ID: 1029741279

View in Genome Browser
Species Human (GRCh38)
Location 7:102493103-102493125
Sequence CAGCTCCAAGGTGGGTAAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 4, 1: 0, 2: 0, 3: 14, 4: 239}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029741279_1029741288 5 Left 1029741279 7:102493103-102493125 CCTCCTTACCCACCTTGGAGCTG 0: 4
1: 0
2: 0
3: 14
4: 239
Right 1029741288 7:102493131-102493153 CTTCGCGAAGCTGAGGGCCTCGG 0: 4
1: 0
2: 0
3: 5
4: 117
1029741279_1029741289 13 Left 1029741279 7:102493103-102493125 CCTCCTTACCCACCTTGGAGCTG 0: 4
1: 0
2: 0
3: 14
4: 239
Right 1029741289 7:102493139-102493161 AGCTGAGGGCCTCGGTAGTGAGG 0: 4
1: 0
2: 0
3: 10
4: 119
1029741279_1029741290 14 Left 1029741279 7:102493103-102493125 CCTCCTTACCCACCTTGGAGCTG 0: 4
1: 0
2: 0
3: 14
4: 239
Right 1029741290 7:102493140-102493162 GCTGAGGGCCTCGGTAGTGAGGG 0: 4
1: 0
2: 0
3: 7
4: 146
1029741279_1029741286 -2 Left 1029741279 7:102493103-102493125 CCTCCTTACCCACCTTGGAGCTG 0: 4
1: 0
2: 0
3: 14
4: 239
Right 1029741286 7:102493124-102493146 TGGGCGTCTTCGCGAAGCTGAGG 0: 4
1: 0
2: 0
3: 5
4: 42
1029741279_1029741287 -1 Left 1029741279 7:102493103-102493125 CCTCCTTACCCACCTTGGAGCTG 0: 4
1: 0
2: 0
3: 14
4: 239
Right 1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG 0: 4
1: 0
2: 0
3: 0
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029741279 Original CRISPR CAGCTCCAAGGTGGGTAAGG AGG (reversed) Exonic
900102692 1:968760-968782 AAGCTGCAAAGCGGGTAAGGAGG + Intronic
900497091 1:2980690-2980712 GAGCTCCAAGGGAGGGAAGGGGG + Intergenic
900824385 1:4914320-4914342 CAGGTCAAAGGTGAGGAAGGAGG + Intergenic
900860125 1:5223001-5223023 CAGCTCCACCGTGGCCAAGGGGG - Intergenic
903066474 1:20702459-20702481 CACCCCCAAGATTGGTAAGGGGG - Intronic
903442495 1:23398878-23398900 CAGCTCCTTGGAGGCTAAGGTGG - Intronic
903886221 1:26542605-26542627 AAGCCCCAGGATGGGTAAGGCGG - Intronic
905268751 1:36772912-36772934 CAGGTGCAGGGTGGGTAAGTGGG + Intergenic
905913134 1:41667450-41667472 CAGGCCCCAGGTGGGGAAGGCGG + Intronic
906362700 1:45177347-45177369 CAGTTCCAATGTGGAAAAGGGGG - Intronic
907257335 1:53189849-53189871 CAGCTGGAAGGTAGCTAAGGAGG + Intergenic
910089993 1:83451044-83451066 CTGCTTCAGGGTGGGTACGGCGG - Intergenic
910873327 1:91854457-91854479 CAGCTCCAAGCTGGGCACTGGGG - Intronic
911138548 1:94470414-94470436 CAGCTCCAGGGTGGGTATTGAGG + Intronic
914869958 1:151464813-151464835 CAGCTCCCAGGTGGAAAAGATGG + Intergenic
915106189 1:153536360-153536382 CAGCGTCAATGTGGGCAAGGAGG + Intergenic
915533855 1:156522043-156522065 CAGCTGGAAGCTGGGTATGGTGG - Intergenic
915587761 1:156853499-156853521 CAGGTTCAAGGTGGGCATGGGGG - Intronic
915598337 1:156907799-156907821 GGGCTCCAAGGTGAGTGAGGGGG + Intronic
