ID: 1029741277

View in Genome Browser
Species Human (GRCh38)
Location 7:102493099-102493121
Sequence TCCAAGGTGGGTAAGGAGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 4, 1: 0, 2: 1, 3: 33, 4: 374}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029741277_1029741286 2 Left 1029741277 7:102493099-102493121 CCTCCCTCCTTACCCACCTTGGA 0: 4
1: 0
2: 1
3: 33
4: 374
Right 1029741286 7:102493124-102493146 TGGGCGTCTTCGCGAAGCTGAGG 0: 4
1: 0
2: 0
3: 5
4: 42
1029741277_1029741287 3 Left 1029741277 7:102493099-102493121 CCTCCCTCCTTACCCACCTTGGA 0: 4
1: 0
2: 1
3: 33
4: 374
Right 1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG 0: 4
1: 0
2: 0
3: 0
4: 36
1029741277_1029741288 9 Left 1029741277 7:102493099-102493121 CCTCCCTCCTTACCCACCTTGGA 0: 4
1: 0
2: 1
3: 33
4: 374
Right 1029741288 7:102493131-102493153 CTTCGCGAAGCTGAGGGCCTCGG 0: 4
1: 0
2: 0
3: 5
4: 117
1029741277_1029741290 18 Left 1029741277 7:102493099-102493121 CCTCCCTCCTTACCCACCTTGGA 0: 4
1: 0
2: 1
3: 33
4: 374
Right 1029741290 7:102493140-102493162 GCTGAGGGCCTCGGTAGTGAGGG 0: 4
1: 0
2: 0
3: 7
4: 146
1029741277_1029741289 17 Left 1029741277 7:102493099-102493121 CCTCCCTCCTTACCCACCTTGGA 0: 4
1: 0
2: 1
3: 33
4: 374
Right 1029741289 7:102493139-102493161 AGCTGAGGGCCTCGGTAGTGAGG 0: 4
1: 0
2: 0
3: 10
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029741277 Original CRISPR TCCAAGGTGGGTAAGGAGGG AGG (reversed) Exonic
900102696 1:968764-968786 TGCAAAGCGGGTAAGGAGGGGGG + Intronic
900650418 1:3727549-3727571 TCCGAGGTGGGTGGGGAAGGTGG + Intronic
901006021 1:6171873-6171895 TGCCAGGTGGGCCAGGAGGGTGG - Intronic
901715589 1:11151121-11151143 TCTAAGGTGGTGTAGGAGGGCGG + Intronic
901931785 1:12600656-12600678 TCCAAGGTGGTTGGTGAGGGGGG - Intronic
902228519 1:15012402-15012424 CCCATGGTGAGTAAGGATGGGGG + Intronic
903252543 1:22066623-22066645 TGAAAGGAGTGTAAGGAGGGAGG + Intronic
903710893 1:25323386-25323408 GACCAGGTGGGTAGGGAGGGAGG - Intronic
904481754 1:30798226-30798248 TACATGGTGGGTAAGGAGGTGGG + Intergenic
904488648 1:30844460-30844482 TCCAGTGTGGGGAAGGAGGCGGG - Intergenic
904867859 1:33596179-33596201 CCCAAGTAGGGTGAGGAGGGAGG - Intronic
905738152 1:40345295-40345317 TCCCTGGAGGCTAAGGAGGGTGG + Intronic
906357213 1:45116864-45116886 TCCAAGATGGGTATGGACAGGGG - Intronic
906683154 1:47744579-47744601 AGGAAGGTGGGTATGGAGGGAGG + Intergenic
908131565 1:61080751-61080773 TCCAAGGATGTTCAGGAGGGAGG + Intronic
909425565 1:75520580-75520602 GGAAAGGTGGGTAAGAAGGGAGG + Intronic
910943973 1:92568265-92568287 ACCAGGGAGGGTAAGGCGGGCGG + Intronic
911178665 1:94842392-94842414 TACAAGGTGGGCATGGTGGGTGG + Intronic
911566319 1:99466710-99466732 TCCAAGGTGAGTGATGATGGTGG + Intergenic
911681329 1:100719424-100719446 TCCAATGTGGGTTAAGGGGGTGG - Intergenic
912372075 1:109181439-109181461 CCCAAGCTGGGAAAGGAGGTTGG + Intronic
913262529 1:117012519-117012541 TCCAAGTTGGGAAAGGGGGCAGG - Intronic
913599022 1:120405090-120405112 TCCAAGGTAGGGAAGGAAAGGGG + Intergenic
914088357 1:144474530-144474552 TCCAAGGTAGGGAAGGAAAGGGG - Intergenic
914310254 1:146459680-146459702 TCCAAGGTAGGGAAGGAAAGGGG + Intergenic
914591854 1:149113459-149113481 TCCAAGGTAGGGAAGGAAAGGGG - Intergenic
914712493 1:150227590-150227612 TCAAAAGAGGGGAAGGAGGGTGG + Intronic
914826211 1:151139563-151139585 TCTAATGTGGGTCAGGTGGGTGG - Intronic
914894532 1:151657280-151657302 TCCCAGGAGGCTAAGGTGGGAGG - Intronic
916179413 1:162070528-162070550 TCCTAGGCGGGTAAGGATGGGGG - Intronic
916586407 1:166153830-166153852 TCTAAGGGGGGTATAGAGGGAGG - Intronic
916756228 1:167772565-167772587 TTCATGGTGGGTTTGGAGGGAGG + Intronic
917724916 1:177819135-177819157 CCCTAGGTGGGTAGGGAGAGGGG + Intergenic
917958337 1:180123140-180123162 TCCAATGTGAGAAGGGAGGGAGG + Intergenic
