174819110 20:53712155-53712177 AAGGAAGGAGGGAGGGAAGTAGG - Intergenic
1174832699 20:53827727-53827749 AAGGAGGGAGGGAGGGAAGAGGG - Intergenic
1175449061 20:59047064-59047086 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1175479996 20:59304015-59304037 AAGGAGGGAGGCAGGAAGGGAGG - Intronic
1175499865 20:59442110-59442132 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1175605776 20:60311248-60311270 AAGGAGGGAGGGAGGGAAGGTGG - Intergenic
1177116043 21:17088187-17088209 AAGAAGGGAGGAGGGCAAGGAGG + Intergenic
1177235858 21:18389219-18389241 AAGGAGGGAGGGAGGCAGGGAGG + Intronic
1177421660 21:20867301-20867323 AAGGAGGGAGGAAGGGAGGTTGG - Intergenic
1177430667 21:20988574-20988596 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1177823216 21:26054698-26054720 AAGCAGGGAGACCACCAAGTAGG + Intronic
1178061540 21:28858545-28858567 AAGGAGGGAGGGAGGAAAGGAGG + Intergenic
1178163931 21:29950241-29950263 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1178319878 21:31597234-31597256 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1178319885 21:31597250-31597272 AAGAAGGGAGGGAGGCAAGGAGG - Intergenic
1178627242 21:34228290-34228312 AAGGCTGGAGGCCAGCAAGCAGG - Intergenic
1178918189 21:36721162-36721184 AAGGAGAGAGCCTGGCATGTTGG + Intronic
1179296850 21:40070342-40070364 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1179388962 21:40970004-40970026 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1179720912 21:43315607-43315629 CAGGAGGGAGGCTGGCAGGAGGG + Intergenic
1179942616 21:44649661-44649683 AAGGAGGGAGGCCTGTATGGGGG - Intronic
1180151556 21:45950789-45950811 AGGGAGGGAGGCGGGCAGGAGGG - Intergenic
1180161569 21:46000650-46000672 AAGGAGGGCGGCCGGGGAGGCGG + Intronic
1180525427 22:16254669-16254691 AGGGAGGGAGGAAGGCAAGAAGG + Intergenic
1180958748 22:19752839-19752861 AAGGAAGCAGGCTGGCCAGTCGG + Intergenic
1181492139 22:23267221-23267243 AAGGAGGGAGGAGGGAAAGAAGG + Intronic
1181630257 22:24147360-24147382 AGGGAGGGAGGCAGGGAAGCAGG - Intronic
1181712391 22:24698711-24698733 AGGGAGGGAGGCAGGGAAGGAGG - Intergenic
1181815408 22:25432715-25432737 AAGGAGGGAGGAAGGAAAGAGGG + Intergenic
1181969467 22:26679454-26679476 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1181969474 22:26679470-26679492 AAGGAGGGAGGAAGGGAAGGAGG - Intergenic
1182860652 22:33556557-33556579 AGGGAGGGAGGCAGGCAGGCAGG + Intronic
1183263509 22:36811576-36811598 AGGGAGGGAGGCAGGGAACTGGG + Intronic
1183507959 22:38219912-38219934 AAGGAAGGAGGCCAGGAAGACGG + Exonic
1183723681 22:39576779-39576801 GAGGAGGGCGGCCGGGAAATGGG - Intronic
1183763132 22:39843638-39843660 GAGGAGGGAGGCAGGCAGGAAGG + Intronic
1183927619 22:41217221-41217243 AGGGAGGGAGGCCGGGGAGCCGG + Intronic
1184025436 22:41852172-41852194 AAGGAGGGAGGGAGGCAGGGAGG + Intronic
1184103373 22:42353412-42353434 AAGGAGGGAGGACAGGAAGGAGG + Intergenic
1184455281 22:44606706-44606728 AGGCAGGGAGGCCGGCCAGGTGG - Intergenic
1184846254 22:47089576-47089598 GAGGAGTGAGGCCGGCAGGGTGG + Intronic
1184934431 22:47710376-47710398 AGGGAGGGAGGCAGGCAGGCAGG - Intergenic
1185078544 22:48696405-48696427 AAGGAGGGAGGGAGGAAAGGAGG - Intronic
1185087682 22:48749549-48749571 GAGGAAGGAAGCCGGCAAGTGGG + Intronic
949433527 3:4003930-4003952 AAGGAGGGAGGGAGGCAAGAAGG + Intronic
