ID: 1029741274

View in Genome Browser
Species Human (GRCh38)
Location 7:102493088-102493110
Sequence TAAGGAGGGAGGCCGGCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 4, 1: 0, 2: 0, 3: 18, 4: 275}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029741274_1029741286 13 Left 1029741274 7:102493088-102493110 CCACTTGCCGGCCTCCCTCCTTA 0: 4
1: 0
2: 0
3: 18
4: 275
Right 1029741286 7:102493124-102493146 TGGGCGTCTTCGCGAAGCTGAGG 0: 4
1: 0
2: 0
3: 5
4: 42
1029741274_1029741281 -6 Left 1029741274 7:102493088-102493110 CCACTTGCCGGCCTCCCTCCTTA 0: 4
1: 0
2: 0
3: 18
4: 275
Right 1029741281 7:102493105-102493127 TCCTTACCCACCTTGGAGCTGGG 0: 4
1: 0
2: 0
3: 9
4: 161
1029741274_1029741289 28 Left 1029741274 7:102493088-102493110 CCACTTGCCGGCCTCCCTCCTTA 0: 4
1: 0
2: 0
3: 18
4: 275
Right 1029741289 7:102493139-102493161 AGCTGAGGGCCTCGGTAGTGAGG 0: 4
1: 0
2: 0
3: 10
4: 119
1029741274_1029741280 -7 Left 1029741274 7:102493088-102493110 CCACTTGCCGGCCTCCCTCCTTA 0: 4
1: 0
2: 0
3: 18
4: 275
Right 1029741280 7:102493104-102493126 CTCCTTACCCACCTTGGAGCTGG 0: 4
1: 0
2: 1
3: 14
4: 160
1029741274_1029741290 29 Left 1029741274 7:102493088-102493110 CCACTTGCCGGCCTCCCTCCTTA 0: 4
1: 0
2: 0
3: 18
4: 275
Right 1029741290 7:102493140-102493162 GCTGAGGGCCTCGGTAGTGAGGG 0: 4
1: 0
2: 0
3: 7
4: 146
1029741274_1029741287 14 Left 1029741274 7:102493088-102493110 CCACTTGCCGGCCTCCCTCCTTA 0: 4
1: 0
2: 0
3: 18
4: 275
Right 1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG 0: 4
1: 0
2: 0
3: 0
4: 36
1029741274_1029741288 20 Left 1029741274 7:102493088-102493110 CCACTTGCCGGCCTCCCTCCTTA 0: 4
1: 0
2: 0
3: 18
4: 275
Right 1029741288 7:102493131-102493153 CTTCGCGAAGCTGAGGGCCTCGG 0: 4
1: 0
2: 0
3: 5
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029741274 Original CRISPR TAAGGAGGGAGGCCGGCAAG TGG (reversed) Intronic
900266022 1:1757616-1757638 TGAGGAGCCAGGCAGGCAAGTGG - Intronic
901462868 1:9401926-9401948 GAGGGAGGGAGGCCGGCAGGCGG + Intergenic
902391971 1:16112256-16112278 ATGGGAGGGAGGCTGGCAAGAGG - Intergenic
905299000 1:36973204-36973226 TAAGGAGGCAGGCAGGGAACAGG - Intronic
906214455 1:44030758-44030780 TAGGGAGGCAGGCCGGCTGGAGG + Intronic
909249603 1:73334994-73335016 GAAGGAGGGAGGGAGGGAAGGGG - Intergenic
910197002 1:84652323-84652345 TGAGGAGGGAGGATGGCTAGAGG + Intronic
910846798 1:91611929-91611951 CAAGGAGGGAGGAGGGCAACTGG + Intergenic
910998173 1:93131625-93131647 TATGTAGGGAGGCCGACAAATGG + Intronic
911104140 1:94116937-94116959 AAAGGAGGGAGGGAGGGAAGGGG - Intronic
912430854 1:109627657-109627679 TAAGGATGGAGGCTGCCAAGAGG - Intronic
913340382 1:117752463-117752485 TAAGGAGAGAGTCCAGCATGAGG - Intergenic
914791444 1:150880820-150880842 TAAGTATGGAGGCCAGTAAGGGG + Intergenic
915161548 1:153923760-153923782 GAAGCAGGGAGGCCAGCAAAAGG - Intergenic
