ID: 1029741275

View in Genome Browser
Species Human (GRCh38)
Location 7:102493095-102493117
Sequence AGGTGGGTAAGGAGGGAGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3071
Summary {0: 4, 1: 0, 2: 6, 3: 191, 4: 2870}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029741275_1029741290 22 Left 1029741275 7:102493095-102493117 CCGGCCTCCCTCCTTACCCACCT 0: 4
1: 0
2: 6
3: 191
4: 2870
Right 1029741290 7:102493140-102493162 GCTGAGGGCCTCGGTAGTGAGGG 0: 4
1: 0
2: 0
3: 7
4: 146
1029741275_1029741288 13 Left 1029741275 7:102493095-102493117 CCGGCCTCCCTCCTTACCCACCT 0: 4
1: 0
2: 6
3: 191
4: 2870
Right 1029741288 7:102493131-102493153 CTTCGCGAAGCTGAGGGCCTCGG 0: 4
1: 0
2: 0
3: 5
4: 117
1029741275_1029741287 7 Left 1029741275 7:102493095-102493117 CCGGCCTCCCTCCTTACCCACCT 0: 4
1: 0
2: 6
3: 191
4: 2870
Right 1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG 0: 4
1: 0
2: 0
3: 0
4: 36
1029741275_1029741289 21 Left 1029741275 7:102493095-102493117 CCGGCCTCCCTCCTTACCCACCT 0: 4
1: 0
2: 6
3: 191
4: 2870
Right 1029741289 7:102493139-102493161 AGCTGAGGGCCTCGGTAGTGAGG 0: 4
1: 0
2: 0
3: 10
4: 119
1029741275_1029741286 6 Left 1029741275 7:102493095-102493117 CCGGCCTCCCTCCTTACCCACCT 0: 4
1: 0
2: 6
3: 191
4: 2870
Right 1029741286 7:102493124-102493146 TGGGCGTCTTCGCGAAGCTGAGG 0: 4
1: 0
2: 0
3: 5
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029741275 Original CRISPR AGGTGGGTAAGGAGGGAGGC CGG (reversed) Exonic
Too many off-targets to display for this crispr