ID: 1029741278

View in Genome Browser
Species Human (GRCh38)
Location 7:102493102-102493124
Sequence AGCTCCAAGGTGGGTAAGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 4, 1: 0, 2: 3, 3: 15, 4: 236}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029741278_1029741290 15 Left 1029741278 7:102493102-102493124 CCCTCCTTACCCACCTTGGAGCT 0: 4
1: 0
2: 3
3: 15
4: 236
Right 1029741290 7:102493140-102493162 GCTGAGGGCCTCGGTAGTGAGGG 0: 4
1: 0
2: 0
3: 7
4: 146
1029741278_1029741286 -1 Left 1029741278 7:102493102-102493124 CCCTCCTTACCCACCTTGGAGCT 0: 4
1: 0
2: 3
3: 15
4: 236
Right 1029741286 7:102493124-102493146 TGGGCGTCTTCGCGAAGCTGAGG 0: 4
1: 0
2: 0
3: 5
4: 42
1029741278_1029741287 0 Left 1029741278 7:102493102-102493124 CCCTCCTTACCCACCTTGGAGCT 0: 4
1: 0
2: 3
3: 15
4: 236
Right 1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG 0: 4
1: 0
2: 0
3: 0
4: 36
1029741278_1029741289 14 Left 1029741278 7:102493102-102493124 CCCTCCTTACCCACCTTGGAGCT 0: 4
1: 0
2: 3
3: 15
4: 236
Right 1029741289 7:102493139-102493161 AGCTGAGGGCCTCGGTAGTGAGG 0: 4
1: 0
2: 0
3: 10
4: 119
1029741278_1029741288 6 Left 1029741278 7:102493102-102493124 CCCTCCTTACCCACCTTGGAGCT 0: 4
1: 0
2: 3
3: 15
4: 236
Right 1029741288 7:102493131-102493153 CTTCGCGAAGCTGAGGGCCTCGG 0: 4
1: 0
2: 0
3: 5
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029741278 Original CRISPR AGCTCCAAGGTGGGTAAGGA GGG (reversed) Exonic
900102693 1:968761-968783 AGCTGCAAAGCGGGTAAGGAGGG + Intronic
900497092 1:2980691-2980713 AGCTCCAAGGGAGGGAAGGGGGG + Intergenic
900824386 1:4914321-4914343 AGGTCAAAGGTGAGGAAGGAGGG + Intergenic
901849431 1:12006312-12006334 AGCTGCCAGGCGGGTCAGGATGG + Intronic
903080377 1:20806247-20806269 AGCTACTTTGTGGGTAAGGAGGG - Intergenic
903886220 1:26542604-26542626 AGCCCCAGGATGGGTAAGGCGGG - Intronic
904012279 1:27396696-27396718 AGCTCCAGGCTTGGGAAGGAAGG - Intergenic
904453908 1:30635554-30635576 TGATCCATGCTGGGTAAGGACGG + Intergenic
905205917 1:36342799-36342821 AGCTCCAAGGTGGGCCAGGGAGG + Intronic
905725247 1:40245819-40245841 ACCTCCAAGCTGGGGGAGGAGGG + Intergenic
906694612 1:47815577-47815599 AGCTTCCAGGTGGGGCAGGATGG - Intronic
907747865 1:57232969-57232991 ACCTTCAAGGAGGGAAAGGAAGG - Intronic
910883633 1:91944335-91944357 AGGTCCAAGGTTGGGGAGGATGG - Intergenic
912665881 1:111579159-111579181 ACCTCCAAGGAGGGGAGGGAGGG - Intronic
915106190 1:153536361-153536383 AGCGTCAATGTGGGCAAGGAGGG + Intergenic
915598338 1:156907800-156907822 GGCTCCAAGGTGAGTGAGGGGGG + Intronic
916602114 1:166303345-166303367 AGGTCGCAGGTGGGAAAGGACGG + Intergenic
918262909 1:182812433-182812455 TCCTCCAAGGAGAGTAAGGATGG + Intronic
919772427 1:201171134-201171156 GGCTCCCGGGTGGGGAAGGACGG - Intronic
919801969 1:201359559-201359581 AGCTGGAAGGTAGGGAAGGAGGG + Intronic