918852007 1:189704113-189704135 TCCAAAGAGGGTAAGAAAGGTGG + Intergenic
919564007 1:199160964-199160986 TCCAAGGAAGGAAGGGAGGGAGG + Intergenic
920173867 1:204088174-204088196 GCCAAGGTGGGAAGTGAGGGAGG - Intronic
921472702 1:215567639-215567661 TCCCGGCTGGGGAAGGAGGGCGG + Exonic
923622698 1:235591216-235591238 GCCAAGGTGGGTAATGAGCCAGG - Intronic
923873006 1:238016539-238016561 TACAAGATGTGTAAGGAGTGTGG + Intergenic
924261275 1:242234208-242234230 TCAAAGGAGGTGAAGGAGGGAGG + Intronic
1063515415 10:6690188-6690210 TCCAAGGTGTGGAGGGAGGGAGG + Intergenic
1064621595 10:17222954-17222976 CCCAAAGTGGGAAGGGAGGGAGG - Intergenic
1064961826 10:20973687-20973709 TCCATGGTGGTTAAAGAAGGAGG - Intronic
1067902594 10:50257876-50257898 GCCAATGTGAGGAAGGAGGGAGG + Intergenic
1069303009 10:66932008-66932030 TCAAAGGTGTCAAAGGAGGGGGG + Intronic
1070657044 10:78278778-78278800 CCCTAGGGAGGTAAGGAGGGAGG - Intergenic
1070668683 10:78363058-78363080 TCCAGGGTAGGAAAGCAGGGAGG - Intergenic
1071305023 10:84292048-84292070 TCCAACGTGTGTAAGGAGCTGGG - Intergenic
1071307190 10:84309815-84309837 TCCAAGGTTGGTATGGGGGCTGG - Intergenic
1071470389 10:85980111-85980133 TCCCAGGTGGGGAAGGAGGAAGG - Intronic
1072248903 10:93566638-93566660 GCCAAGGCGGGGAAAGAGGGAGG - Intergenic
1073704725 10:105970260-105970282 CCCCAGGTGTGGAAGGAGGGAGG - Intergenic
1074551415 10:114445876-114445898 ACCCAGGTGGGTGAGGTGGGAGG - Intronic
1076108090 10:127840427-127840449 GCCCAGGTCGGTAAGGATGGTGG + Intergenic
1076726182 10:132414501-132414523 TGCAAGATGGGTCAGGAGGAGGG - Intronic
1077231546 11:1460078-1460100 TGCAAGGTGGGGAGGGAAGGGGG + Intronic
1077409414 11:2396487-2396509 TCCGAGGTGGGTAGGGGGTGGGG + Intronic
1077522353 11:3043781-3043803 GCCAAGGGGAGGAAGGAGGGCGG + Intronic
1078086099 11:8233749-8233771 GCCAGGCTGGGGAAGGAGGGAGG - Intronic
1078266195 11:9757991-9758013 CCCAAGGAGGGTCAGGATGGTGG - Intergenic
1078661150 11:13287087-13287109 TCAGAGGTGGGAAGGGAGGGTGG - Intronic
1078800335 11:14637276-14637298 TCCCAGGTGGACAAGGAGGAGGG - Intronic
1079035926 11:17020082-17020104 TCGCAGGTGGGAAAGGAGCGGGG - Intergenic
1079106421 11:17575039-17575061 ACCTTGGTGGGTAAGGTGGGTGG + Intronic
1079127897 11:17731801-17731823 TCCAAAGTGGAAAAGGAGTGAGG + Intergenic
1079248546 11:18771068-18771090 TCCAAGGTCGGTGAGGAGCAAGG + Intronic
1080885442 11:36363548-36363570 TCAAAGGCGGGTCAGGAGGAAGG - Intronic
1081644148 11:44778159-44778181 TCTGAGGTGGGGAAGGAAGGTGG + Intronic
1081739870 11:45431248-45431270 TAAAAGGTGTGTAAGCAGGGAGG - Intergenic
1083429178 11:62605072-62605094 TCCCAGGAGGGAAAGCAGGGAGG - Intronic
1084214330 11:67639395-67639417 TCCAGGGTGGGTGGGCAGGGTGG - Intronic
1084397369 11:68921340-68921362 ACCAAGGTGGCCAAGGTGGGAGG - Intronic
1084470370 11:69355940-69355962 TCCAAGATGGGGAGGGAGGAGGG + Intronic
1084487092 11:69454880-69454902 TCCAAGGCTGGTAAGGGGGCTGG - Intergenic
1084517727 11:69645541-69645563 TCCAGGGTGGGTCCCGAGGGAGG + Intronic
1085401349 11:76237690-76237712 TCCCAGGAGGCTGAGGAGGGTGG + Intergenic
1085836618 11:79963390-79963412 TCCAAGCTGTGTGAGGATGGTGG - Intergenic
1086750990 11:90493412-90493434 TGCAAGTGGGGTAGGGAGGGTGG + Intergenic
1087079353 11:94154960-94154982 TGCAAGGTGGGTGAGGTGGGCGG + Intronic
1087420132 11:97912482-97912504 TCCAAGGTGGGGATAGAAGGAGG + Intergenic
1088256671 11:107909726-107909748 CCTAAGGTGGATAAGGAAGGAGG - Intronic
1089868885 11:121655386-121655408 TCCCAGGTTGGGAAGGAAGGAGG - Intergenic
1090102279 11:123811968-123811990 TACTAGGGGGGAAAGGAGGGAGG - Intergenic
1090435237 11:126681460-126681482 TCCAAGGTTGCTCATGAGGGAGG + Intronic
1090438668 11:126708577-126708599 TCCGGGGTGGGGAAGGAAGGAGG + Intronic
1090470914 11:126980368-126980390 TCAAAGCTGGGTAAGGATGGAGG + Intronic
1090636399 11:128692937-128692959 TCCAGGCTGGGTAGGGAGGACGG + Intronic