915972456 1:160364247-160364269 AAAGGAGGGAGCCCTGCAAGGGG + Intergenic
916386645 1:164280421-164280443 AAGGGAGGGAGGGAGGCAAGGGG + Intergenic
916942045 1:169686646-169686668 TAAGGATTGAGGACGGTAAGGGG - Intronic
918550274 1:185734292-185734314 AAAGGAGGGAGGACGGCAACTGG + Intergenic
918810730 1:189116408-189116430 TAAGGTTGGAGGCAGGAAAGAGG + Intergenic
920748039 1:208647327-208647349 GAAGGAGGGAGGGAGGGAAGGGG - Intergenic
922507295 1:226133934-226133956 TGAGGAGGGAGGATGGAAAGAGG + Intergenic
922730101 1:227945241-227945263 TAAGCAGGGAGGCCAGCCCGAGG - Intronic
922758326 1:228109063-228109085 GAGGGAGGGAGGCAGGGAAGGGG - Intronic
923109450 1:230879573-230879595 GAGAGGGGGAGGCCGGCAAGGGG - Intergenic
1063243416 10:4194132-4194154 CAAGGAGGGAGGACGGCTTGAGG - Intergenic
1065292342 10:24243410-24243432 AAAGGAGGGAGGGTGGGAAGGGG - Intronic
1067292893 10:44957467-44957489 GAAGGAGGGAGGGAGGAAAGAGG - Intergenic
1069394462 10:67973604-67973626 TAAGTAGAGAGGCTGGCAATAGG + Intronic
1071611905 10:87039224-87039246 TAAGCTGGGAGGCCTGCATGGGG - Intergenic
1072631926 10:97152193-97152215 TGTGGAGGGAGGCTGGCATGTGG - Intronic
1072788433 10:98300665-98300687 TAGGGAGGTAGGCCAGCATGGGG - Intergenic
1073116507 10:101094584-101094606 TAGGGAGGGATGGCGGCAGGAGG - Intronic
1074816569 10:117145973-117145995 GAAGGAGGGAGGGAGGGAAGGGG + Intergenic
1074863238 10:117529107-117529129 AGAAGAGGGAGGCTGGCAAGCGG + Intergenic
1075835703 10:125450852-125450874 TAACGAGGGAATTCGGCAAGAGG - Intergenic
1075905515 10:126078343-126078365 TAAGGAAGGAGCTTGGCAAGGGG - Intronic
1076077351 10:127545051-127545073 AAAGGAGGGAGGGGAGCAAGAGG - Intergenic
1076474524 10:130743092-130743114 TGAGGAAGGAGGCGGGCAGGTGG - Intergenic
1079632007 11:22689126-22689148 TGAGCAGGAAGGGCGGCAAGAGG + Intronic
1083623144 11:64058823-64058845 TGAAGAGGGCAGCCGGCAAGGGG + Intronic
1083633695 11:64108927-64108949 TAAGGACAGAGGCAGGCAGGTGG + Intronic
1083994226 11:66264252-66264274 GAAGGAGGGAGGCAGGGATGAGG + Intronic
1084021525 11:66420831-66420853 GAGGGAGGGAGGCGGGCGAGGGG - Intergenic
1087508490 11:99059063-99059085 TGGGGAGGGAGGGAGGCAAGGGG - Intronic
1089084996 11:115809478-115809500 TCAGGAGGGAGCACGGCATGTGG - Intergenic
1089196373 11:116696099-116696121 TAAGGAGGGAGGGGAGGAAGAGG - Intergenic
1089998119 11:122928220-122928242 CAAGGAGGGAGGACTGCTAGAGG + Intronic
1091007395 11:131965919-131965941 AAAGGAGGGAGGGAGGGAAGGGG + Intronic
1091286795 11:134412373-134412395 CGAGGAGGGAGGCCGGCGAGGGG + Intergenic
1092060699 12:5548114-5548136 AAAGGAGGGAGGGAGGGAAGAGG - Intronic
1092092274 12:5812718-5812740 AAGGGAGGGAGGGAGGCAAGAGG + Intronic
1093450802 12:19311191-19311213 TAAGGTGGGAGGCTTGCATGAGG + Intronic
1094278636 12:28708937-28708959 CAAGGAGGGAGGCCAGCCAGAGG + Intergenic
1097054405 12:56241134-56241156 TGTGGAGGGAGGTGGGCAAGAGG + Exonic