919991617 1:202711275-202711297 AGCTCCTGGGTAGGTTAGGAAGG - Intergenic
920044322 1:203123777-203123799 ACCTCCAAGGCTGGGAAGGAGGG - Intronic
920380378 1:205531586-205531608 AGCCCCAACGTGGGTAAAGGAGG - Exonic
922304173 1:224329886-224329908 CGCACCAACGTGGGTAGGGAAGG + Intronic
922852791 1:228748017-228748039 ACCTCCCAGGTGGATAAGCATGG + Intergenic
923329726 1:232911409-232911431 AGCACCAAGGTGGATCAGGAGGG - Intergenic
924483423 1:244456911-244456933 ACATACAAGGTGTGTAAGGAAGG + Intronic
924645176 1:245870845-245870867 AGCTGCAAGGTGGGTCTGGATGG - Intronic
1064105639 10:12498715-12498737 ACCTCCAAGGTGAGAGAGGATGG + Intronic
1064535089 10:16350066-16350088 AAGCCCAAGTTGGGTAAGGAGGG + Intergenic
1064956452 10:20916261-20916283 AACTGCAAAGTGGGGAAGGAGGG + Intronic
1067767525 10:49098224-49098246 AGCCCCAAGGCTGGTGAGGAAGG - Intronic
1071320251 10:84448163-84448185 AGATCCAAAATGGGTAAGGAGGG - Intronic
1072155797 10:92722750-92722772 AGGTCCAAAGAGGGAAAGGAAGG - Intergenic
1075443760 10:122499594-122499616 TGCGCCAAGCTGGGTAAGGAGGG - Intronic
1077231543 11:1460075-1460097 GGCTGCAAGGTGGGGAGGGAAGG + Intronic
1078408235 11:11089817-11089839 AGCTCCAAGGGGTGGATGGAAGG + Intergenic
1078519117 11:12049349-12049371 TGCTCAGAGGTGGGTAAGGGAGG + Intergenic
1078638438 11:13073895-13073917 GGCTCCAAGGTGGCATAGGAGGG + Intergenic
1081566178 11:44262651-44262673 AGCTCCAGAGTGGGCCAGGAGGG - Exonic
1081644147 11:44778156-44778178 AGTTCTGAGGTGGGGAAGGAAGG + Intronic
1083270135 11:61567978-61568000 TCCTCCAAGGTGGGTGGGGAAGG + Intronic
1083887305 11:65579127-65579149 TGCTCCAAGGTGGGGAAGGATGG + Exonic
1084397370 11:68921343-68921365 AGCACCAAGGTGGCCAAGGTGGG - Intronic
1087022463 11:93616982-93617004 AGCTACAAGGTGAGTAAGGAAGG + Intergenic
1088242213 11:107784219-107784241 AGCTCCAACTGGGGTGAGGAAGG + Intergenic
1088993250 11:114972892-114972914 ACATCCAAGGTGGGTGAGGGAGG - Intergenic
1089119821 11:116125641-116125663 AGCCCCAGGGTGGACAAGGAGGG - Intergenic
1090083109 11:123627440-123627462 GACTCCAAGGTGGGGAGGGATGG + Intronic
1090244313 11:125204814-125204836 AGCTCAGAGCAGGGTAAGGAAGG - Intronic
1090438667 11:126708574-126708596 GGCTCCGGGGTGGGGAAGGAAGG + Intronic
1090951054 11:131473684-131473706 AGCTCCATGGTGGAGAGGGAGGG + Intronic
1090962500 11:131569687-131569709 AGCTCTCAGGTGGCTGAGGAGGG - Intronic
1091828665 12:3534028-3534050 GGCACGAAGGTGGGCAAGGAGGG + Intronic
1092077433 12:5685349-5685371 GTCTCCATGGTGGGGAAGGATGG + Intronic
1092216702 12:6688867-6688889 AGCTCCCTGGAGGGGAAGGAGGG - Intronic
1094118154 12:26938987-26939009 AACTCGCAGGTGGGTAAGGCAGG - Intronic
1094480422 12:30876906-30876928 AGACACAAGGTGGGTAGGGAGGG + Intergenic
1096201477 12:49686665-49686687 AGCTGCAAGGAGTGTAGGGATGG - Intronic