1090805137 11:130197974-130197996 GGCAGGGTGGGGAAGGAGGGTGG - Intronic
1090865713 11:130698847-130698869 TCCAAGGTGGATAAGATGGCTGG - Intronic
1090922788 11:131221627-131221649 ACCAAGCTGGGTCAGGATGGGGG + Intergenic
1091380047 12:51901-51923 TCCAAGGTGAGGGAGGAGAGAGG - Intergenic
1092256452 12:6928617-6928639 GGGAAGGTGGGGAAGGAGGGAGG + Intronic
1094511841 12:31101811-31101833 TCTAAGGAAGGAAAGGAGGGAGG - Exonic
1095818077 12:46446716-46446738 TGAAAGGAGGGGAAGGAGGGAGG + Intergenic
1095940334 12:47722821-47722843 TCCAAGGTGGGCAGGAAGGCAGG + Intronic
1096526952 12:52215738-52215760 GCCCAGGTGGGAGAGGAGGGAGG + Intergenic
1097247471 12:57614468-57614490 AGCAGGGTGGGCAAGGAGGGAGG - Intronic
1097507127 12:60487993-60488015 TCCAAGCTGGGGATTGAGGGTGG - Intergenic
1100986111 12:100203151-100203173 ACCAGGGTGGGGAAGGAGGGTGG - Intronic
1101307682 12:103545813-103545835 TCCAAGGTGGGTACTGTGAGTGG - Intergenic
1103183531 12:118936094-118936116 GCCAAGGTGGGGAAGGAGCGAGG - Intergenic
1103972856 12:124682874-124682896 AACAAGGTTGGTAAGGAGGGTGG - Intergenic
1104008916 12:124915139-124915161 GCCAGGGCGGGTCAGGAGGGAGG - Exonic
1104647384 12:130506883-130506905 TCCATGATGGAGAAGGAGGGAGG - Intronic
1104666169 12:130649114-130649136 TCGGAGGTGGGTATGGAGGTGGG + Intronic
1104982648 12:132581191-132581213 CCCAAGGGGGGCAGGGAGGGAGG - Intronic
1105038067 12:132940887-132940909 TCAAACGTGGGGAGGGAGGGAGG - Intronic
1105323697 13:19351322-19351344 TTCCAGGTGGGAATGGAGGGAGG + Intergenic
1105870256 13:24498213-24498235 TTCCAGGTGGGAATGGAGGGAGG - Exonic
1107802932 13:44127132-44127154 TCCAAGGAGGGAAAGAAGGCAGG + Intergenic
1109785016 13:67162021-67162043 TCCAAGGTCGTTTAGGAAGGCGG - Intronic
1110066245 13:71110036-71110058 TCCAATCTTGGTAAGGAGGAGGG + Intergenic
1110734582 13:78921042-78921064 CCTAAGGTGGCTAAGGTGGGAGG + Intergenic
1113604278 13:111594557-111594579 TCCAACGTGGGTGGGCAGGGGGG - Intronic
1113723008 13:112574933-112574955 GCCCAGGTGGGGAGGGAGGGAGG + Intronic
1114236841 14:20831480-20831502 TCCAAGTCTGGTAAGGATGGAGG + Intergenic
1115111618 14:29830280-29830302 TAGAGGGTGGGGAAGGAGGGAGG - Intronic
1115748981 14:36468818-36468840 TCCAACATGGGTAATCAGGGTGG + Intergenic
1117479234 14:56126625-56126647 CACAAGATGGGAAAGGAGGGGGG - Intronic
1118616586 14:67578248-67578270 TGCCAGGTGGGAAAGGTGGGAGG + Intronic
1119551343 14:75516169-75516191 CCAAAGGAGGGGAAGGAGGGAGG - Intergenic
1122494132 14:102139918-102139940 TCCAAGATGGCGACGGAGGGAGG + Exonic
1122916982 14:104864008-104864030 TGCAAGGTTGGGGAGGAGGGAGG - Intergenic
1123799735 15:23807448-23807470 TACAAGGAGGGGAAGGAGAGAGG + Intergenic
1125730115 15:41888252-41888274 TCCACGGTGGGCAAGGATTGGGG + Intronic
1126729597 15:51669421-51669443 TCCACAGAGGGTAAAGAGGGAGG - Intergenic
1127121702 15:55777513-55777535 TCTAAGGTGGCAAAGGATGGTGG + Intergenic
1128146685 15:65335905-65335927 GCCACCGTGGGTGAGGAGGGTGG - Exonic
1128746262 15:70116635-70116657 GCCATGGTGGGTGAGGAGGCTGG + Intergenic
1129721240 15:77879195-77879217 TACAAGGTGGGAAACGAGGAAGG + Intergenic
1129770674 15:78201449-78201471 TGCAAGATGGGAAAGGAGGCTGG - Intronic
1129857874 15:78837871-78837893 TCCACGGAGGGGAAGGAGCGAGG - Intronic
1129874598 15:78965359-78965381 TCTAATGTGGCTAAAGAGGGGGG - Intronic
1132550959 16:553672-553694 TTCAGGGAGGGGAAGGAGGGGGG - Exonic
1132884538 16:2176820-2176842 TCTAGGGTGGGGATGGAGGGTGG - Exonic
1132977954 16:2719917-2719939 TCCAAAGTGGGGAGGCAGGGTGG - Intronic
1134459693 16:14420644-14420666 ACCCAGGAGGGTGAGGAGGGAGG - Intergenic
1136065759 16:27757286-27757308 ACCATGGTGGGTAGGGCGGGAGG + Intronic
1137549522 16:49427759-49427781 AGAAAGATGGGTAAGGAGGGTGG - Intergenic
1138575243 16:57903556-57903578 TTCAAGGTGGGTAAAGTGAGGGG + Intronic