1097173098 12:57128420-57128442 TGAGGAGGGAGGGAGGGAAGGGG - Intronic
1099274511 12:80558080-80558102 AAAGGAGGGAGGGAGGGAAGGGG - Intronic
1099771309 12:87061466-87061488 TATGGAGGAAGGAAGGCAAGAGG + Intergenic
1101850884 12:108401273-108401295 TAAGGAGGGAGGCTGGCTTGAGG - Intergenic
1102277921 12:111598003-111598025 GAAGGAGGAAGGCCGGGACGGGG + Intronic
1103362746 12:120363350-120363372 TAGGGAGGGAGGCAGGAAGGAGG - Intronic
1103985992 12:124767791-124767813 TGAGGAGGGAGGCAGGAAGGTGG - Intergenic
1107088523 13:36450812-36450834 TAGGAGGGGAGGCAGGCAAGTGG - Intergenic
1110451559 13:75642370-75642392 TAAGGAGGGAGGATGGCTTGAGG + Intronic
1111211605 13:85086992-85087014 TATGGAGGGAGGTAGGGAAGGGG + Intergenic
1111745972 13:92270053-92270075 TAAGGAGGGTGGTGGGGAAGGGG + Intronic
1114558941 14:23577632-23577654 GAAAGAGGGAGGGGGGCAAGTGG + Intronic
1114572309 14:23680443-23680465 TAAGAAGGGAGGGTGACAAGGGG - Intergenic
1118249660 14:64147288-64147310 TGAGGGAGGAGGCTGGCAAGTGG - Intronic
1118867533 14:69715245-69715267 TAGGGAGGGTGCCTGGCAAGAGG + Intergenic
1119693095 14:76692063-76692085 GAAGGAGGGAGGTCGGGCAGTGG + Intergenic
1121323103 14:93004177-93004199 GAGGGAGGGAGGCCAGCAGGAGG + Intronic
1121457134 14:94045663-94045685 TTAGGAGGGAGGCCTGGCAGAGG - Intronic
1123972510 15:25521442-25521464 AAAGGAGGGTTGCAGGCAAGGGG + Intergenic
1124439194 15:29674801-29674823 AAGGAAGGGAGGCCGGCAGGGGG - Intergenic
1124652733 15:31485194-31485216 TAAGGATGGAGGCCTTCAGGTGG + Intronic
1125513558 15:40305802-40305824 TAGGGAGGGAGGTGGGAAAGGGG - Intronic
1126675349 15:51155776-51155798 TAAAGTGGAAGGCAGGCAAGGGG - Intergenic
1127660771 15:61098170-61098192 CAGGGAGGGAGGCAGGGAAGGGG - Intronic
1128136015 15:65264056-65264078 AAATGAGGGAGGCCGACATGCGG + Intronic
1128566015 15:68700714-68700736 TAGGGAGGGCGGCTGGCAGGCGG + Intronic
1129300203 15:74621054-74621076 GCAGGAGGGAGGCAGGGAAGAGG - Intronic
1129314144 15:74731057-74731079 GAAGGAGGGAGTCAGGCAGGAGG + Intergenic
1129933102 15:79428440-79428462 GAAGGAGGGAGGGAGGAAAGGGG - Intergenic
1131274345 15:90968377-90968399 TAAGAGGGGAGGCAGGCTAGGGG + Intronic
1131346721 15:91656383-91656405 AAGGGAGGGAGGCAGGGAAGCGG - Intergenic
1131593788 15:93775923-93775945 GGAGGAGGGAGACCTGCAAGAGG + Intergenic
1132513315 16:354370-354392 GAAGCACGGAGGCGGGCAAGTGG - Intergenic
1133324546 16:4935296-4935318 GAAGGAGGGAGGCTGGGAGGAGG + Intronic
1134310358 16:13070609-13070631 AAAGGCAGGAGGCCGGGAAGTGG + Intronic
1134487701 16:14671480-14671502 TAAGGAGGGAGGACTACATGAGG - Intergenic
1136316116 16:29455451-29455473 TAAGGAAGGAGACCGGGCAGCGG + Intronic
1136430693 16:30194793-30194815 TAAGGAAGGAGACCGGGCAGCGG + Exonic
1137558603 16:49488993-49489015 TAAGGAGAGAGGCGGCCTAGGGG - Exonic
1139508994 16:67415883-67415905 TAAGGAAGGGGGCTGGGAAGCGG - Intronic