915973512 1:160370484-160370506 CAGCTCAGAGGTGGGAAAGCAGG - Intronic
917612835 1:176706407-176706429 CTGCTCCAAGGTGTGTGAGCTGG + Exonic
918887480 1:190214000-190214022 CATCTCCCATGTGGCTAAGGAGG + Intronic
919824347 1:201493038-201493060 CAGCTCCCTGCTGGGGAAGGTGG - Intronic
921152507 1:212413629-212413651 CAGACCCTAGGTGGGTTAGGAGG + Intronic
922779992 1:228244438-228244460 CAGCTCAAAAGTGGGCATGGAGG + Exonic
923329727 1:232911410-232911432 AAGCACCAAGGTGGATCAGGAGG - Intergenic
1063789455 10:9425451-9425473 GAGCACCAGGGTGGGTCAGGAGG + Intergenic
1064690986 10:17918206-17918228 CCGCTCCAAGATGGGTTGGGGGG - Intergenic
1070696541 10:78568164-78568186 CAGCTGCAACGTGGGTCACGAGG - Intergenic
1070735398 10:78860619-78860641 CAGGTCCAAGGGGAGCAAGGTGG + Intergenic
1070973975 10:80590088-80590110 AAGCCCCAGGGTGGGTCAGGAGG + Intronic
1071320252 10:84448164-84448186 CAGATCCAAAATGGGTAAGGAGG - Intronic
1074341924 10:112640498-112640520 CAGCCTGGAGGTGGGTAAGGAGG + Intronic
1075443761 10:122499595-122499617 GTGCGCCAAGCTGGGTAAGGAGG - Intronic
1076368129 10:129935347-129935369 CAGCTCTCCGGTGGGGAAGGTGG + Intronic
1078417541 11:11178238-11178260 CAGCTCCCATTGGGGTAAGGAGG + Intergenic
1079203204 11:18392904-18392926 CAGCACCAATGTGGTTGAGGTGG - Intergenic
1079908092 11:26274156-26274178 CAGATCTGAGGTGTGTAAGGAGG + Intergenic
1079993869 11:27274756-27274778 CAGCTTCCAGGTGGGACAGGAGG + Intergenic
1079993982 11:27275787-27275809 CAGCTTCCAGGTGGGACAGGAGG - Intergenic
1081710644 11:45213379-45213401 CAGCCCCAAGGTTGGAAAGTGGG - Intronic
1083106808 11:60366056-60366078 CAGTTTCAGGGTGGGTGAGGTGG - Intronic
1083952976 11:65967017-65967039 CAGCTCCTAGGTGGGAGAGCTGG - Intronic
1084397371 11:68921344-68921366 CAGCACCAAGGTGGCCAAGGTGG - Intronic
1085329597 11:75636855-75636877 AAGCACCAAGTTGGGTCAGGAGG - Intronic
1086965651 11:93025238-93025260 CAGCTGCGAGGTGGGACAGGAGG + Intergenic
1087274227 11:96144548-96144570 CAGCTACATGGAGGGGAAGGGGG - Intronic
1087278027 11:96179892-96179914 CAGCTCCTAGTTGGCCAAGGTGG - Intronic
1088782380 11:113148545-113148567 CAGCCCCAAGGTGAGGAAGTGGG + Intronic
1090239913 11:125174728-125174750 CAGCTTCCAGGAGGGTCAGGGGG + Intronic
1090951053 11:131473683-131473705 CAGCTCCATGGTGGAGAGGGAGG + Intronic
1090962501 11:131569688-131569710 CAGCTCTCAGGTGGCTGAGGAGG - Intronic
1092216703 12:6688868-6688890 CAGCTCCCTGGAGGGGAAGGAGG - Intronic
1093021244 12:14206317-14206339 CAGCTGCATGGTGGGGATGGAGG - Intergenic
1093511650 12:19936231-19936253 GAGCTCAAGGGTGGGAAAGGTGG + Intergenic
1094567412 12:31612274-31612296 AATTTCCAAGCTGGGTAAGGTGG + Intergenic
1097106802 12:56630471-56630493 GAGCTGCCAGGTGGGCAAGGTGG - Intronic
1100986113 12:100203155-100203177 GAGCACCAGGGTGGGGAAGGAGG - Intronic
1102104226 12:110306873-110306895 CAGCTACAAGGAGGCTGAGGTGG - Intronic