1138863919 16:60793700-60793722 TCCTAGATGAGAAAGGAGGGGGG - Intergenic
1140479215 16:75253455-75253477 TCCTAGTTGGCCAAGGAGGGCGG + Intronic
1140499245 16:75418892-75418914 GCCAAGGTGGGTGAGTATGGGGG + Intronic
1141444767 16:84050766-84050788 CCCCATGTGGGTAAGGAGAGCGG + Intergenic
1141445036 16:84052185-84052207 CCCCATGTGGGTAAGGAGAGCGG + Intergenic
1142261555 16:89044841-89044863 TCCAAGGTGAGGGAAGAGGGGGG + Intergenic
1142574952 17:900555-900577 CCCAGGGTGGGAAGGGAGGGTGG + Intronic
1144784721 17:17825226-17825248 GCCAAGATGGGTAAGGGGAGGGG - Intronic
1145279741 17:21458420-21458442 TCCAAGGGAGGTGAGGAGAGGGG + Intergenic
1145398142 17:22512062-22512084 TCCAAGGAAGGTGAGGAGAGGGG - Intergenic
1146255208 17:31388368-31388390 GTCAAGGTGGGCAAGGAGTGGGG + Intergenic
1146666582 17:34709060-34709082 TCCAGAGTGGGTGAGGAAGGAGG + Intergenic
1146814631 17:35932491-35932513 TCCAAGATGATTAAGGAGCGTGG - Intergenic
1147226923 17:38986363-38986385 TCCAAGGAGAGAAAGAAGGGAGG - Intergenic
1147309435 17:39586108-39586130 TCCCAGGAGGCTAAGGCGGGAGG - Intergenic
1147335816 17:39726545-39726567 TCCAACCTGGGGCAGGAGGGAGG - Exonic
1147671694 17:42180366-42180388 TCTAAGGTGGGTGAGGCAGGAGG - Intronic
1151578899 17:74966834-74966856 TCTAAGGAGGCTAAGGTGGGAGG + Intronic
1151803668 17:76392112-76392134 TCCTAGGTAGGGAGGGAGGGAGG + Exonic
1151966543 17:77434501-77434523 TACCAGGTGGCTAAGCAGGGTGG + Intronic
1152392829 17:80012968-80012990 TCTTAGGTGGGTAAGGACGCTGG - Intronic
1152648682 17:81482036-81482058 TCCAAGGTGGGGCTGGATGGGGG + Intergenic
1153030482 18:709048-709070 TCCAACATGGGTCAGGAGGGAGG + Intronic
1153294554 18:3533221-3533243 TCCAACTTGGGTGAGGAGTGAGG + Intronic
1153700788 18:7691856-7691878 TCCCAGGAGGTTAAGGAGGTGGG + Intronic
1153700798 18:7691891-7691913 TCCCAGGAGGTTAAGGAGGTGGG + Intronic
1153700808 18:7691926-7691948 TCCCAGGAGGTTAAGGAGGTGGG + Intronic
1153866755 18:9277210-9277232 CCCCAGGTGGCTAAGGTGGGAGG + Intronic
1154347137 18:13551618-13551640 GCCATGGTGGGGTAGGAGGGCGG + Intronic
1155167269 18:23241285-23241307 GCCGAGGTGGGTAAGGTGGGGGG + Intronic
1155716148 18:28946103-28946125 TCCAAAGTGGGTAAAGAGCTTGG + Intergenic
1156850982 18:41725954-41725976 TCAATGGTGGGGAGGGAGGGAGG + Intergenic
1157499555 18:48180052-48180074 TGCAAGGAAGGTACGGAGGGAGG - Intronic
1157528193 18:48401060-48401082 TTCAAGGTAGGGAAGGAGGGAGG + Intronic
1157640380 18:49206853-49206875 ACCCAAGTGGGTAAGGAAGGAGG + Intronic
1158238601 18:55350190-55350212 TCCAATGTGGGTCAGGTGGCTGG + Intronic
1161637340 19:5397132-5397154 TCCAAGGTTGGGGAGGAAGGAGG - Intergenic
1162130538 19:8523449-8523471 TAAAAGGAGGCTAAGGAGGGAGG - Intronic
1162345451 19:10115667-10115689 TCCAAGGTGGGCAGGCAGGCAGG - Exonic
1162766782 19:12924626-12924648 ACCAAGCTGGGTGAGCAGGGGGG - Exonic
1162968451 19:14166645-14166667 TCCAGGGCGGGTGGGGAGGGAGG - Intronic
1163315077 19:16535955-16535977 GCCTAGGTGGGTGAGGAGGTGGG - Intronic
1163653396 19:18531922-18531944 GCCCAGCGGGGTAAGGAGGGTGG + Exonic
1163689704 19:18731902-18731924 TGCAGGGTGGGTGAGGAGAGGGG - Intronic
1165038983 19:33055442-33055464 TCCCAGGTGGAGAGGGAGGGAGG - Intronic
1165386401 19:35512895-35512917 TCCAGGGTGGCATAGGAGGGGGG + Intronic
1167587156 19:50381699-50381721 GCCCAGGTGGGAAGGGAGGGTGG + Intronic
1168201327 19:54817778-54817800 TCCAAGATGGGTGTGCAGGGAGG + Intronic
1168378887 19:55903726-55903748 TTCGAGGTGGTTTAGGAGGGAGG - Intronic
925408792 2:3626926-3626948 TCCAGGGAGGGTGTGGAGGGTGG - Intronic
925503074 2:4528711-4528733 CCCAGGGTGGGTGAGGCGGGTGG + Intergenic
926872407 2:17437007-17437029 TCCAAGGAGGGAGAGGAGAGTGG + Intergenic
927505146 2:23608029-23608051 CCCAAGATGAGGAAGGAGGGAGG + Intronic
927790035 2:26002627-26002649 TCTAAGGTGTGTCAGCAGGGTGG + Intergenic
927863123 2:26572798-26572820 TCCGAGGAGGAGAAGGAGGGAGG + Intronic