1140257525 16:73349797-73349819 GAAGGAGGGAGGGAGGGAAGAGG - Intergenic
1140986257 16:80160608-80160630 GAAGAAGGGAGGCAGGCAGGGGG + Intergenic
1141428727 16:83959990-83960012 TGACGAGGGAGGTCGACAAGGGG - Intronic
1141715574 16:85724995-85725017 AAAGGAGGGAGGCCAGCAGGTGG - Intronic
1141884172 16:86880426-86880448 CAAGAAGGGAGGCCGGCTGGTGG - Intergenic
1142073560 16:88104453-88104475 TAATGAAAGGGGCCGGCAAGAGG - Intronic
1142488648 17:263158-263180 CAAGGAGGGAGGTGGGCATGGGG + Intronic
1142733072 17:1875762-1875784 TAAGGAGTGAGGCTGGCAATGGG - Exonic
1143387797 17:6542378-6542400 TTAGGAAGGGGGCTGGCAAGTGG - Intronic
1143410824 17:6707371-6707393 GAAGGAGGGAGGCAGGGAGGAGG - Intronic
1144016218 17:11198974-11198996 TGAGGAGTGAGGACGGCCAGAGG - Intergenic
1144457436 17:15430618-15430640 AAAGGAGGGAGGGAGGCAATGGG + Intergenic
1144587543 17:16496764-16496786 TTGGGAGGGAGGCCTGGAAGAGG - Intergenic
1144833307 17:18143649-18143671 CAAGGAGGGAGGCTGGCAGGTGG + Intronic
1145888580 17:28399161-28399183 GAAGGAGGGAGGGAGGTAAGAGG - Exonic
1146340478 17:32015023-32015045 TTGGGAGTGAGGCAGGCAAGTGG + Intronic
1146906067 17:36618580-36618602 TAAGGAGGGAGGACAGTGAGAGG + Intergenic
1147134861 17:38428755-38428777 GAAGGACGGAAGCAGGCAAGGGG + Intronic
1147606012 17:41774075-41774097 TTAGATGTGAGGCCGGCAAGGGG - Intronic
1148354658 17:46967892-46967914 TAAGCAGGGAGGTGGCCAAGAGG + Intronic
1148872355 17:50666131-50666153 AAAGGAGTTAGGCAGGCAAGAGG - Intronic
1150859448 17:68786327-68786349 GAAGGAGGGAGGGAGGGAAGAGG - Intergenic
1151144763 17:72030588-72030610 GAAGGAGGGAAGCAGGCAGGAGG + Intergenic
1151805215 17:76400772-76400794 CAAGGTGGGAGGGTGGCAAGTGG - Intronic
1152013347 17:77734494-77734516 TAAGGAGGGAGGAAGGCAGGCGG - Intergenic
1152021519 17:77782231-77782253 CCAGGAGGGAGGTCAGCAAGCGG - Intergenic
1152388905 17:79991622-79991644 GAAGGAGGCAGGGAGGCAAGAGG + Intronic
1154284017 18:13034856-13034878 CAAGGAGGAAGGCAGGCATGGGG - Intronic
1156943087 18:42795019-42795041 TAAGGAGAGAGATGGGCAAGAGG + Intronic
1158525013 18:58205534-58205556 GAAGGAGGGAGGCAGGCAGCTGG + Intronic
1159776847 18:72612493-72612515 AAAGGAGGGAGGGAGGTAAGGGG - Intronic
1160371571 18:78376542-78376564 CACGGAGGGAGGCTGGCATGAGG + Intergenic
1160484359 18:79275267-79275289 GAAAGAAGGAGGCAGGCAAGGGG - Intronic
1161494501 19:4580160-4580182 TAAGGAGGGAGGAGGGAGAGAGG - Intergenic
1162515000 19:11142558-11142580 GAATGATGGAGGCCGGCCAGAGG - Intronic
1162569270 19:11461531-11461553 GAAGGAGGGAGGGAGGAAAGAGG - Intronic
1162713713 19:12614974-12614996 TAAGGTGGGAGGACGGCCTGAGG - Intronic
1163004616 19:14389361-14389383 TGAGGAGGGAGACGGGGAAGGGG + Intronic
1163244807 19:16086907-16086929 TGAGGAGCGAGGCAGACAAGAGG - Intronic
1165831632 19:38733507-38733529 TAAGGAAGGAGAAGGGCAAGGGG - Intronic
1167158338 19:47752616-47752638 TGAGGAGGGAGGCCTGGACGGGG - Intronic