1102534528 12:113570647-113570669 CACCTCCAGGGTGGGCAGGGGGG + Intergenic
1103576732 12:121883013-121883035 CAGCTCAAGGCTGGGTGAGGTGG - Intergenic
1103582007 12:121922416-121922438 GAGCTCTAAGGTGTGTAGGGAGG + Intronic
1104393814 12:128414782-128414804 TAGCTCACAGGTAGGTAAGGTGG - Exonic
1105281206 13:18963711-18963733 CAGCTCCAAGGTGGCCTCGGTGG + Intergenic
1105290408 13:19049727-19049749 CAGCTCCAAGGTGGCCTCGGTGG + Intergenic
1106170235 13:27282513-27282535 CAGCTCCAAGGTGTGTGCTGGGG + Intergenic
1107227890 13:38072852-38072874 AAGCACCAAGGTTGGTCAGGAGG - Intergenic
1110704529 13:78589389-78589411 CAGCTCCAGGGAGGGTCAAGGGG - Intergenic
1112606334 13:100910322-100910344 CAAATCCAAGTTAGGTAAGGGGG + Intergenic
1116225610 14:42148101-42148123 CAGCAACCATGTGGGTAAGGAGG - Intergenic
1118801261 14:69191812-69191834 CAGCACCCAGGTGCGCAAGGAGG + Exonic
1119964732 14:78901712-78901734 CAGCTTCAAGGTGGGCCAGATGG + Intronic
1121653859 14:95580720-95580742 CAGCTCCAGGGTGGGGAAAGAGG + Intergenic
1122401671 14:101471010-101471032 CATCTGCAACGTGGGTAAGATGG + Intergenic
1124019339 15:25904935-25904957 CAGCTGAAGGGTGGGTCAGGTGG + Intergenic
1125001832 15:34778850-34778872 CAGCTACAAGGAGGCTGAGGTGG - Intergenic
1126180147 15:45777370-45777392 CAGCCCCAAAGTAGGGAAGGGGG + Intergenic
1129712325 15:77826660-77826682 CAGGTCCCAGCTGGGGAAGGAGG + Intergenic
1130076292 15:80693788-80693810 CAGGTCCTAGCTGGGCAAGGTGG + Intronic
1130322801 15:82854631-82854653 CCGCAACAAGGTGGGTACGGTGG - Exonic
1132543567 16:522725-522747 CAGCATCAAGGTGGGGCAGGTGG + Exonic
1132835621 16:1951492-1951514 CAGCTACATGGGGGGTGAGGTGG - Intronic
1134979261 16:18593999-18594021 CAGCTCCTAGGTGGCTGAGAGGG + Intergenic
1136021853 16:27445544-27445566 CAGCTCCAAGGTGGAGAAATTGG + Intronic
1136628204 16:31474388-31474410 CAGCTCCAGAGTGGCTGAGGTGG - Exonic
1137426734 16:48386009-48386031 CAGCTGAAAAGTGGGTAATGGGG + Intronic
1138230499 16:55332436-55332458 CAGCTCTAACCTGGGAAAGGAGG + Intergenic
1139966527 16:70748567-70748589 CAGCTCCAGAGTGGGGAATGGGG + Intronic
1143261193 17:5599567-5599589 CAGCTGGAAGGTGGTGAAGGTGG + Intronic
1145105500 17:20111853-20111875 CAGCCCCAAGAAGGGAAAGGTGG + Intronic
1147403538 17:40194862-40194884 CAGCCCCAAAGTGGGGGAGGGGG + Exonic
1147674900 17:42198407-42198429 CAGCTCCAGGCTGGGCATGGTGG + Intergenic
1149496002 17:57117935-57117957 CAGCTCCCAAGTGGTGAAGGTGG - Intronic
1152665803 17:81568662-81568684 CAGCCCCAAGGTGCCTAAGAAGG + Intronic
1153977715 18:10284051-10284073 CTGCTCCAAAGTGGCCAAGGTGG + Intergenic
1156228088 18:35128893-35128915 CAGCCCCAAGGAGGGGAAGTGGG - Intronic
1157710052 18:49843983-49844005 CAGCACCGGGGTGGGGAAGGGGG - Intronic
1158701872 18:59755412-59755434 CAGCTCCAAGGAGTCTGAGGTGG + Intergenic