949646863 3:6105517-6105539 AAGGAGGGAGGGAGGCAGGGAGG - Intergenic
949985596 3:9538178-9538200 GAGGAGGGAGCCCGGGAAGAAGG - Intronic
950930272 3:16782303-16782325 AAGGAGGGAGGCCAGGAAGAAGG + Intergenic
951376817 3:21928291-21928313 AAGGAGGGAGGAAGGAAGGTAGG + Intronic
951703876 3:25524617-25524639 AAGGAGGGAGGCAGGGAGGGAGG - Intronic
952029304 3:29121303-29121325 AAGGAGGGAGGGAGGCAGGGAGG + Intergenic
952164620 3:30733636-30733658 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
952334186 3:32391075-32391097 AGGGAAGGAGGCAGGCAAGCAGG + Intergenic
952334187 3:32391079-32391101 AAGGAGGCAGGCAAGCAGGTAGG + Intergenic
952945760 3:38477174-38477196 AGGGAGGGAGGCCGGGTGGTGGG - Intronic
953005279 3:38971951-38971973 AAGGAGGGAGGCAGAGAGGTAGG + Intergenic
953312386 3:41891356-41891378 AGGGAGGGAGGCAGGCAGGCAGG + Intronic
953668765 3:44945113-44945135 ATGGAGGGAGGCAGGACAGTGGG + Intronic
954280356 3:49572884-49572906 AAGGAGGAAGGCCGGTGAATAGG + Intronic
954368121 3:50156735-50156757 AAGGAGCCAGGCCCGGAAGTGGG + Intronic
955657942 3:61264258-61264280 AATTAGGGAGGCGGGCAATTTGG - Intergenic
956329285 3:68087551-68087573 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
956614601 3:71158130-71158152 AGGGAGGGAGGCAGGGAAGGAGG + Intronic
956783705 3:72624803-72624825 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
956828753 3:73024642-73024664 AAGGAGGGAGGGAGGCAGGAAGG - Intronic
956851571 3:73232723-73232745 AGGGAGGGAGGGAGGCAAGGAGG - Intergenic
957220842 3:77380676-77380698 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
957979849 3:87494586-87494608 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
958907673 3:99960009-99960031 AAGGAGGGAGGCAGGAAAGGAGG - Intronic
959116357 3:102183382-102183404 AGGGACGGAGGCCTGCATGTTGG + Intronic
959416650 3:106084011-106084033 AGGGAGGGAGGCAGGCAGGAAGG + Intergenic
959445708 3:106436093-106436115 AAGGAGGGAGGGAGGAAAGAAGG + Intergenic
959534504 3:107470051-107470073 AAGGAGGAGGGCTGGCAAGATGG + Intergenic
959687927 3:109167765-109167787 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
960004449 3:112767620-112767642 CAGGAGGGAGGGAGGGAAGTTGG - Intronic
960335613 3:116414014-116414036 AAGGAAGGAGGCAGGAAAGGCGG + Intronic
960647356 3:119902346-119902368 AGGGAGGGAGGGAGGCAAGCAGG + Intronic
960963811 3:123090831-123090853 CAGGAGGTAGGCTGACAAGTGGG - Intronic
961396780 3:126599184-126599206 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
962490859 3:135892954-135892976 AAGAAGGGAGGGAGGCAAGAGGG + Intergenic
962516852 3:136160308-136160330 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
962700129 3:137989593-137989615 AGAGAGGGAGACTGGCAAGTAGG - Intergenic
963196986 3:142543449-142543471 AAGGAGGGAGGGAGGAAAGGAGG - Intronic
963599003 3:147361123-147361145 AAGGAGGGGGGAGGGAAAGTAGG - Intergenic
963638150 3:147825381-147825403 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
964531361 3:157671431-157671453 AAGGAGGGAGGGAGGAAAGGTGG - Intronic
964879750 3:161410248-161410270 ATGTAGGGAGGCTGGAAAGTGGG + Intergenic
965454048 3:168875298-168875320 AGGGAGGCAGGCAGGCAAGCAGG - Intergenic
965834959 3:172841140-172841162 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
966311023 3:178594031-178594053 AAGGAGGGAGGGAGGGAAGAGGG - Intronic