928057847 2:28076163-28076185 TACAAGGGGGCTAAGGTGGGAGG + Intronic
929983327 2:46700010-46700032 ACCAAGGTGGGTAAGGGATGCGG + Intronic
931046370 2:58358383-58358405 TTCAAGGTGGGTGTGGAGGATGG - Intergenic
931421109 2:62128608-62128630 TGCAAGGAAGGGAAGGAGGGAGG - Intronic
933119640 2:78520966-78520988 TCCAGGGAGGGTAAGGAGATGGG + Intergenic
933685131 2:85135465-85135487 TCGACGGTGGGTAAGGGGGCAGG + Intronic
935975585 2:108575210-108575232 TCCAAGGTTGGGGAGGATGGAGG + Intronic
938383196 2:130848079-130848101 GCCCAGGTGGGCAGGGAGGGTGG + Intronic
939642328 2:144655434-144655456 TGGGAGGTGGGTAGGGAGGGTGG + Intergenic
940473926 2:154135717-154135739 CTCAAGGAGGCTAAGGAGGGAGG + Intronic
941113984 2:161450689-161450711 TTAAAGGTGGGAAAGGAGGCCGG - Intronic
941510144 2:166397301-166397323 TCCAAAGTGAGGAAGGTGGGAGG - Intergenic
941835751 2:170018438-170018460 TCCCTGGTGGGTAAGGAGGAGGG - Intronic
942424268 2:175842610-175842632 GCCAAGGTGGGTAAGGCAGGTGG - Intergenic
942788474 2:179730524-179730546 TCCAAGCTAGCTAAGGATGGAGG - Intronic
942826588 2:180184877-180184899 GCGAAGTTTGGTAAGGAGGGAGG + Intergenic
944290605 2:198000153-198000175 GCCAGGGTAGTTAAGGAGGGAGG + Intronic
944518108 2:200532567-200532589 TCCAAGGTGGGGAAGGGGGTTGG - Intronic
944669547 2:201983761-201983783 TGCAAGGTGGGTTTTGAGGGAGG + Intergenic
944688417 2:202137911-202137933 GCCAAAGTGGGGATGGAGGGAGG - Intronic
945080398 2:206082389-206082411 TGCAAGGAGGGAAAAGAGGGAGG + Intronic
945927241 2:215818215-215818237 TGCAAGGTAGGTGAGGAGGAGGG + Intergenic
946090709 2:217220526-217220548 AGCAGGGTGGGAAAGGAGGGAGG - Intergenic
946148233 2:217747000-217747022 TCCAGGGTGGGTGAGGTGGGAGG - Intronic
947740619 2:232483234-232483256 TCCTTGGTGGGTAGGGTGGGGGG - Intronic
947913004 2:233813854-233813876 TCAAAGGTGGTTCAGGAAGGTGG - Intronic
948736397 2:240009140-240009162 TCTAAGGTGGGTGAGGAGCTGGG - Intronic
948826116 2:240574132-240574154 GCCACGATGGGGAAGGAGGGTGG - Exonic
948925626 2:241095067-241095089 CCCAAGGTGGGTGTGGGGGGGGG - Exonic
1168932163 20:1632662-1632684 TCCAAGGTGGGAGAGGAAGAAGG + Intronic
1172303515 20:33865746-33865768 CCCAAGGTGGGTAAAGCGTGAGG - Intergenic
1172483521 20:35285374-35285396 TCCAGGGTGGGCAAGGATGTGGG + Intergenic
1172550121 20:35792563-35792585 GACAAGGTAGGGAAGGAGGGAGG - Intronic
1172775767 20:37405884-37405906 TCGGTGGTGGGGAAGGAGGGAGG - Exonic
1173463594 20:43263364-43263386 TGCAAAGTGGGGAGGGAGGGAGG - Intergenic
1173466931 20:43290612-43290634 TCCATAGTAAGTAAGGAGGGGGG + Intergenic
1175194211 20:57231082-57231104 TCCAGGGTGGGAAAGGGGGTTGG - Intronic
1175657921 20:60788003-60788025 TCAGACGTGGGTCAGGAGGGAGG - Intergenic
1175974721 20:62704819-62704841 TCGCAGGCGGGCAAGGAGGGCGG - Intergenic
1180342205 22:11628244-11628266 TCCGCGGTGGGGACGGAGGGCGG + Intergenic
1181491186 22:23261871-23261893 GCCAAGGTTGGAAAGGAAGGAGG - Intronic
1181685514 22:24525196-24525218 TCCACCTTGGGAAAGGAGGGAGG + Intronic
1182025687 22:27116705-27116727 TCAAAGGTAGGAAAGGAGGAAGG + Intergenic
1182825349 22:33260194-33260216 GCCAGGGTGGGTCAGGAGGCAGG - Intronic
1183094836 22:35545831-35545853 GCTAAGGTAGGAAAGGAGGGAGG + Intronic
1183644739 22:39118219-39118241 TGTAAGGTGGGTAGGGCGGGAGG - Intergenic
1183913662 22:41098893-41098915 TGTAAGGTGGGTAAGTAAGGTGG - Intronic
1184109306 22:42385587-42385609 GCCAGGGTGGGGAGGGAGGGAGG - Intronic
1184183647 22:42848957-42848979 TCCAAGGTGGGGAGGGAGAGAGG - Intronic
1184387870 22:44186550-44186572 TCAAAGGTGGGAAAGGTGGATGG - Intronic
1184814842 22:46861652-46861674 TCCCAGGAGGGGGAGGAGGGCGG + Intronic
1184944592 22:47794118-47794140 GCCAAGGTGTGAAGGGAGGGAGG - Intergenic
1185394745 22:50581207-50581229 GCCGAGGTGGGTGAGGTGGGAGG - Intronic
949963421 3:9334467-9334489 TCCAACCAGGGTATGGAGGGAGG + Intronic