1160512752 18:79461634-79461656 CAGCGCCAGGGTGTGTGAGGTGG - Intronic
1160820364 19:1054974-1054996 CAGCTCCCAGGTGGGCACAGGGG - Intronic
1160902700 19:1436649-1436671 CAGCTCCCAGGAGGGCCAGGCGG + Intergenic
1161770225 19:6226964-6226986 CGGCTCCAAGGTTAGTGAGGCGG - Exonic
1166138511 19:40792059-40792081 CAGCTCCAGGGTGGGACAGGTGG + Intronic
1166207259 19:41279163-41279185 CAGCACCCAGCTAGGTAAGGAGG + Exonic
1166251630 19:41575653-41575675 CAGCTCCTAGGTGTGGAGGGAGG - Intronic
1166387703 19:42391355-42391377 CAGCTCCAAATTGGGAAGGGAGG + Intergenic
1168616644 19:57843106-57843128 CAGCTACATGGAGGCTAAGGTGG - Intronic
927129031 2:20041646-20041668 CAGCTACCAGGTGGCTGAGGTGG - Intronic
927718939 2:25370884-25370906 CAACTCAAAGGTGGGGGAGGGGG - Intergenic
930385112 2:50684387-50684409 CAGCTACTAGGAGGCTAAGGTGG + Intronic
932270331 2:70403522-70403544 CAGCTGGAAGGTGGGTAACATGG + Intergenic
932344749 2:70988311-70988333 CCCTTCCAAGGTGGGTCAGGAGG - Exonic
932575058 2:72958242-72958264 CTGTCCCAAGGTAGGTAAGGTGG + Intronic
932615454 2:73228481-73228503 CAGCTCAAAGGTGGGGATGCTGG + Exonic
932878142 2:75474455-75474477 AAGTTGCAAGGTGGGTGAGGAGG + Intronic
933509397 2:83220544-83220566 CAGCAGCAAGGTAGGTATGGGGG + Intergenic
934549346 2:95245554-95245576 CAGCTCCAGGCTGGGCACGGTGG - Intronic
936073958 2:109389961-109389983 CAGATCTTAGGTGGGTGAGGAGG - Intronic
937496219 2:122422948-122422970 CAACACCAAGGCGGGTAAGGAGG - Intergenic
937884707 2:126891825-126891847 CAGCTCCCAGGGGGGGCAGGAGG + Intergenic
937887457 2:126909623-126909645 AAGCACCAGGGTGGGTCAGGAGG - Intergenic
938084907 2:128393141-128393163 CAGCTACTAGGAGGTTAAGGTGG + Intergenic
939319779 2:140604254-140604276 CTGCTCAAAAGTGGGTAAGAGGG - Intronic
941471759 2:165896960-165896982 CAGGGCCCAGGTGGGGAAGGTGG - Intronic
942752547 2:179304229-179304251 CAGCAGGGAGGTGGGTAAGGTGG - Intergenic
944180223 2:196883280-196883302 AAGCACCAATGTGGGCAAGGAGG + Intronic
944518109 2:200532571-200532593 CCAATCCAAGGTGGGGAAGGGGG - Intronic
944776995 2:202976821-202976843 CAGCTGCCAGGAGGCTAAGGTGG - Intronic
946092798 2:217245872-217245894 CAGCACAAAGGTGTGAAAGGTGG - Intergenic
946148235 2:217747004-217747026 CATCTCCAGGGTGGGTGAGGTGG - Intronic
947049917 2:226030890-226030912 CAGCTCCAAGGTGATCAAAGGGG - Intergenic
947742861 2:232492797-232492819 CAGCACCCAGGTAGGCAAGGAGG - Intergenic
947822811 2:233083749-233083771 CAGCTCCAGGGTGGCCAGGGAGG + Intronic
948487436 2:238289667-238289689 CACTTCCAAGGCGGGTAAGATGG + Intronic
1169096016 20:2899396-2899418 AAGCACCAGGGTGGGTCAGGAGG + Intronic
1169508245 20:6236329-6236351 CATCTCCAAGGTAGTTAAGCTGG - Intergenic
1169706654 20:8513912-8513934 CAGCTACCAGGAGGCTAAGGTGG + Intronic
1170828589 20:19819646-19819668 CAGCTACCAGGAGGGTGAGGTGG - Intergenic