966881215 3:184352341-184352363 AGGGAGGGAGGCTGGCAGCTAGG + Intronic
967039091 3:185672923-185672945 CAGGAGTGAGGCTGGCAAGGTGG - Intronic
967190119 3:186977598-186977620 AAGGAGGGCGGAAGGCAACTTGG + Intronic
967303987 3:188043028-188043050 AAGGAAGGAGGCTGGCCAGGAGG - Intergenic
967350708 3:188511144-188511166 AGGGAGGGAGGGAGGCAGGTAGG - Intronic
968159980 3:196418259-196418281 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
968445607 4:650661-650683 AGGGAGGGGGGCCGGCAGGGAGG + Intronic
968940099 4:3633302-3633324 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
968941397 4:3640556-3640578 AAGGAGGGTGGACGGGAAGAAGG + Intergenic
969723649 4:8906876-8906898 AGGGAGGGAGGGAGGCAAGAAGG - Intergenic
970224568 4:13844159-13844181 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
970305596 4:14728719-14728741 AAGGTGGGAGGCTGGGAGGTGGG + Intergenic
970365056 4:15350104-15350126 AGGGAGGCAGGCAGGCAAGCAGG + Intronic
970365077 4:15350172-15350194 AAGGAGGGAGGCAGGAAGGAAGG + Intronic
970542519 4:17094237-17094259 AAGGAGGGAGGCAGGGAGGAAGG + Intergenic
971394313 4:26214490-26214512 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
972648731 4:40994867-40994889 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
973544354 4:51966084-51966106 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
973655620 4:53044616-53044638 AAGGAGGGAGGGAGGGAAGAAGG - Intronic
974047222 4:56908200-56908222 ACCGAGGAAGGCCGGTAAGTGGG + Exonic
975029637 4:69599610-69599632 AGGGAGGAAGGCAGGCAAGCAGG + Intronic
977202800 4:94136739-94136761 AAGGAGGGAGGAAGGGAAGGGGG + Intergenic
977271824 4:94926116-94926138 AAGGAGGGAGGCAGGGAGGGAGG - Intronic
977574592 4:98662907-98662929 GAGGAGGGAGGCAGGAAGGTGGG - Intergenic
979698523 4:123640881-123640903 AAGGAAGGAGGGAGGCAAGGAGG + Intergenic
979698558 4:123640977-123640999 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
979698579 4:123641037-123641059 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
979732726 4:124044834-124044856 CAGGAGGGACCCAGGCAAGTAGG - Intergenic
979865060 4:125744121-125744143 AGGGAGGGAGGGAGGGAAGTGGG + Intergenic
980078618 4:128320513-128320535 AAGGAGGGAGGGAGGGAAGCAGG - Intergenic
980936757 4:139233155-139233177 AAGGAGGGTGCCCGGCACGGTGG + Intergenic
980968741 4:139549531-139549553 AAGGAGGGAGGGAGGCAAAAAGG - Intronic
982294085 4:153808823-153808845 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
982294116 4:153808899-153808921 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
982529262 4:156517989-156518011 AAGGAGGGAGGGAGGGAAGCAGG + Intergenic
982643910 4:157998165-157998187 AAGGAGGGAGGGAGGGAAGGTGG - Intergenic
982859734 4:160434246-160434268 AAGGAGGGACCCAGGCAAATAGG - Intergenic
983033098 4:162827930-162827952 AGGGAGGGAGGCAGGCAGGCAGG + Intergenic
984224957 4:177023537-177023559 AAGGAGGGAGGGAGGAAAGAAGG + Intergenic
984566509 4:181336992-181337014 AGGGAGGGAGGGCGGGAAGAAGG + Intergenic
985313124 4:188625598-188625620 AAGGTGGGAGGACTCCAAGTGGG - Intergenic
985376230 4:189342091-189342113 AAGCAGGGAAGCCGGAATGTTGG - Intergenic
985485458 5:146081-146103 GAGGAGGGAGGACTCCAAGTGGG - Intronic
985485465 5:146106-146128 GAGGAGGGAGGACTGCAAGTAGG - Intronic
985485506 5:146260-146282 AAGGAGGGAGGGGGGCAGGGTGG - Intronic