1167235123 19:48309579-48309601 GAAGGAGGTAGGCAGACAAGTGG - Intronic
1168124782 19:54277389-54277411 AAAGGAGAGAGGCCTGCAGGTGG - Intronic
1168266401 19:55226097-55226119 GGAGGAGGGAGGGCGGCAAGGGG - Intergenic
924961918 2:43408-43430 TAAGGATGGAGGCAGGAAAAAGG - Intronic
925281340 2:2687447-2687469 TGAGGAGGGAGGCGGGCCTGTGG - Intergenic
925919229 2:8627849-8627871 TAAGGAGGGTGGCCCGGAGGAGG + Intergenic
926945540 2:18183675-18183697 TAATGAGGAAGGCAGGCCAGAGG + Intronic
927916341 2:26938996-26939018 CAATGAGGGAGGCAGGCAGGTGG - Intronic
928300780 2:30122086-30122108 GAAGGAGGGAGACAGGCTAGGGG + Intergenic
929617765 2:43325561-43325583 GAAGGAGGGAGGAAGGGAAGAGG + Intronic
930044250 2:47155135-47155157 GCAGGAGCCAGGCCGGCAAGGGG + Intronic
931748792 2:65313388-65313410 CAAGGAGCGAGGAGGGCAAGCGG - Exonic
931799745 2:65747298-65747320 TACGCAGGGAGGCCTGAAAGTGG + Intergenic
932595014 2:73088249-73088271 GAAGGAGGGAGCCCGGAAGGAGG - Exonic
933870056 2:86557401-86557423 TAGGTAGGGAGGCCGGTTAGTGG - Intronic
935063101 2:99624856-99624878 GAAGGCGGGAGGGCAGCAAGTGG + Intronic
938296951 2:130184453-130184475 TCAGGAGTGAGGTGGGCAAGGGG - Intronic
938459809 2:131490204-131490226 TCAGGAGTGAGGCGGGCAAGGGG + Intronic
938672903 2:133602500-133602522 TCAGGAGGGAGGTAGGCACGTGG + Intergenic
941692362 2:168514285-168514307 TAAGGAAGGGGGCTGGCATGAGG - Intronic
941710313 2:168704995-168705017 TGAGGAAGGAGGCAGGAAAGAGG - Intronic
942629385 2:177939338-177939360 GAAGGAGGGAGGGCGGAAGGAGG + Intronic
943633378 2:190279248-190279270 TAAGAAGTGAGGCCTTCAAGAGG - Intronic
945033513 2:205685668-205685690 CAGGGAGGGAGGCAGGCTAGCGG - Intronic
946405104 2:219488332-219488354 CAGAGAGGGAGGCCAGCAAGTGG + Intronic
948521790 2:238543873-238543895 TGAGGAGGGAGTACTGCAAGAGG - Intergenic
948612047 2:239176176-239176198 GAGGGAGGGAGGCCGGGCAGAGG - Intronic
948612076 2:239176260-239176282 GAGGGAGGGAGGCCGGGCAGAGG - Intronic
948612084 2:239176279-239176301 GAGGGAGGGAGGCCGGGCAGAGG - Intronic
948612113 2:239176363-239176385 GAGGGAGGGAGGCCGGGCAGAGG - Intronic
948805257 2:240451153-240451175 TCTGGAGGGAGCCCGCCAAGAGG - Intronic
1168925547 20:1576041-1576063 AAAGGAGGGAGGTGGGGAAGGGG - Intronic
1168929425 20:1609069-1609091 AAAGGAGGGAGGTGGGGAAGGGG - Intronic
1168933986 20:1647234-1647256 AAAGGAGGGAGGCAGGGAAGGGG - Intronic
1170578129 20:17680227-17680249 TGAGGAGGGAGGCGGGGCAGTGG + Intronic
1171231529 20:23490984-23491006 AAAGGCCGGAGGCTGGCAAGTGG + Intergenic
1171370862 20:24661295-24661317 GAAGGAGGGAGGGAGGAAAGGGG + Intronic
1171472196 20:25381078-25381100 CAAGCAGGGAGACCGGCTAGGGG - Intronic
1172118039 20:32583477-32583499 GAGGGAGGGAGGCCGGCGCGGGG + Intronic
1172527350 20:35607785-35607807 TAGGGTGGGAGGGAGGCAAGGGG + Intergenic
1173502984 20:43566908-43566930 GAGGGAGGGAGGCGGGCAGGCGG + Intronic