950023694 3:9806651-9806673 CCCCAGGTGGGGAGGGAGGGAGG + Intronic
950439907 3:13004530-13004552 TCCAAGGAGAGGGAGGAGGGAGG - Intronic
950646522 3:14380514-14380536 TCCTAGGAGGCTAAGGCGGGAGG + Intergenic
951711884 3:25591827-25591849 TCCAGCGTGGATAAGGAGGAAGG - Intronic
952728802 3:36618126-36618148 TCCAAGGTAGGGAAGGAAAGGGG - Intergenic
953606307 3:44415351-44415373 TCCAGGGTGGGCACAGAGGGGGG + Intergenic
954445199 3:50542575-50542597 TCCAAGGAGGGGATGGAGTGAGG + Intergenic
955393498 3:58537810-58537832 TCCAAGGTGGTTATGCAGGGAGG - Intergenic
956978069 3:74605128-74605150 TACCAGGGGGGTGAGGAGGGAGG + Intergenic
957368313 3:79255868-79255890 TCAAAGCTGGGTCAGGATGGAGG + Intronic
957723138 3:84031060-84031082 TTCAAAGTGGGTCAGGATGGGGG + Intergenic
959717549 3:109449781-109449803 GCCAAGGCGGGCAAGGCGGGTGG - Intergenic
961505893 3:127370292-127370314 GCGAAGGTGGGTTTGGAGGGTGG - Intergenic
962260357 3:133898257-133898279 TCCAAGTTGGGGAGGGAGGAAGG - Intergenic
962884424 3:139611018-139611040 TCCAAAGTTGGTGAGGATGGGGG + Intronic
965871993 3:173275561-173275583 TCCAAGGAGGATAAAGAGGTAGG - Intergenic
968356017 3:198108046-198108068 GCCAAACTGGGGAAGGAGGGAGG + Intergenic
968504721 4:966558-966580 TCCAAGGTGGGCGAGGAGCCGGG - Intronic
968673407 4:1864298-1864320 TCCAAGGAGGGGAGGGAAGGAGG - Intergenic
969175956 4:5399299-5399321 GCAGAGGTGGGGAAGGAGGGTGG - Intronic
969391174 4:6892250-6892272 GGCAGGGTGGGCAAGGAGGGAGG + Intergenic
969637916 4:8380049-8380071 CCCAAGGTGGGTAAACAAGGCGG + Intronic
971060667 4:22965237-22965259 GTCAAGGTGGGCAAGGAGAGGGG + Intergenic
972445137 4:39136566-39136588 TCCAAGCAGGGTGAAGAGGGTGG + Intergenic
972769294 4:42181514-42181536 TCCAGGGTGCGGAAGGAAGGTGG + Intergenic
972990791 4:44820770-44820792 TCAAAGGTGGGGAATAAGGGAGG - Intergenic
974377996 4:61102497-61102519 GCCAAGGTTGATAAGGAGGCTGG - Intergenic
975169374 4:71215511-71215533 TCCCAGGTTCATAAGGAGGGTGG + Intronic
977902614 4:102439517-102439539 GACAAAGAGGGTAAGGAGGGAGG + Intergenic
979282737 4:118885714-118885736 GACAAGGTGGGCAAGGTGGGTGG - Intronic
985933478 5:3077709-3077731 TACAGAGTGGGAAAGGAGGGAGG + Intergenic
986272516 5:6246160-6246182 TCAAAGGTGAGTTAGGATGGGGG + Intergenic
988434003 5:31152085-31152107 TCCAAGGTAGGCAAGAAGAGTGG - Intergenic
988490860 5:31704119-31704141 ACCAAGGAGGCTAAGGAGGGAGG - Intronic
988797715 5:34667344-34667366 TCCAGGGAGGCTAAGGTGGGAGG - Intronic
988932581 5:36051112-36051134 TCCAGCTTGGGTGAGGAGGGAGG + Intronic
989007262 5:36828710-36828732 TCCAAGGATGGTAAGGACAGAGG - Intergenic
989379219 5:40797755-40797777 TCCCAGGTGGGGCAGGCGGGCGG - Intronic
990762333 5:59143221-59143243 TCCAAGATGAGAAGGGAGGGAGG - Intronic
992953384 5:81883157-81883179 CCCAAGGAGGGTAAGGAGGTCGG + Intergenic
993270224 5:85786878-85786900 TCCATGGTGTATATGGAGGGAGG + Intergenic
993745392 5:91591151-91591173 TGCAAGGTGTGTAAGGAGAATGG - Intergenic
994712590 5:103283515-103283537 TGCAAGGTGGGTAGGAGGGGTGG + Intergenic
996747664 5:126858821-126858843 TCCCTGGTGGGTCAGCAGGGAGG - Intergenic
997119046 5:131155624-131155646 TTCAATGTGGGTCAGGAGTGTGG + Intergenic
1000097805 5:157986589-157986611 GCCAAGGTGGGAGAGGAGGCGGG - Intergenic
1001051149 5:168415477-168415499 TGCAATGTGGGTGAGGAGGTTGG - Intronic
1001359396 5:171065798-171065820 TGAAAGGTGGGAAAGGAGGCAGG - Intronic
1002170107 5:177370164-177370186 TCAAAGGTGGGTGGTGAGGGAGG + Intronic
1002213031 5:177609546-177609568 TTCAAGGTGGACAGGGAGGGAGG + Exonic
1002490031 5:179569230-179569252 TTCAGGGTGGGGAAGGAGTGGGG + Intronic
1003170376 6:3717093-3717115 TCAGATGTGGGTTAGGAGGGAGG - Intergenic
1003200860 6:3958946-3958968 TCCAAGTTAGCTAAGGAGGTAGG - Intergenic
1005844538 6:29767188-29767210 TCCAAAATGGATGAGGAGGGAGG - Intergenic
1005856655 6:29867990-29868012 TTCAAAATGGGTGAGGAGGGAGG - Intergenic