985545986 5:509456-509478 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
985648538 5:1096706-1096728 AAGGAGGGAGGAAGGAAAGGAGG + Intronic
985648556 5:1096750-1096772 AAGGAGGGAGGAAGGAAAGGAGG + Intronic
985648591 5:1096831-1096853 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
985957540 5:3276359-3276381 AAGGAGGGAGGGCAGGAAGGAGG + Intergenic
985993675 5:3584516-3584538 AAGGAGGGAGGCAGGACAGGAGG + Intergenic
986327618 5:6688246-6688268 TAAGAGGGAGGCAGGCAGGTTGG + Intergenic
988224672 5:28397888-28397910 AACGTGGGAGGTGGGCAAGTAGG + Intergenic
990762309 5:59143149-59143171 AAGGAGGGAGGAAGGGAAGGAGG - Intronic
990886661 5:60602121-60602143 AGGAAGGGAGGCAGGCAAGAAGG + Intronic
992104513 5:73438263-73438285 AGGGAGGGAGGCCAGGAAGGGGG + Intergenic
992865880 5:80956818-80956840 AAGGAGGGAGGAAGGAAAGGTGG - Intergenic
993703309 5:91143388-91143410 AAGGAGGTATGCAGACAAGTGGG + Intronic
994102607 5:95910266-95910288 AAGGAGGGTGGGCTGGAAGTTGG + Intronic
994198856 5:96949915-96949937 AAGGAGGGAGGGAGGGAAGGAGG - Intronic
994373017 5:98988458-98988480 AAGGAGGAAGGCAGGCAGGCAGG + Intergenic
994596409 5:101843251-101843273 AAGGAGGGAGGGAGGAAAGGAGG + Intergenic
994731015 5:103490578-103490600 AAGGAGGGAGGGAGGAAAGGAGG - Intergenic
994731028 5:103490624-103490646 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
995116491 5:108486183-108486205 AAGGAGGGAGGGCGGGAGGGAGG + Intergenic
995434527 5:112120572-112120594 AAGAAGGGAGTCCAGGAAGTGGG - Intergenic
996009488 5:118465885-118465907 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
996214152 5:120847622-120847644 AAGGAGAAAGGCCAGAAAGTGGG - Intergenic
997292811 5:132749543-132749565 TAGCAGAGATGCCGGCAAGTTGG - Intronic
998127001 5:139631026-139631048 AGGGAGGGAGGCAGGCAGGCAGG - Intergenic
998127002 5:139631030-139631052 AAGGAGGGAGGGAGGCAGGCAGG - Intergenic
999030395 5:148284166-148284188 AAGGAGGGAGGGAGGAAAGAAGG - Intronic
1000118606 5:158175966-158175988 AAGCAGAGAGGCCGGCAGGCTGG + Intergenic
1000463320 5:161547864-161547886 AAGGAGGGATGGCGGCGGGTGGG - Intronic
1000676680 5:164130337-164130359 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
1001774787 5:174320734-174320756 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
1001774832 5:174320864-174320886 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
1002377009 5:178796056-178796078 AAGGAGGGAGGGAGGGAAGTGGG + Intergenic
1002530747 5:179843072-179843094 AGGGAGGGAGGCAGGCAAGCAGG + Intronic
1002614781 5:180444710-180444732 AACCATGGAGGCCGGAAAGTTGG - Intergenic
1002917637 6:1541974-1541996 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1002917649 6:1542002-1542024 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1002917656 6:1542018-1542040 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1002917705 6:1542162-1542184 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1002917720 6:1542198-1542220 AAGGAGGGAGGCAGGGAAGGAGG + Intergenic
1003012005 6:2435173-2435195 AAGGAGGAAGGTCACCAAGTGGG - Intergenic
1003465780 6:6378506-6378528 AAGGAGGGAGGGAGGAAAGGAGG - Intergenic
1003709792 6:8576441-8576463 AAGGAGGGAGGGAGGGAGGTAGG - Intergenic
1004658936 6:17692532-17692554 AAGGAGGGAGGATGGGAAGAAGG + Intronic