1173629884 20:44504849-44504871 TGATGAGGGAGGACTGCAAGAGG + Exonic
1174063005 20:47845683-47845705 TAAGGAGGGAGGGGTGAAAGTGG + Intergenic
1174118367 20:48243472-48243494 TAAGGATGGAGGCTGGAAAAGGG - Intergenic
1174151351 20:48488679-48488701 TAAGGAGGGAGGGGTGAAAGTGG + Intergenic
1174832700 20:53827728-53827750 GAAGGAGGGAGGGAGGGAAGAGG - Intergenic
1175642501 20:60642788-60642810 CACAGAGGGAGGCTGGCAAGGGG - Intergenic
1175909012 20:62395750-62395772 CAAGGAGGGTGCCCGGCAGGGGG + Intronic
1179720911 21:43315606-43315628 CCAGGAGGGAGGCTGGCAGGAGG + Intergenic
1179942617 21:44649662-44649684 GAAGGAGGGAGGCCTGTATGGGG - Intronic
1180151557 21:45950790-45950812 GAGGGAGGGAGGCGGGCAGGAGG - Intergenic
1180568128 22:16692577-16692599 TAAGGAGGGAAGGAGCCAAGAGG + Intergenic
1180953403 22:19730852-19730874 TAAGGGGGGAGCGCGGAAAGAGG + Intergenic
1181013444 22:20055355-20055377 TAAGGAGGGAGGACTGCTTGAGG - Intronic
1181064642 22:20299660-20299682 TAAGGAGAGAGCGCGGCTAGGGG + Intergenic
1181143298 22:20823841-20823863 TTAGGAGGGAGGCTGGCTTGAGG + Intronic
1181182647 22:21078535-21078557 TCAGGAGTGAGGCGGGCAAAGGG + Intergenic
1181815407 22:25432714-25432736 GAAGGAGGGAGGAAGGAAAGAGG + Intergenic
1183024260 22:35052314-35052336 TAAGGAGGGAGGGAGGGAAAGGG - Intergenic
1185087681 22:48749548-48749570 AGAGGAAGGAAGCCGGCAAGTGG + Intronic
1185108050 22:48885425-48885447 GGAGGAGGGAGGCAGGCACGGGG - Intergenic
1185390471 22:50558466-50558488 TTAACAGGGAGGACGGCAAGAGG - Intronic
949505148 3:4720324-4720346 TAAGCAGGGAGGCCAGGTAGCGG + Intronic
952154315 3:30626546-30626568 AACAGAGGGAAGCCGGCAAGTGG + Intronic
952866317 3:37857571-37857593 TGAGGAGTGAGGCCAGAAAGAGG - Intergenic
953625469 3:44567331-44567353 TAAGGTGGGAGGCTGGCTTGAGG - Intronic
954407193 3:50351782-50351804 GAAGGAGGGAGGACTGCCAGAGG + Intronic
955391378 3:58524735-58524757 TCAGGAGGGAGGCCAGGCAGAGG - Intronic
956644981 3:71446452-71446474 TAAGGAGGGAGGGAGCCAGGCGG + Intronic
957979825 3:87494429-87494451 AAAGGAGGGAGGGAGGGAAGAGG + Intergenic
959291790 3:104484641-104484663 TAATGGGGGTGGCTGGCAAGAGG + Intergenic
960027039 3:113021130-113021152 TTAAGAGGGAGGCAGGCAGGAGG - Intergenic
961175841 3:124834515-124834537 GAAGGAGGGAGGCGAGGAAGGGG + Intronic
962490858 3:135892953-135892975 AAAGAAGGGAGGGAGGCAAGAGG + Intergenic
963465187 3:145670544-145670566 TAAGGAAGGAGGACTGGAAGAGG - Intergenic
964219136 3:154324331-154324353 TATGGAGGGGGGCCAGCAGGGGG - Exonic
966311024 3:178594032-178594054 TAAGGAGGGAGGGAGGGAAGAGG - Intronic
966403922 3:179575517-179575539 TAAGGAGGGAGGGAGGAAGGAGG - Intronic
968653670 4:1769756-1769778 CAAGGAGGCAGGCTGGCATGGGG - Intergenic
969057721 4:4412599-4412621 TATGGAGGGAGGAGGTCAAGGGG - Intronic
969436502 4:7192308-7192330 GAGGGAGGGAGGACGGGAAGAGG + Intergenic