1171373584 20:24676773-24676795 CAGCACCAAGGTGTGTAGCGGGG - Intergenic
1171509550 20:25670324-25670346 GAGCTCCAATGTGGGTAGTGGGG + Intergenic
1173346260 20:42203143-42203165 CAGCTACAAGGTGGAAATGGAGG + Intronic
1176061422 20:63174500-63174522 CATCTCCCCTGTGGGTAAGGGGG - Intergenic
1176093265 20:63328373-63328395 CTGCTCCAAGATGGGCATGGGGG - Exonic
1178488081 21:33031329-33031351 CAGCTCCCAGGTTCTTAAGGAGG - Intergenic
1179602963 21:42493210-42493232 CAACTTTAAGGTGGGAAAGGTGG - Intronic
1180599734 22:17008079-17008101 CAGCTCCCGGGAGGGTGAGGGGG + Exonic
1181558181 22:23684147-23684169 CAGCTGCAGGGTGGGTAGTGGGG - Intergenic
1181697258 22:24600021-24600043 AAGCTCCAAGGAGGGGATGGGGG - Intronic
1181890556 22:26059382-26059404 CAACTCCAGGGTGGGAAAAGAGG + Intergenic
1182028130 22:27136328-27136350 CAGCTCCAGAGTTGGAAAGGTGG + Intergenic
1182825350 22:33260198-33260220 AAGCGCCAGGGTGGGTCAGGAGG - Intronic
1184387871 22:44186554-44186576 CTGGTCAAAGGTGGGAAAGGTGG - Intronic
1185327194 22:50232442-50232464 CAGCTACATGGAGGCTAAGGTGG + Intronic
950106788 3:10393618-10393640 CAGCCCCAAGGAGAGAAAGGGGG + Intronic
950649720 3:14399714-14399736 CAGCCCCAAGGAGAGAAAGGAGG - Intergenic
953377028 3:42437189-42437211 AAGCACCAAGGTGAGTCAGGAGG - Intergenic
953422313 3:42763988-42764010 CAACTCCAAGGTTGGGAGGGGGG + Intronic
954436060 3:50496974-50496996 CATTTCCAAGGTGGGAAAGATGG + Intronic
959147279 3:102564646-102564668 CAGCTCAAAGGGGAGTAAGTGGG - Intergenic
959689892 3:109187525-109187547 AAGCGCCAAGTTGGGTATGGCGG - Intergenic
961109672 3:124273208-124273230 CACCTCCAAGATGGGGAATGTGG - Intronic
963398620 3:144767406-144767428 CAGATCAAATGTGGGTTAGGTGG + Intergenic
964195860 3:154063409-154063431 GACCTCAAGGGTGGGTAAGGTGG + Intergenic
965275488 3:166677206-166677228 CAGCTCCAACGTGGCTAAAAGGG - Intergenic
965285979 3:166821392-166821414 CAACTCCAAGCTGGGTGTGGTGG + Intergenic
965547878 3:169934052-169934074 CAGGGCCAAGGTGGGAGAGGTGG + Intronic
966338417 3:178897828-178897850 CATGTCCAAAGTGGGAAAGGAGG - Intergenic
968883036 4:3310804-3310826 CAGGTCCCAGGTGGAGAAGGTGG + Intronic
968903830 4:3442903-3442925 CAGGCCCAAGGTGGGTCAGGTGG + Exonic
969098489 4:4751778-4751800 CAGCGGCAAGGTTGGTAAGGAGG - Intergenic
969879736 4:10163207-10163229 GAGCTGCAGGGTGGGAAAGGAGG + Intergenic
973846839 4:54921492-54921514 CAGCACCAAGGGGGACAAGGGGG - Intergenic
975327145 4:73071173-73071195 CAGCTACCAGGAGGCTAAGGCGG + Intergenic
980877152 4:138673008-138673030 CTTCTCCACGGTGGCTAAGGAGG + Intergenic
981752749 4:148108505-148108527 CTGCTCCAAGAGGGGCAAGGTGG - Intronic
981782444 4:148443974-148443996 CAGCTCCAAGCTGGGGACCGAGG - Intronic
985196069 4:187430942-187430964 CAGCTCTAAGGGAGGTATGGGGG + Intergenic
985588653 5:753629-753651 CAGCTCCACGATGGCCAAGGTGG - Intronic