1096263901 12:50109313-50109335 AGCTCCAAGGTGGGAGGGCAAGG + Intronic
1097035460 12:56120851-56120873 GGCTCCAAGGAGGATGAGGATGG + Exonic
1100304919 12:93341618-93341640 AGCTCCAGGGAGGTTAAGCAAGG + Intergenic
1100782252 12:98040559-98040581 AGCTTCAAGATTGGCAAGGAGGG + Intergenic
1100986112 12:100203154-100203176 AGCACCAGGGTGGGGAAGGAGGG - Intronic
1102524507 12:113502003-113502025 TGCAACCAGGTGGGTAAGGAAGG - Intergenic
1103510566 12:121470828-121470850 AATTCCAAGGTGGGTAGGTATGG + Intronic
1106123779 13:26883296-26883318 AGCTACAAGGTGGGTGCAGATGG - Intergenic
1106878180 13:34099275-34099297 AGCTACTAAGTGGGAAAGGAAGG - Intergenic
1108059374 13:46517406-46517428 TGCTCCAAGGGGGGTAAACAAGG + Intergenic
1109195699 13:59375730-59375752 AGGACCCAGGTGGATAAGGAGGG - Intergenic
1110332394 13:74287934-74287956 AGCTCTAAGGAGGTAAAGGAAGG - Intergenic
1113065484 13:106370104-106370126 AGCTCCAGGGAGGGTAAGGCAGG - Intergenic
1113851073 13:113418423-113418445 TCCTCCAACGTGGGAAAGGAAGG + Intergenic
1113903301 13:113807907-113807929 AGCCCCAGGGTGGATGAGGATGG - Intronic
1114236840 14:20831477-20831499 GGCTCCAAGTCTGGTAAGGATGG + Intergenic
1114415640 14:22541744-22541766 AGCTCCAAGTTGTGTTAGAAAGG + Intergenic
1114809593 14:25882024-25882046 AGCATCAAGGTGGGAAAGGGAGG - Intergenic
1114814731 14:25943721-25943743 AGCTCTGATGTGGGAAAGGAAGG + Intergenic
1116225609 14:42148100-42148122 AGCAACCATGTGGGTAAGGAGGG - Intergenic
1118765049 14:68904044-68904066 GGCTCCATGTTGGGTAGGGAAGG - Intronic
1118801262 14:69191813-69191835 AGCACCCAGGTGCGCAAGGAGGG + Exonic
1120544200 14:85790387-85790409 AGCTACAAGATGGGGTAGGAAGG + Intergenic
1124554178 15:30709836-30709858 AGTTCCCAGAAGGGTAAGGAGGG - Intronic
1124677067 15:31695835-31695857 AGTTCCCAGAAGGGTAAGGAGGG + Intronic
1126217646 15:46174782-46174804 AAATCCAAGGTGGGTCAGGCAGG - Intergenic
1127900245 15:63335844-63335866 TGCTCCGAGCTGGGTAAGAAAGG + Intronic
1128565749 15:68699644-68699666 AGCTCCAAGGCGGGGAGGGGTGG - Intronic
1128734300 15:70044050-70044072 GGCTCCAAGATGGGCAATGATGG + Intergenic
1132384585 15:101391007-101391029 AGCTCAAACGTGTGCAAGGAAGG - Intronic
1134167424 16:11941648-11941670 AGCCCCAGGGTTGGTAAGGGAGG - Intronic
1134610519 16:15604766-15604788 TGCTCGAAGGGGGGTAGGGATGG + Intronic
1135312855 16:21419298-21419320 AGCCCCAGGGTTGGTAAGGGAGG - Intronic
1135365778 16:21851578-21851600 AGCCCCAGGGTTGGTAAGGGAGG - Intronic
1135446036 16:22519584-22519606 AGCCCCAGGGTTGGTAAGGGAGG + Intronic
1136322968 16:29499806-29499828 AGCCCCAGGGTTGGTAAGGGAGG - Intronic
1136437652 16:30239774-30239796 AGCCCCAGGGTTGGTAAGGGAGG - Intronic
1138706574 16:58921213-58921235 AGCCCCAATGTGGTTAAGAAAGG - Intergenic
1139545608 16:67648269-67648291 AGCGTCGAGGTGGGTAAGGCTGG - Exonic
1141923249 16:87150532-87150554 AGCTCAAGGCTGGGCAAGGAGGG + Intronic