1007341300 6:41192944-41192966 CCCAACGTGGGTTAGGATGGGGG - Intronic
1007357962 6:41334628-41334650 CCCAAGGTGGGAAAGCAGGCTGG - Intergenic
1008465195 6:51822346-51822368 TCCAAGGAGGACAAGGAGGATGG - Intronic
1008627079 6:53327196-53327218 TCCAGCCTGAGTAAGGAGGGTGG - Intronic
1008660781 6:53665588-53665610 CCCAAGGAGGGTAAGGAGCTGGG - Exonic
1011109332 6:83819932-83819954 GCCAAGCTGGGTAGGGAGTGTGG + Intergenic
1011630108 6:89315024-89315046 TCATAGGTGGGAAAGGAGGGAGG - Intronic
1015731946 6:136357972-136357994 TCTAAGGTGGGTATGCAGGCAGG - Intronic
1016456327 6:144234687-144234709 TCCAGGGTGGGGAAGGGGGCTGG + Intergenic
1017638018 6:156462491-156462513 TCCAAGATGGGTAAGGAGGTGGG - Intergenic
1017963927 6:159247227-159247249 TCCAAGGAGGGTGGGGAGGGAGG - Intronic
1018215155 6:161519175-161519197 TCCAAGCTGGGGAAGTAGGGAGG + Intronic
1018281192 6:162187490-162187512 TTCAAGGTGGGGAAGGACGGAGG + Intronic
1019336486 7:485300-485322 TCAAAGGTGGGAAGGGAGGGTGG - Intergenic
1020262321 7:6537143-6537165 TCCAAGCTGGGCAGGCAGGGAGG + Intronic
1022441026 7:30433426-30433448 GCAAAGGTGGGGAGGGAGGGTGG - Intronic
1022532558 7:31076164-31076186 TCCAAGGTGGGCAGGGTGGGCGG + Intronic
1023830943 7:44038790-44038812 TCCAAGGTGGGTAAGGAGGGAGG - Intergenic
1023836987 7:44074168-44074190 CCCAAGGAGGGTCAGGAGGCGGG - Intronic
1024257060 7:47547147-47547169 TCCAGGGTGAGGAGGGAGGGAGG + Intronic
1026971645 7:74472254-74472276 TCCAAGGAAGGGAAAGAGGGGGG - Intronic
1027167799 7:75847966-75847988 GCCATGGTGGGAATGGAGGGAGG + Intronic
1028672658 7:93421160-93421182 TCCAAGGTTGGTAACCAGAGAGG + Intergenic
1028985470 7:97005654-97005676 TCCAAGGGGGGAAAGCAGGCGGG + Exonic
1029278903 7:99424415-99424437 TCCAATGGGGGTTAGGTGGGAGG + Intronic
1029416171 7:100444628-100444650 TCAAAGGTGGGGAGGGAGGAAGG - Intergenic
1029741277 7:102493099-102493121 TCCAAGGTGGGTAAGGAGGGAGG - Exonic
1029759267 7:102592268-102592290 TCCAAGGTGGGTAAGGAGGGAGG - Exonic
1029776636 7:102688178-102688200 TCCAAGGTGGGTAAGGAGGGAGG - Intergenic
1030393368 7:108954633-108954655 TCCAGGGAGGGTTATGAGGGTGG - Intergenic
1032415303 7:131730985-131731007 ATCAAGGTGGATATGGAGGGAGG - Intergenic
1032770734 7:135052570-135052592 TCCAAGATGGGGGAGGAAGGTGG - Intronic
1033160740 7:138994133-138994155 TCCAGGGTGGGTGAAGGGGGAGG - Intergenic
1033642941 7:143279809-143279831 TCCAAAATGTGTAAGGAAGGTGG - Intergenic
1034300816 7:150013851-150013873 TCAGAGGTGGGTAGGGAGGATGG + Intergenic
1034337563 7:150333325-150333347 TCCAAGTGGGGTAAGGGGAGTGG + Intronic
1034481161 7:151321185-151321207 GCCAAGGTGGGGATTGAGGGAGG + Intergenic
1034805235 7:154083449-154083471 TCAGAGGTGGGTAGGGAGGATGG - Intronic
1035049262 7:155989262-155989284 GCCAGGGTGGGTGGGGAGGGGGG - Intergenic
1035280609 7:157776008-157776030 TCGGAGGTGGGCAAGGAGTGAGG + Intronic
1035413836 7:158667516-158667538 CACAGGGTAGGTAAGGAGGGCGG - Intronic
1035413866 7:158667602-158667624 CACAGGGTAGGTAAGGAGGGCGG - Intronic
1035413904 7:158667716-158667738 CACAGGGTAGGTAAGGAGGGCGG - Intronic
1035414066 7:158668179-158668201 CCCAGGGTCGGTAAGGAAGGCGG - Intronic
1037454793 8:19052660-19052682 TCCAAGTTGGGAAAGGAGTTCGG + Intronic
1037666779 8:20976559-20976581 TCTCAAGTGGGTAGGGAGGGAGG - Intergenic
1038448105 8:27617928-27617950 TCCAAGGGGAGCAGGGAGGGAGG + Intergenic
1038574833 8:28696023-28696045 ACTTAGGTGGGTAAGGTGGGAGG - Intronic
1038716141 8:29992956-29992978 TCCCAGGAGGCTGAGGAGGGAGG - Intergenic
1038977098 8:32711717-32711739 TTCAAGGTAGGTCACGAGGGAGG - Intronic
1039068765 8:33631954-33631976 CCCACGGTGGGTATGGGGGGAGG - Intergenic
1041833991 8:62191508-62191530 TGCAAGTTGGCTAGGGAGGGAGG - Intergenic
1042844796 8:73159059-73159081 TCCGAGGTGGGTGAGGGAGGTGG + Intergenic