1005089508 6:22042233-22042255 AGGGAGGGGGGCGGGCAGGTGGG - Intergenic
1005881566 6:30066344-30066366 AACCAGGAAGGCCGACAAGTAGG - Intergenic
1006308808 6:33242611-33242633 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1006822303 6:36907033-36907055 AAGGAGGGAGGAAGGCAGGAAGG - Intronic
1007121115 6:39382310-39382332 AAGGAGGTAGGAAGGGAAGTGGG - Intronic
1007770271 6:44186468-44186490 AGAGAGGGAGGACGACAAGTGGG - Intergenic
1007899709 6:45399714-45399736 AGGGAGGTAGGGAGGCAAGTGGG + Intronic
1008327419 6:50200235-50200257 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1008857743 6:56112295-56112317 CAGGAGGGAGGCAAGCAAGATGG + Intronic
1009033835 6:58093000-58093022 AGGGAGGGAGGCAGGCAGGCAGG - Intergenic
1010014594 6:71090046-71090068 GAGGAGTGATGCCGGCAATTCGG - Intergenic
1011601442 6:89064090-89064112 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
1011641254 6:89418242-89418264 AAGGAGGGAGGGAGGGAGGTGGG + Intergenic
1012300393 6:97580523-97580545 AATGAGGGAGGCGGGCAAGCAGG - Intergenic
1013424442 6:109998258-109998280 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1013644910 6:112127518-112127540 AGTGAGGGAGGTGGGCAAGTAGG + Intronic
1013766280 6:113577983-113578005 AAGGAGGGAGGCAGGGAGGAAGG - Intergenic
1015631519 6:135236525-135236547 AAGGAGGGAGGAAGGAATGTAGG - Intergenic
1016318734 6:142819015-142819037 AAGAAGGGAGGCAGGGAAGAAGG + Intronic
1016318745 6:142819043-142819065 AGGGAGGGAGGGCGGGAAGGAGG + Intronic
1016791966 6:148075634-148075656 AGGGAGGGAGGCAGGCAGGCAGG - Intergenic
1017334063 6:153234485-153234507 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1017609363 6:156168067-156168089 AGGGAGGGAGGAAGGCAAGTGGG + Intergenic
1018724284 6:166598825-166598847 AAGGATGGAGGCAGGAAAGAAGG - Intronic
1018816806 6:167338987-167339009 AAGGAGGGAGGGCAGGAAGGAGG - Intronic
1019273925 7:166148-166170 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1019273932 7:166164-166186 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1019404922 7:877952-877974 GAGGAGGGAGGCAGGGAGGTGGG - Intronic
1019558151 7:1642690-1642712 AGGGAGGGAGGCAGGCAGGGAGG - Intergenic
1019558157 7:1642706-1642728 AGGGAGGGAGGCAGGCAGGGAGG - Intergenic
1021466161 7:20945463-20945485 AAGGAGGGAGGGAGGAAAGGAGG - Intergenic
1022109233 7:27218177-27218199 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1022740279 7:33113722-33113744 AAGGAGGGAGGCAGGAAGGAAGG - Intergenic
1023613046 7:41990963-41990985 AAGGAAGGAGGCAGGCAAGTAGG + Intronic
1023745573 7:43319532-43319554 AAGGAAGGAGGCCGGCGGGTGGG - Intronic
1023830939 7:44038778-44038800 AAGGAGGGAGGCCGGCAAGTGGG - Intergenic
1023844810 7:44114595-44114617 GAGGAGGGAGACCGGCTGGTGGG + Intergenic
1023856771 7:44188914-44188936 CAGGATGGAGGCCGCCAAGAAGG - Intronic
1024124358 7:46276868-46276890 AAGGAGGGAGGGTGGCAGGAAGG - Intergenic
1024243580 7:47453451-47453473 AGGGAGGGAGGAAGGCCAGTGGG - Intronic
1024301789 7:47892550-47892572 AAGGAGGGAGGTTGGGAGGTGGG + Intronic
1024515353 7:50248249-50248271 AAGGAGGGAGGGAGGCAGGAAGG + Intergenic
1024633630 7:51269040-51269062 ATGGAGGGAGGCCAGCCAGAAGG + Intronic
1025147068 7:56514257-56514279 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1025147075 7:56514273-56514295 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1025151228 7:56552437-56552459 AAGGAGGGAGGCAGGGAGGGAGG - Intergenic