1144178466 17:12730797-12730819 AGCTCACAGGTTGATAAGGAAGG + Intronic
1146055449 17:29578532-29578554 AACTCCAAGGTGGGAGAGAAGGG + Intronic
1146569164 17:33938283-33938305 AACTTGAAGGTGGATAAGGAGGG - Intronic
1149612395 17:57967153-57967175 AGCACCAAGGTAAGTGAGGAGGG - Intergenic
1151099163 17:71536014-71536036 AGCCCCAAGGTGTGCACGGATGG - Intergenic
1152665804 17:81568663-81568685 AGCCCCAAGGTGCCTAAGAAGGG + Intronic
1159445477 18:68537065-68537087 AGCACCATGGTGTGTGAGGAGGG - Intergenic
1159445678 18:68539244-68539266 AGCACCATGGTGTGTGAGGAGGG - Intergenic
1159445878 18:68541421-68541443 AGCACCATGGTGTGTGAGGAGGG - Intergenic
1160606935 18:80058688-80058710 AACTCCTAGGTGGGTGATGATGG - Intronic
1162594941 19:11621325-11621347 AGGTCCAAGGCGGGTCAGGCTGG - Intergenic
1165226259 19:34357379-34357401 AGCCCCCAGGTGGGAGAGGAAGG - Intergenic
1166138512 19:40792060-40792082 AGCTCCAGGGTGGGACAGGTGGG + Intronic
1166207260 19:41279164-41279186 AGCACCCAGCTAGGTAAGGAGGG + Exonic
1166291966 19:41869202-41869224 AGGACCAAGATGGGTAAGCAGGG + Exonic
1167421938 19:49409100-49409122 AGCCCCAAGGTGGGCAGGGAAGG + Intronic
1168344368 19:55643185-55643207 AGCTAGAAAGGGGGTAAGGAAGG - Exonic
925337963 2:3112407-3112429 AGCTCAGAGGAGGGCAAGGAGGG - Intergenic
925349067 2:3188604-3188626 AGCTCCGAGGTGAGGGAGGACGG + Intergenic
925897215 2:8481817-8481839 AGGTACATGGTGGGTCAGGAAGG - Intergenic
929805746 2:45143506-45143528 GGTTCCAAGGTGGGAAGGGATGG - Intergenic
932100643 2:68896529-68896551 CTCTACAAGGTGGGTAGGGAAGG + Intergenic
932987870 2:76748647-76748669 AGCTCCATGGGGGGGAGGGAGGG - Exonic
934715805 2:96542593-96542615 AGGTCCAAGGTGGGGCAGCAGGG - Intronic
936055703 2:109260495-109260517 AGCTCCACAGAGGGTAAGTATGG - Intronic
937109317 2:119350630-119350652 AGCTGCAAGGATGGTGAGGAGGG + Intronic
937313659 2:120917498-120917520 AGCTGCAAGGAGGGCAAGGCTGG - Intronic
939798491 2:146678335-146678357 AGCTGCAGGCTGGGTAAGCAAGG - Intergenic
940087108 2:149872790-149872812 AGCTCCAAACTGTGTGAGGAGGG - Intergenic
944211614 2:197211737-197211759 ACCTCCAAGTTGGGAAAAGAAGG - Intronic
946148234 2:217747003-217747025 ATCTCCAGGGTGGGTGAGGTGGG - Intronic
946200084 2:218066099-218066121 TGCTGCTAGGTGGGGAAGGATGG + Intronic
947742860 2:232492796-232492818 AGCACCCAGGTAGGCAAGGAGGG - Intergenic
1171022877 20:21602691-21602713 AGCTCTACTGTGGGTAGGGAGGG + Intergenic
1171442284 20:25174844-25174866 AACTTCAAGGAGGGAAAGGAAGG + Intergenic
1171509551 20:25670325-25670347 AGCTCCAATGTGGGTAGTGGGGG + Intergenic
1172689249 20:36779065-36779087 GGCTCCAAGGAGGGTGAGGAAGG + Exonic
1173346261 20:42203144-42203166 AGCTACAAGGTGGAAATGGAGGG + Intronic
1173467714 20:43296410-43296432 TGCTCCAAGTTGGGGAAAGAAGG - Intergenic
1174187230 20:48715302-48715324 AGCTCCAAGTGGTGTAAGAATGG - Intronic