1042852019 8:73226052-73226074 GCCAAGGTGGGGGAGCAGGGAGG + Intergenic
1045343036 8:101271144-101271166 GACAAGGTGGGTCAGGATGGTGG + Intergenic
1047424439 8:124732383-124732405 CAGAAGGTGGGTCAGGAGGGAGG + Intergenic
1049317324 8:141976274-141976296 TTCAGGCTGTGTAAGGAGGGGGG - Intergenic
1049532601 8:143161926-143161948 TCCAGGGTGGGGAAGGAGGCTGG + Intergenic
1049613250 8:143565525-143565547 TGCAAGGTGAGCAAGGAGGCCGG + Intergenic
1049707403 8:144049255-144049277 TGCAGGGTGGCTGAGGAGGGCGG + Intergenic
1049824988 8:144662477-144662499 TCCAAGGTGGATAATGGGGAGGG - Intergenic
1049825013 8:144662568-144662590 TCCAAGGTGGATAAGTGGGAGGG - Intergenic
1049825077 8:144662784-144662806 CCCAAGGTGGATAAGGGGGAGGG - Intergenic
1049825120 8:144662909-144662931 TCCAAGGTGGATAATGGGGGTGG - Intergenic
1051588787 9:18754675-18754697 TCCAAGATGGGCAAGGAGCAAGG - Intronic
1052807481 9:33025595-33025617 CCCAGGCTGGGGAAGGAGGGAGG - Intronic
1053129499 9:35606978-35607000 TCCAAGGTAGGCTAGCAGGGTGG + Exonic
1054128182 9:61334613-61334635 TCCATGCTGGGTAAGTGGGGAGG + Intergenic
1055455554 9:76468235-76468257 TCTAAGGTGGATAAGGAGGCAGG + Intronic
1056112250 9:83407497-83407519 TCCAAGGAGGGTAGGGATTGTGG - Intronic
1056689863 9:88798753-88798775 CCCAAGGTGGGTGGTGAGGGGGG + Intergenic
1056771668 9:89482015-89482037 TCCAAGAGGGGAAAGGAGGCAGG + Intronic
1057613415 9:96567092-96567114 TCCCAGCTGGGGAAGGAAGGCGG - Intronic
1058504403 9:105653736-105653758 TTGGAGGTGGGTAAGGTGGGTGG + Intergenic
1059015087 9:110506737-110506759 TCCAAGCAGGGGAAGGAGGGAGG + Intronic
1059312225 9:113396504-113396526 GCAAAGGTGGGGAAGGAGGATGG + Intronic
1059956686 9:119523271-119523293 TCCTAGGGTGGTCAGGAGGGAGG + Exonic
1060723038 9:125990762-125990784 TCCAGGGTGGATCAAGAGGGAGG - Intergenic
1061398514 9:130356066-130356088 CCTAAGGTGAGTAGGGAGGGGGG - Intronic
1061725344 9:132579435-132579457 CCAAAGGTGGGAAAGTAGGGTGG + Intergenic
1062431820 9:136529762-136529784 TCCAAGATGGGGAAGGAAGCCGG - Intronic
1062474464 9:136720356-136720378 TCCAGGGTTGGGGAGGAGGGAGG - Intronic
1062523749 9:136970070-136970092 TCCAGGATGGGGAAGGAGGAAGG + Intronic
1062725936 9:138073599-138073621 TTCAAGGTGGGCCAGGCGGGGGG + Exonic
1185722333 X:2392044-2392066 TGCAAGGTGAGGAAGGAGGAGGG + Intronic
1186546749 X:10457894-10457916 TCCAAGGTAGGTTAGGAGCAGGG - Intronic
1188200742 X:27291273-27291295 GCCAAGGTAGGTAAGGAATGGGG + Intergenic
1189129812 X:38485893-38485915 TCCCAAGTGGGAAAGGAGGGTGG - Intronic
1189246944 X:39570575-39570597 TCCAAAGTGGGTCAGGAGCTGGG - Intergenic
1189277449 X:39797308-39797330 TGCTAGGTGGGTAGGCAGGGAGG - Intergenic
1189437501 X:41006067-41006089 ACCAAGGAGGCTAAGGTGGGAGG - Intergenic
1189485785 X:41430650-41430672 TCCCTGGTGGGAATGGAGGGTGG - Intergenic
1190258972 X:48786383-48786405 CCCAGGGTGGGCAGGGAGGGTGG + Intergenic
1190439835 X:50466236-50466258 TCAAAGCTTGGCAAGGAGGGGGG + Intronic
1191616316 X:63174097-63174119 TCCAAGGTGACTAAGAAGCGGGG + Intergenic
1191619981 X:63204826-63204848 TCCAAGGTGACTAAGAAGCGGGG - Intergenic
1191947670 X:66553629-66553651 CCCATGGTGGGTGAGCAGGGTGG + Intergenic
1192165707 X:68826549-68826571 GCCAGGGTGGGTCAGGAGGTGGG + Intergenic
1193600822 X:83507266-83507288 TGCAGGGCGGGTGAGGAGGGTGG + Intergenic
1193717775 X:84952009-84952031 TCAAAGGTGGGGAATAAGGGAGG + Intergenic
1195107699 X:101616694-101616716 TCCAGGGTGAGTAAGGATGGAGG + Exonic
1195286005 X:103384906-103384928 TCCAAGGAGGGCAAGGAAGCTGG - Intergenic
1195664935 X:107420540-107420562 CCCAAGGAGGCTAAGCAGGGTGG - Intergenic
1195927251 X:110038405-110038427 GCCAAAGTGGGCATGGAGGGTGG - Intronic
1198379359 X:136069577-136069599 ACCAAGGAGGCTAAGGTGGGAGG + Intergenic
1199361336 X:146922604-146922626 TGCAGGGTGGGTCAGGAGGCTGG + Intergenic
1201556654 Y:15270063-15270085 TCAAAGGTGGGGAATAAGGGAGG + Intergenic