969799256 4:9549796-9549818 TAAGGAGGGAGGGAAGCATGGGG - Intergenic
971276534 4:25203181-25203203 GTAGGATGGAGGCAGGCAAGGGG - Intronic
974700059 4:65431580-65431602 AAAGGAGGGAGGTCGGGAAGAGG - Intronic
976321868 4:83725498-83725520 TAAGGAGGGAAGGGGGAAAGAGG - Intergenic
977202799 4:94136738-94136760 GAAGGAGGGAGGAAGGGAAGGGG + Intergenic
977637098 4:99311986-99312008 TTAAGAGGGAGACCGTCAAGTGG - Intronic
978247872 4:106597099-106597121 TGAGAAGGGAGGCTGGAAAGTGG - Intergenic
978677014 4:111330666-111330688 TAAGGATGGAGGGTGGGAAGAGG + Intergenic
978807788 4:112818596-112818618 TAAGCAGGGAGAGGGGCAAGAGG + Intronic
982703210 4:158678891-158678913 TAAGGCGGGAGGACTGCATGAGG - Intronic
985611352 5:891410-891432 TGAGGAGGGAGCCTGGCATGAGG - Intronic
985677032 5:1237510-1237532 ACAGGAGGGAGGCCGGAGAGGGG + Intronic
990543429 5:56797622-56797644 GAAGGAGGGAGGGAGGAAAGGGG + Intergenic
991362885 5:65839539-65839561 TGAGGATGGAGGCTGGCAGGAGG + Intronic
992077177 5:73202244-73202266 GAGGGAGGGAGGGCGGCAGGAGG + Intergenic
992104512 5:73438262-73438284 TAGGGAGGGAGGCCAGGAAGGGG + Intergenic
994451727 5:99951711-99951733 TAAGCAGGGAGCCAGGCATGGGG + Intergenic
995047810 5:107670673-107670695 GAGGGAGGGAGGCAGGCAAAGGG + Exonic
995434528 5:112120573-112120595 TAAGAAGGGAGTCCAGGAAGTGG - Intergenic
996136060 5:119843924-119843946 GAGGGAGGGAGGCTGGCAGGAGG - Intergenic
1000463321 5:161547865-161547887 TAAGGAGGGATGGCGGCGGGTGG - Intronic
1000931471 5:167256710-167256732 TAAGTAGGGAAGCCAGAAAGAGG + Intergenic
1001281440 5:170389149-170389171 CAGGGAGGGAGGCAGGCAGGAGG - Intronic
1001595966 5:172898920-172898942 GAAGCAGGGAGAGCGGCAAGAGG + Intronic
1001713442 5:173795678-173795700 TATGGAGGGAGGCATGCATGTGG + Intergenic
1002377008 5:178796055-178796077 AAAGGAGGGAGGGAGGGAAGTGG + Intergenic
1003540272 6:7012526-7012548 GAAGGAAGGAGGGCAGCAAGGGG + Intergenic
1005929770 6:30475042-30475064 TGGGGATGGAGGCCGGGAAGAGG - Intergenic
1006678889 6:35782840-35782862 GAAGCAGGGAGGCCGGGAGGCGG + Intronic
1007309108 6:40931040-40931062 AAAGGAGGAAAACCGGCAAGTGG + Intergenic
1007615867 6:43179580-43179602 TCAGCAAGGAGGCTGGCAAGAGG - Exonic
1007690759 6:43699699-43699721 CAGGCAGGGAGGCCGGGAAGGGG - Intergenic
1011228840 6:85137455-85137477 TAAGGAGGGAGGATGGAGAGGGG - Intergenic
1012409942 6:98945993-98946015 AAAGGGGGGAGGGAGGCAAGAGG + Intronic
1016980849 6:149852506-149852528 GAGGGAGGGAGGCCAGCATGCGG - Intronic
1017313017 6:152996580-152996602 TAAGGAAGGAGCCAGGAAAGGGG - Intronic
1017522302 6:155213208-155213230 GAAGGAGGTATGCGGGCAAGGGG + Intronic
1017609362 6:156168066-156168088 GAGGGAGGGAGGAAGGCAAGTGG + Intergenic
1021925380 7:25529421-25529443 GCAGCAGGGAGGCCTGCAAGGGG - Intergenic
1021940531 7:25674427-25674449 TAAGGAGGAAGTGGGGCAAGAGG + Intergenic
1022418971 7:30202460-30202482 TAAGAAGGCAGGCCTGGAAGTGG - Intergenic