1174559609 20:51421307-51421329 AGCCACAAGGAGGGGAAGGAAGG + Intronic
1177552960 21:22649687-22649709 AATTCTAAGTTGGGTAAGGAGGG + Intergenic
1177816295 21:25980874-25980896 AGCACCAGGGTTGGTCAGGAGGG + Intronic
1178488080 21:33031328-33031350 AGCTCCCAGGTTCTTAAGGAGGG - Intergenic
1179660520 21:42871710-42871732 AGCCAGAAGGTGGGTAAGAAGGG + Intronic
1181045621 22:20213002-20213024 AGCTCCCAGGCTGGTAATGACGG - Intergenic
1184927401 22:47652866-47652888 AGCTCCAAGCAGGGAAAGAATGG + Intergenic
950014382 3:9745526-9745548 AGCTCAAAGGAGGGGAAGAATGG - Intronic
950461298 3:13123728-13123750 CACTGCAAGGTGGGAAAGGAAGG + Intergenic
954100419 3:48368066-48368088 TCCTCCAAGGGGGGCAAGGAAGG - Intergenic
954254180 3:49392315-49392337 AGCTACTGGGTGGGTAAGGGTGG + Intronic
959274731 3:104263878-104263900 AAGCCAAAGGTGGGTAAGGAAGG - Intergenic
960245938 3:115400437-115400459 AGTTCTAAGTTAGGTAAGGAGGG + Intergenic
963338638 3:144006908-144006930 AGCTAAAAGGTGGGTACAGATGG - Intronic
963831469 3:150013850-150013872 AGCTCCCAGTTGAGGAAGGATGG - Intronic
964251135 3:154719111-154719133 AACTCCAAGGTGGCTAGTGAAGG + Intergenic
965216870 3:165874809-165874831 AGTACCAGGGTGGGTAGGGAAGG + Intergenic
966338416 3:178897827-178897849 ATGTCCAAAGTGGGAAAGGAGGG - Intergenic
966660781 3:182412095-182412117 AGCTCCAAGGTGGAACAGGGAGG + Intergenic
967088085 3:186111902-186111924 AGCTCCAAATAGGGTTAGGAAGG + Intronic
967869503 3:194218380-194218402 AGCTCCATGGTGCCTTAGGAAGG + Intergenic
968517038 4:1019715-1019737 AGCTGCAGGGAGGGTAGGGAAGG + Intronic
968903831 4:3442904-3442926 AGGCCCAAGGTGGGTCAGGTGGG + Exonic
969098488 4:4751777-4751799 AGCGGCAAGGTTGGTAAGGAGGG - Intergenic
974811376 4:66950455-66950477 AGCACCAAGGTGAATGAGGAAGG + Intergenic
975107932 4:70590449-70590471 AGCTCCAAGGAGGTAGAGGAGGG - Intergenic
976930044 4:90554851-90554873 AGCACCCAGGAGAGTAAGGAGGG + Intronic
977915299 4:102585930-102585952 AAGGCCAATGTGGGTAAGGAAGG + Intronic
981782443 4:148443973-148443995 AGCTCCAAGCTGGGGACCGAGGG - Intronic
986106797 5:4667487-4667509 AGCTAAAAGGTGGGTAGGGTGGG + Intergenic
986310960 5:6550879-6550901 AGCTCCGTGGAGAGTAAGGATGG - Intergenic
987761503 5:22168659-22168681 AGCTGCAAGGAGAGTCAGGATGG - Intronic
988797716 5:34667347-34667369 AGCTCCAGGGAGGCTAAGGTGGG - Intronic
990980296 5:61596556-61596578 AGCTGCAAGTTTGGTAAAGAAGG - Intergenic
991896291 5:71402126-71402148 AGCTGCAAGGAGAGTCAGGATGG - Intergenic
996402110 5:123073842-123073864 AGCTCCATGGTGTGTAATCATGG - Intergenic
997405127 5:133639652-133639674 AGCCCCATGGTGGGCAGGGAAGG + Intergenic
997516045 5:134490676-134490698 AACTCCAAGCTGGGTAAGGAGGG - Intergenic
997631688 5:135373602-135373624 AGTAGCAAGGTGGATAAGGAGGG + Intronic
998069858 5:139188904-139188926 AGCACTAAGCTGAGTAAGGAAGG + Intronic