1025231397 7:57205229-57205251 AAGGAGGGAGGGGTGAAAGTGGG - Intergenic
1025231717 7:57207152-57207174 AAGGAGGGAGGGAGGAAAGCAGG - Intergenic
1026214451 7:68335809-68335831 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1026775850 7:73230553-73230575 AAGGAGGGCTGCCTGGAAGTGGG + Intergenic
1026859982 7:73779805-73779827 AGGGAGGGAGGCAGGCAGGGAGG - Intergenic
1026859984 7:73779809-73779831 AAGGAGGGAGGGAGGCAGGCAGG - Intergenic
1026871076 7:73852222-73852244 AAGGAGGGAAGGCGGGAAGGAGG - Intergenic
1026962820 7:74420026-74420048 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1026962827 7:74420042-74420064 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1027016708 7:74783925-74783947 AAGGAGGGCTGCCTGGAAGTGGG + Intronic
1027071320 7:75162011-75162033 AAGGAGGGCTGCCTGGAAGTGGG - Intergenic
1027416914 7:77983496-77983518 ATGGAGGGAGGCAGGCAGGAAGG - Intergenic
1027716450 7:81677062-81677084 ATTGAGGTAGGCTGGCAAGTCGG - Intergenic
1027769911 7:82393120-82393142 AGGGAGGGAGGCAGGCAGGAAGG + Intronic
1027769919 7:82393140-82393162 AGGGAGGGAGGCAGGCAGGGAGG + Intronic
1027769926 7:82393156-82393178 AGGGAGGGAGGCCGGGAGGGAGG + Intronic
1028449666 7:90967104-90967126 AAGGAGGGAGGGAGGAAGGTGGG + Intronic
1028611401 7:92716072-92716094 AAGGAGTGACGCAGGCAATTGGG + Intronic
1029184478 7:98728769-98728791 AAGGAGGGAGGGAGGGAAGAAGG - Intergenic
1029571574 7:101373158-101373180 AAGGAGGGAGGCCAGTTAGGAGG + Intronic
1029741273 7:102493087-102493109 AAGGAGGGAGGCCGGCAAGTGGG - Intronic
1029759263 7:102592256-102592278 AAGGAGGGAGGCCGGCAAGTGGG - Intronic
1029776632 7:102688166-102688188 AAGGAGGGAGGCCGGCAAGTGGG - Intergenic
1030114584 7:106053662-106053684 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1030942502 7:115671332-115671354 AGGGAGGGAGGAAGGCAAGGAGG - Intergenic
1031214125 7:118869330-118869352 AAAGAGGGAGGCTGACAAGCAGG - Intergenic
1031340646 7:120595896-120595918 AGGGAGGGAGGCAGGCAGGCAGG + Intronic
1031929872 7:127674137-127674159 AAGGAGGGAGGAGGGCAGGAAGG - Intronic
1032738204 7:134712056-134712078 AGGGAGGGAGGGAGGGAAGTTGG + Intergenic
1033263674 7:139865868-139865890 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1033866751 7:145698342-145698364 ATGGAGGCAAGCAGGCAAGTTGG + Intergenic
1034193694 7:149229847-149229869 AAGGAGGGAGGACGCAATGTGGG + Intergenic
1034682368 7:152938966-152938988 AGGGAGGGAGGGAGGCAAGGAGG - Intergenic
1034724665 7:153324491-153324513 GGGGAGGGAGGCAGGCAGGTGGG - Intergenic
1035143289 7:156786112-156786134 AAGGAGGGAGGCTGTGAAGGAGG + Intronic
1036146491 8:6259151-6259173 AGGGAGGGAGGCAGGCAGGCAGG + Intergenic
1036282754 8:7415740-7415762 AGGCAGGGAGGCGGGCAGGTGGG - Intronic
1036493018 8:9245108-9245130 AAGCAGGGAGGCCAGCTAGGAGG + Intergenic
1036496614 8:9276025-9276047 AGGGAGGGAGGGAGGGAAGTAGG - Intergenic
1037085743 8:14847640-14847662 AAGGAGGGAGGGAGGCAGGGAGG + Intronic
1037169430 8:15873945-15873967 AAGGAGGGAGGCAGGGAGGGAGG - Intergenic
1037775791 8:21834811-21834833 AGGGAGGGAGGCAGGCAGGGAGG + Intergenic
1037776237 8:21837794-21837816 AAGGAGGGAGGACCTCAGGTGGG - Intergenic
1038022868 8:23564523-23564545 AAGGAGGGAGGCAGGAAAGAAGG + Intronic
1038043449 8:23746305-23746327 AAGGAGGGAGGCAGGGAAGGAGG - Intergenic