985603322 5:846068-846090 CAGCTCCACGATGGCCAAGGTGG - Intronic
986106796 5:4667486-4667508 GAGCTAAAAGGTGGGTAGGGTGG + Intergenic
987371011 5:17192935-17192957 CAGCTCAAATGTGGGGCAGGGGG - Intronic
988797717 5:34667348-34667370 CAGCTCCAGGGAGGCTAAGGTGG - Intronic
988944149 5:36178261-36178283 CAGCTCCTAGGTAGGAAGGGTGG + Intronic
991711983 5:69417031-69417053 CAGCAGCAAAGTGGGTAAGAAGG - Intronic
994308175 5:98233829-98233851 CAGCTACCAGGGGGCTAAGGTGG - Intergenic
995228968 5:109736733-109736755 CAGGTTCTAGGAGGGTAAGGTGG - Intronic
997516046 5:134490677-134490699 GAACTCCAAGCTGGGTAAGGAGG - Intergenic
997758623 5:136423562-136423584 CAGCCCAAAGCTGGGTATGGTGG - Intergenic
1004000548 6:11593187-11593209 CAGCTCCTAAGTGGCAAAGGTGG - Intergenic
1004660632 6:17706408-17706430 CCGCTCCGGGGCGGGTAAGGGGG + Exonic
1007269411 6:40624743-40624765 CAGCTCCCAGATGGGGAAGTAGG + Intergenic
1013566174 6:111366034-111366056 AAACTACAAGGTGGGTAATGAGG + Intronic
1013818075 6:114122715-114122737 CTCCTCCAAGGTAGGGAAGGTGG - Intronic
1016456325 6:144234683-144234705 GACCTCCAGGGTGGGGAAGGGGG + Intergenic
1017058489 6:150459096-150459118 CAGCTCCCAGGTGGATAAGCTGG + Intergenic
1017638020 6:156462495-156462517 ACTCTCCAAGATGGGTAAGGAGG - Intergenic
1017867279 6:158454891-158454913 CTGCTCCAGGATGGGTATGGTGG - Intronic
1019450309 7:1094245-1094267 CTGCTGCCAGGTGGGTGAGGCGG - Intronic
1020125798 7:5531873-5531895 CACCTCCAAGGAGGGGGAGGAGG - Intronic
1020432443 7:8127860-8127882 TCGCTACAAGGTAGGTAAGGTGG - Exonic
1022311188 7:29197260-29197282 CAGCTTCAAGAAGGCTAAGGGGG + Intronic
1023830945 7:44038794-44038816 CAGCTCCAAGGTGGGTAAGGAGG - Intergenic
1024182191 7:46907836-46907858 GATGTCTAAGGTGGGTAAGGAGG - Intergenic
1024570416 7:50718379-50718401 CAGTTCATAGGTGGATAAGGAGG - Intronic
1026224708 7:68430043-68430065 CATTTCCAAGGTGGGAAGGGAGG - Intergenic
1026631188 7:72039651-72039673 CAGCTGCACAGTGGGGAAGGAGG - Intronic
1026665356 7:72336472-72336494 CAGCTCCACGGAAGGCAAGGTGG + Intronic
1026715592 7:72786686-72786708 CAGCTGCTAGGAGGCTAAGGTGG - Intronic
1027035578 7:74922792-74922814 CAGCCCCATGGAGGGGAAGGAGG + Intergenic
1029394480 7:100298345-100298367 CAGCCCCATGGAGGGGAAGGAGG - Intergenic
1029741279 7:102493103-102493125 CAGCTCCAAGGTGGGTAAGGAGG - Exonic
1029759269 7:102592272-102592294 CAGCTCCAAGGTGGGTAAGGAGG - Exonic
1029776638 7:102688182-102688204 CAGCTCCAAGGTGGGTAAGGAGG - Intergenic
1030721984 7:112881783-112881805 CAGCTGGAGGGTGGGCAAGGTGG - Intronic
1031940035 7:127778872-127778894 CAGCTCCCAGCTAGGTGAGGTGG - Intronic
1032165184 7:129539764-129539786 CAGCACCAGGGTTGGTCAGGAGG - Intergenic
1034571095 7:151957056-151957078 CAGCTCCTGGGAGGCTAAGGTGG + Intronic