999254102 5:150200078-150200100 AGCTCCATGGTGGGAAAGTCAGG + Intronic
999315155 5:150578953-150578975 AGCACCAAGGTGGCTACTGATGG + Intergenic
999707210 5:154284424-154284446 ATCTCCTAGCTGGGTAAGTAGGG - Intronic
1001527145 5:172437103-172437125 AGGCCCAAGGTGGATAAGTATGG + Intronic
1003334076 6:5154386-5154408 AGCCCCAGGGTGGGTGAGAAAGG + Intronic
1004193683 6:13486445-13486467 AGCGCAAAGGTGGGGAAGGCCGG + Intronic
1007269412 6:40624744-40624766 AGCTCCCAGATGGGGAAGTAGGG + Intergenic
1007378158 6:41470386-41470408 CTCTCCAGGGTGGGAAAGGAAGG - Intergenic
1007822818 6:44573517-44573539 AGCTAAAAGATGGGAAAGGAGGG - Intergenic
1007847537 6:44772336-44772358 ATCTCCTAGGTGGGAAAGTATGG - Intergenic
1007999517 6:46344373-46344395 GGCACCAAGATTGGTAAGGAAGG + Intronic
1011850295 6:91618980-91619002 AGCTCCAAGGTAGTTAAGATAGG + Intergenic
1013566175 6:111366035-111366057 AACTACAAGGTGGGTAATGAGGG + Intronic
1013852620 6:114534530-114534552 ACTACCAAGGTGGGTAGGGAAGG + Intergenic
1014306769 6:119752738-119752760 TGCTCCAAGGAGGGAGAGGAAGG - Intergenic
1015791634 6:136969449-136969471 AGCTATAGGGTGGGTGAGGAGGG + Intergenic
1017058490 6:150459097-150459119 AGCTCCCAGGTGGATAAGCTGGG + Intergenic
1017965080 6:159257253-159257275 AGCTCCTGGGTGGGTGAGCATGG + Intronic
1018281191 6:162187487-162187509 AAGTTCAAGGTGGGGAAGGACGG + Intronic
1020432442 7:8127859-8127881 CGCTACAAGGTAGGTAAGGTGGG - Exonic
1020643472 7:10785303-10785325 AGCTTCAAGGTGGAAAAGAAAGG - Intergenic
1022082980 7:27042525-27042547 AGCTCAAGGGTGGGGAAGTAGGG - Intergenic
1022532755 7:31077045-31077067 AGCTCCTGGGTCGGGAAGGAGGG - Intronic
1022724596 7:32969482-32969504 GGCTACACAGTGGGTAAGGATGG - Intronic
1023830944 7:44038793-44038815 AGCTCCAAGGTGGGTAAGGAGGG - Intergenic
1024054993 7:45654424-45654446 AGCTCAAAAGTGGGTCAGGGAGG - Intronic
1024979513 7:55145599-55145621 AGTACCAACGTGGGAAAGGAGGG - Intronic
1025049004 7:55718350-55718372 GGCTACACAGTGGGTAAGGATGG + Intergenic
1026224707 7:68430042-68430064 ATTTCCAAGGTGGGAAGGGAGGG - Intergenic
1026467885 7:70670248-70670270 AGAGCCTAGGTGGGGAAGGAAGG + Intronic
1026907107 7:74068940-74068962 AGCTCCTAGGTGGGAAGGGATGG - Intronic
1027035579 7:74922793-74922815 AGCCCCATGGAGGGGAAGGAGGG + Intergenic
1027214157 7:76173450-76173472 AGCTCCCAGATGGTTAAGAAGGG + Intergenic
1027603530 7:80270213-80270235 AGCTCCGAGGTCAGAAAGGAAGG + Intergenic
1029394479 7:100298344-100298366 AGCCCCATGGAGGGGAAGGAGGG - Intergenic
1029741278 7:102493102-102493124 AGCTCCAAGGTGGGTAAGGAGGG - Exonic
1029759268 7:102592271-102592293 AGCTCCAAGGTGGGTAAGGAGGG - Exonic
1029776637 7:102688181-102688203 AGCTCCAAGGTGGGTAAGGAGGG - Intergenic
1034192184 7:149221340-149221362 AGAGCCAAGTTGGGTCAGGAAGG + Intronic
1036303777 8:7585796-7585818 AGCTCCAAGTTGGGTCAAGGGGG - Intergenic