1023745574 7:43319533-43319555 CAAGGAAGGAGGCCGGCGGGTGG - Intronic
1023830940 7:44038779-44038801 TAAGGAGGGAGGCCGGCAAGTGG - Intergenic
1024421115 7:49167826-49167848 TGAGGAGGGAGGGAGCCAAGAGG - Intergenic
1024437991 7:49381582-49381604 TAAGGAGGGAGGAAAGAAAGAGG + Intergenic
1025231398 7:57205230-57205252 TAAGGAGGGAGGGGTGAAAGTGG - Intergenic
1027578093 7:79956329-79956351 AAAGGAGGGAGGGTGGGAAGGGG + Intergenic
1029741274 7:102493088-102493110 TAAGGAGGGAGGCCGGCAAGTGG - Intronic
1029759264 7:102592257-102592279 TAAGGAGGGAGGCCGGCAAGTGG - Intronic
1029776633 7:102688167-102688189 TAAGGAGGGAGGCCGGCAAGTGG - Intergenic
1029853494 7:103489367-103489389 GAAGGAGGGAGGCCCAGAAGTGG + Intronic
1032752245 7:134853067-134853089 TAAGGTGGGAGGCATGAAAGAGG - Intronic
1035678640 8:1471568-1471590 TTAGGAGGGAGGCTGGGGAGGGG - Intergenic
1036361857 8:8083229-8083251 TAAGGAGGGAGGGAAGCATGGGG - Intergenic
1037233112 8:16684328-16684350 CAAGGAGAGAGGACAGCAAGAGG + Intergenic
1039774357 8:40720872-40720894 TAAGGTGGGAGGGAGGGAAGGGG + Intronic
1045501439 8:102747216-102747238 TCAGGGGGAAGGCAGGCAAGTGG + Intergenic
1046520310 8:115317711-115317733 TAGGGGGAGAGGCCTGCAAGTGG - Intergenic
1048945518 8:139443474-139443496 TAAAGAGGGAACCCGGCAAGAGG - Intergenic
1048980084 8:139698532-139698554 TAAGCAGGGTGGCAGGGAAGGGG + Intronic
1049385592 8:142341468-142341490 CTAGCAGGCAGGCCGGCAAGGGG + Intronic
1051196593 9:14568393-14568415 GAAGGAAGGAGGGCGGAAAGAGG + Intergenic
1054474030 9:65560210-65560232 GGAGGGGGGAGGCGGGCAAGGGG - Intergenic
1056469938 9:86895461-86895483 TAAGGAGTGGGGCCTGTAAGAGG + Intergenic
1057173220 9:92976252-92976274 TAAGGATGGAGTCAGGCAGGGGG + Exonic
1057194277 9:93108148-93108170 TACGGAGGGAGGCGAGAAAGAGG + Intronic
1058419532 9:104820751-104820773 TAAGGAGGGTGGCGGGGGAGAGG + Intronic
1061295720 9:129675653-129675675 CAAGAAGGGAGGCCAGCGAGGGG - Intronic
1061808637 9:133149769-133149791 CAAGGAGGGAGGTGGGGAAGAGG - Intergenic
1062007874 9:134250540-134250562 TAAGGAGTAAGGCCAGAAAGTGG - Intergenic
1187364071 X:18652086-18652108 TGGGGAGGGAGGCAGGCGAGGGG - Intronic
1189439162 X:41018916-41018938 GAGGTGGGGAGGCCGGCAAGTGG + Intergenic
1190429941 X:50369538-50369560 GAAGGAGGGAGGCAGGGAGGGGG - Intronic
1190620635 X:52284130-52284152 GAAGGAGGTAGGCAGACAAGTGG + Intergenic
1192043284 X:67645354-67645376 GAAGGAGGGAGGCAGGCAGAAGG + Intronic
1192801211 X:74466282-74466304 TAAGTAGGGAGTCAGGAAAGGGG - Intronic
1197103924 X:122690336-122690358 GAAGGAGGGAGGTTGGGAAGGGG + Intergenic
1197621321 X:128752965-128752987 TGAGGAGGGAGGGCGGGAGGAGG - Intergenic
1198195308 X:134354781-134354803 TGAGGAGGGAGGGCGGGAGGAGG - Intergenic
1199264784 X:145817813-145817835 GAAGGAGGGAGGGAGGCGAGAGG - Intronic
1200124588 X:153807308-153807330 TATGGAGGGCGGCCCGCAGGAGG - Exonic