1034576014 7:151998482-151998504 CAACTCCAAGCTGGGCATGGTGG + Intronic
1035270786 7:157718867-157718889 CAGCGACAAGGTGGGTTTGGGGG - Intronic
1035302577 7:157907137-157907159 CACCTTCAAGGTGGGTGTGGTGG + Intronic
1036303778 8:7585797-7585819 GAGCTCCAAGTTGGGTCAAGGGG - Intergenic
1036909961 8:12749304-12749326 CAGCACAAAGGTGGGTCAAGGGG + Intronic
1037932844 8:22892939-22892961 CAAGTCCAAGGGGGTTAAGGTGG + Intronic
1038660801 8:29494990-29495012 CACCTCACAGATGGGTAAGGAGG - Intergenic
1040461404 8:47652447-47652469 CAGCTCCAAGGTGGGCGGGCTGG + Intronic
1040471326 8:47737893-47737915 CAGCTCCAGGGTGGGCACGGCGG + Exonic
1041020238 8:53631647-53631669 AAGCACCAAGGTGGGCCAGGAGG + Intergenic
1041260740 8:56018944-56018966 AAGCACCAGGGTGGGTCAGGAGG + Intergenic
1046926439 8:119794281-119794303 CAGCTCTCAGGAGGCTAAGGTGG + Intronic
1047835468 8:128685452-128685474 CAGCTCCAGGGAGGCTGAGGTGG + Intergenic
1049707401 8:144049251-144049273 CAGCTGCAGGGTGGCTGAGGAGG + Intergenic
1049741343 8:144242506-144242528 CAGCACCAAGGTGGGCACTGCGG + Exonic
1050104724 9:2153417-2153439 CAGCTCTCAGGAGGGTGAGGTGG + Intronic
1052835187 9:33245261-33245283 TGGCTCCAAGGTGGCCAAGGTGG + Intronic
1056807612 9:89740999-89741021 AAGCACCAGGGTGGGTCAGGGGG - Intergenic
1057021824 9:91705116-91705138 CAGCTCCTTGGAGGGTGAGGTGG - Intronic
1057271640 9:93654841-93654863 CAGCTCCAAGGTGGCCTCGGTGG - Intronic
1057760990 9:97874287-97874309 CACCTCCAATGTAGTTAAGGAGG + Intergenic
1058883120 9:109302550-109302572 CAGTTCCAACTTGGCTAAGGAGG - Intronic
1059322317 9:113479436-113479458 CAGCTCCCTGGTGGGTGTGGTGG - Intronic
1059347939 9:113645035-113645057 CAGTTGCAGGGTGGATAAGGTGG + Intergenic
1061158351 9:128878972-128878994 CAGCTGCAAGCTGGGGAATGAGG + Intronic
1061420995 9:130472765-130472787 CAGCTCCAAGGGAGGCAGGGAGG + Intronic
1062707397 9:137953122-137953144 CAGCCCCAGGGTGGGACAGGAGG - Intronic
1185794662 X:2954790-2954812 AAGCTCCAGGGTTGGTCAGGAGG + Intronic
1186275076 X:7929530-7929552 CAGCTCTCAGCTGGGTGAGGTGG + Intergenic
1186628377 X:11320077-11320099 CATCTCCAATGTGAGTAATGTGG - Intronic
1186890755 X:13957099-13957121 GGGCTCCAAGGTGGGGGAGGTGG + Intergenic
1187298615 X:18026789-18026811 CTCCTCCAAGTTGGGTAGGGAGG + Intergenic
1188734376 X:33694579-33694601 AAGCTCAAAGGTGAGGAAGGTGG + Intergenic
1190060194 X:47205906-47205928 CAGTTCCAGGGTGGGGATGGGGG - Intronic
1190577810 X:51859063-51859085 CAGCTAGAAGGTGGTTAAGCTGG - Intronic
1190730645 X:53223463-53223485 AAGCACCAAGTTGGATAAGGAGG + Intronic
1196729476 X:118926580-118926602 CAGCTACTTGGTGGCTAAGGTGG - Intergenic
1197511280 X:127372053-127372075 CAGCTCCAATGGGGGTCAGATGG - Intergenic
1198484043 X:137068483-137068505 CAGATCCACTGTGGATAAGGGGG - Intergenic
1201447818 Y:14077708-14077730 CAGCTCCCAGCTGGGTGAGGTGG - Intergenic