1038285610 8:26203881-26203903 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1038435770 8:27534981-27535003 AACCAGGGAGGCCAGCGAGTAGG + Intronic
1039133336 8:34292714-34292736 AAGGAGGGAGGCCAGTCAGGAGG + Intergenic
1039321627 8:36438140-36438162 AGGGAGGGAGGGAGGAAAGTGGG + Intergenic
1039352981 8:36782389-36782411 AAGGAGGGAGGCAGGGAGGGAGG - Intergenic
1039555420 8:38471770-38471792 GAGGAGGGACCCTGGCAAGTTGG - Intergenic
1039616237 8:38956979-38957001 AAGGAGGGAGGCAGGAAGGAAGG + Intronic
1040053805 8:43040651-43040673 AGGGAGGGAGGCAGGCAGGCAGG - Intronic
1041321522 8:56618724-56618746 AAGAAGGCAGGCTGGCAAGGAGG - Intergenic
1041444181 8:57931891-57931913 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1044118570 8:88365552-88365574 AGGGAGGGAGGCAGGCAGGAAGG + Intergenic
1044253198 8:90028680-90028702 AAGGAGGGAGGAAGGAAAGAAGG - Intronic
1044778168 8:95715558-95715580 AAGGAGGGAGGTAGGGAAGGAGG - Intergenic
1045370178 8:101515069-101515091 AAGGAGGGAGGGAGGGAGGTAGG - Intronic
1045412131 8:101929670-101929692 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1045544710 8:103118215-103118237 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1045972592 8:108096040-108096062 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1046605341 8:116365508-116365530 AAGGAGGGAGGGAGGGAAGAAGG + Intergenic
1047061838 8:121235732-121235754 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1047832269 8:128647752-128647774 AGGGAGGGAGGCAGGGAAGGAGG - Intergenic
1048453564 8:134555965-134555987 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1048709671 8:137195223-137195245 AAGGAGGGAGGCAGGGAGGGAGG + Intergenic
1048864003 8:138746000-138746022 AAGCAGGCAGGCGGGCAGGTGGG + Intronic
1049186732 8:141259157-141259179 AAGGAGGGAGACCAGCATCTGGG + Intronic
1049212657 8:141393800-141393822 CAGGAGGAAGGCCGGGAGGTGGG + Intronic
1049617186 8:143580796-143580818 AAGGAGGGAGGAGGGCCAGGAGG - Intronic
1050555651 9:6787700-6787722 AAGCAGGGAGGTCGACAAGGAGG - Intronic
1051196594 9:14568394-14568416 AAGGAAGGAGGGCGGAAAGAGGG + Intergenic
1051647161 9:19280129-19280151 AGGGAGGAAGGCAGGCAGGTAGG - Intronic
1052417215 9:28191532-28191554 AGGGAGGGAGGCCTTCAAGAAGG - Intronic
1053346184 9:37380059-37380081 AAGGAGGGAGGCAGAGAAGGAGG + Intergenic
1055004374 9:71488794-71488816 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1055356990 9:75447928-75447950 AAGGAGGGAGGATGGGAAGGAGG - Intergenic
1055713099 9:79086917-79086939 AAGGAGGGAGGGAGGAAAGAAGG + Intergenic
1056184141 9:84116334-84116356 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1056265513 9:84892970-84892992 AGGGAGGGAGGCAGGAAAGAAGG - Intronic
1056893284 9:90516207-90516229 AAGGGGGGAGACGGGCAAGGTGG + Intergenic
1057295067 9:93830009-93830031 AGGGAGCGAGGCCGGGAAATAGG - Intergenic
1057571998 9:96211532-96211554 AAAGATGTAGGCAGGCAAGTGGG - Intergenic
1058643314 9:107107862-107107884 AAGGAGGGAGGAAGGCAGGGAGG + Intergenic
1058860067 9:109107493-109107515 GAGGAGGGAGGCAGGCAGGCAGG - Intronic
1058935809 9:109768148-109768170 AAGGAAGGAGGAAGGAAAGTAGG + Intronic
1059638199 9:116191027-116191049 AAGGAGGGAGGAAGGGAAGGAGG + Intronic
1059929904 9:119250107-119250129 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1059987536 9:119835260-119835282 AAGGAGGGAGGGAGGAAAGGAGG + Intergenic