1037240647 8:16773404-16773426 GGATCTAAGCTGGGTAAGGAGGG - Intergenic
1037942391 8:22961630-22961652 AGCTAAAAGGTGGGTGGGGAGGG + Intronic
1038276635 8:26126827-26126849 AACTGCAGGGTGGGTGAGGATGG - Intergenic
1038314044 8:26467532-26467554 GGCACCAGGGTGGGTCAGGAGGG - Intronic
1038660800 8:29494989-29495011 ACCTCACAGATGGGTAAGGAGGG - Intergenic
1038691146 8:29764806-29764828 TGCACCAGGGTGGGGAAGGATGG - Intergenic
1039919913 8:41886222-41886244 AGCCCCAAGGTGGATATGGGTGG + Intronic
1040684538 8:49856239-49856261 AGCTCCAAGATAGGTGAGGCTGG - Intergenic
1042844795 8:73159056-73159078 AGGTCCGAGGTGGGTGAGGGAGG + Intergenic
1044892521 8:96852447-96852469 TGCTGGAAGGTGGGGAAGGAAGG - Intronic
1044944938 8:97381042-97381064 AGGTACAAGGAGGTTAAGGATGG - Intergenic
1045343035 8:101271141-101271163 AGAGACAAGGTGGGTCAGGATGG + Intergenic
1047070560 8:121338259-121338281 GGCTCCCAAGTGGGTAAGGATGG + Intergenic
1047776336 8:128073754-128073776 AGCTCCCAGGATGGTCAGGAAGG - Intergenic
1048381651 8:133870647-133870669 AGCTGAAAGGAGGGTGAGGAAGG - Intergenic
1049707402 8:144049252-144049274 AGCTGCAGGGTGGCTGAGGAGGG + Intergenic
1052550140 9:29937883-29937905 AGTTACTAGGTGGGTAGGGAAGG + Intergenic
1052974796 9:34402558-34402580 GGATCCAAGGTGGGGAGGGAGGG - Intronic
1053507078 9:38652150-38652172 AACTCCAGGGTGGCTGAGGATGG + Intergenic
1056720566 9:89067977-89067999 GGCTCAAAGTTGGGAAAGGAGGG + Intronic
1057760991 9:97874288-97874310 ACCTCCAATGTAGTTAAGGAGGG + Intergenic
1057969263 9:99537891-99537913 AGCAGCAAGGTGGAAAAGGATGG + Intergenic
1058105122 9:100961813-100961835 AGCTGCAAGAATGGTAAGGAGGG + Intergenic
1059411616 9:114136123-114136145 AGCTCCAAGATGGCTGGGGATGG - Intergenic
1060297015 9:122349846-122349868 AGCTCCTAGCTGGGTGAGGCTGG + Intergenic
1060517850 9:124276967-124276989 ACCTTGAAGGTGGATAAGGAAGG + Intronic
1060602365 9:124886798-124886820 AGCACCAGGGTGGGTGAGGCAGG + Intronic
1061037412 9:128121361-128121383 AGCTCCAAGGGGGGAGGGGACGG - Intronic
1061158352 9:128878973-128878995 AGCTGCAAGCTGGGGAATGAGGG + Intronic
1061387432 9:130298877-130298899 AGCACCAGGGTAGGTAGGGAAGG + Intronic
1062707396 9:137953121-137953143 AGCCCCAGGGTGGGACAGGAGGG - Intronic
1189129813 X:38485896-38485918 AACTCCCAAGTGGGAAAGGAGGG - Intronic
1189879167 X:45471300-45471322 ACTTCCAGGGTGGGTAGGGAAGG + Intergenic
1191580849 X:62759088-62759110 ATCCCCATGGTGAGTAAGGAGGG - Intergenic
1195061028 X:101194801-101194823 AGCACAAAGGAGGGTTAGGATGG - Intergenic
1195107698 X:101616691-101616713 AGGTCCAGGGTGAGTAAGGATGG + Exonic
1196392732 X:115225372-115225394 AGCCCCAACATAGGTAAGGATGG + Intronic
1197627596 X:128820087-128820109 TGCTCAAAGGTGGGAAAGAAAGG - Intergenic
1198531855 X:137555790-137555812 AGCTCCAAGTTGTGGAAGGCAGG - Intergenic