1060148296 9:121269862-121269884 AAGGAGGGAGGCGGGGAGGAAGG - Intronic
1060473625 9:123969187-123969209 AAGGAGGGAGGCAGGAAGGAAGG - Intergenic
1060488621 9:124065523-124065545 ATGGAGGGAGGGAGGCAGGTGGG + Intergenic
1060551378 9:124487024-124487046 AAGGTTGGAGACCGGCATGTTGG + Intronic
1061258500 9:129466522-129466544 AAGCAGGGAGGCCACCAAGGTGG + Intergenic
1061295719 9:129675652-129675674 AAGAAGGGAGGCCAGCGAGGGGG - Intronic
1061416540 9:130450356-130450378 AAGGAGGGAGGAAGGCAGGCAGG - Intronic
1061632428 9:131881446-131881468 AAGGAGGGAGGGAGGAAAGGAGG + Intronic
1062050636 9:134444742-134444764 AAGGAGGGAGGTAGGAAAGAAGG - Intergenic
1062144086 9:134979180-134979202 AAGGAGGGAGGCAGGGAAGTAGG + Intergenic
1062256552 9:135625472-135625494 AAGGCAGGAGGCCGACAAGCAGG - Intronic
1062464578 9:136675436-136675458 AAGGGAGGAGGCCAGCAGGTAGG + Intronic
1185627588 X:1493382-1493404 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1185680082 X:1881291-1881313 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1185698426 X:2213297-2213319 AAGGAGGGAGGAAGGGAAGGAGG + Intergenic
1185820216 X:3195895-3195917 AAGGAGGGAGGGCAGAAAGGAGG + Intergenic
1186022429 X:5271384-5271406 AAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1186079300 X:5912913-5912935 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1186079307 X:5912929-5912951 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1186079314 X:5912945-5912967 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1186490793 X:9970514-9970536 AAGGAGGGAGGACGAGAAGGAGG - Intergenic
1186490815 X:9970586-9970608 AAGAAGGGAGGGAGGGAAGTAGG - Intergenic
1187557077 X:20362351-20362373 AAGCAGGGAAGCGGGGAAGTGGG - Intergenic
1189078445 X:37942915-37942937 CAGAAGGGAGGCCAGCAAGAAGG - Intronic
1189439163 X:41018917-41018939 AGGTGGGGAGGCCGGCAAGTGGG + Intergenic
1190248809 X:48707358-48707380 AAGGAGGGAGGGAGGAAGGTAGG - Intronic
1190455711 X:50626085-50626107 AGGGAGTGAGGCAGGCAGGTAGG + Intronic
1191975674 X:66868678-66868700 TAGGAGGGAGGGAGGAAAGTGGG - Intergenic
1192043285 X:67645355-67645377 AAGGAGGGAGGCAGGCAGAAGGG + Intronic
1192451538 X:71248079-71248101 AGGGAGGGAGGCCGGGAAAGTGG - Intronic
1192536713 X:71934646-71934668 AAGCAGGGAGGCCTGGAAGGAGG + Intergenic
1194102237 X:89719678-89719700 AAGAAGGGAGGCAGAGAAGTTGG - Intergenic
1194982575 X:100455087-100455109 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1196743570 X:119047432-119047454 AGGGAGGGAGGGAGGCAAGCAGG + Intergenic
1197207371 X:123801586-123801608 AAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1197271121 X:124425855-124425877 TAGGAGGGAGGCAGGCATTTAGG + Intronic
1197736486 X:129853189-129853211 AAGGAGGGAGAGCAGAAAGTGGG - Intergenic
1198205562 X:134461119-134461141 GAGGAGGGAGGCCAGCAGCTTGG - Intronic
1198210935 X:134515431-134515453 AAGGAGGGAGGGAGGGAAGGAGG + Intronic
1199264783 X:145817812-145817834 AAGGAGGGAGGGAGGCGAGAGGG - Intronic
1200738849 Y:6831492-6831514 AAGGAGGGAGGCAGGGAGGGAGG - Intergenic
1200806986 Y:7443389-7443411 AAGGAGGGAGGGAGGAAAGGTGG - Intergenic
1200807008 Y:7443479-7443501 AAGGAGGGAGGGAGGAAAGGTGG - Intergenic
1201524690 Y:14919388-14919410 AAGGAGGGAGGCAGGGAGGGAGG + Intergenic