ID: 1029741282

View in Genome Browser
Species Human (GRCh38)
Location 7:102493106-102493128
Sequence GCCCAGCTCCAAGGTGGGTA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 4, 1: 0, 2: 1, 3: 21, 4: 202}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029741282_1029741290 11 Left 1029741282 7:102493106-102493128 CCTTACCCACCTTGGAGCTGGGC 0: 4
1: 0
2: 1
3: 21
4: 202
Right 1029741290 7:102493140-102493162 GCTGAGGGCCTCGGTAGTGAGGG 0: 4
1: 0
2: 0
3: 7
4: 146
1029741282_1029741288 2 Left 1029741282 7:102493106-102493128 CCTTACCCACCTTGGAGCTGGGC 0: 4
1: 0
2: 1
3: 21
4: 202
Right 1029741288 7:102493131-102493153 CTTCGCGAAGCTGAGGGCCTCGG 0: 4
1: 0
2: 0
3: 5
4: 117
1029741282_1029741289 10 Left 1029741282 7:102493106-102493128 CCTTACCCACCTTGGAGCTGGGC 0: 4
1: 0
2: 1
3: 21
4: 202
Right 1029741289 7:102493139-102493161 AGCTGAGGGCCTCGGTAGTGAGG 0: 4
1: 0
2: 0
3: 10
4: 119
1029741282_1029741287 -4 Left 1029741282 7:102493106-102493128 CCTTACCCACCTTGGAGCTGGGC 0: 4
1: 0
2: 1
3: 21
4: 202
Right 1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG 0: 4
1: 0
2: 0
3: 0
4: 36
1029741282_1029741286 -5 Left 1029741282 7:102493106-102493128 CCTTACCCACCTTGGAGCTGGGC 0: 4
1: 0
2: 1
3: 21
4: 202
Right 1029741286 7:102493124-102493146 TGGGCGTCTTCGCGAAGCTGAGG 0: 4
1: 0
2: 0
3: 5
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029741282 Original CRISPR GCCCAGCTCCAAGGTGGGTA AGG (reversed) Exonic
900414770 1:2529891-2529913 GCCCAACTCCAAGCTGGAGAAGG - Exonic
900466189 1:2826633-2826655 GCCCAGCTCCCAGGTCAGTCCGG + Intergenic
900593960 1:3472083-3472105 GCCCACCTCCACGCTGGGTAAGG + Intronic
900613966 1:3556058-3556080 GCCCCTCTCCAAGGTGGGCTGGG + Intronic
903186502 1:21632220-21632242 GCCCAGCTCCTAAGTGGGATGGG + Intronic
903848463 1:26292046-26292068 GCCCAGCTTGAGGGTGGGGATGG - Intronic
904772022 1:32886107-32886129 GCTCAGAGCCCAGGTGGGTATGG + Intronic
906265528 1:44425912-44425934 GCTCAGCTTCAAGGAGGGAATGG - Intronic
907438225 1:54462880-54462902 ACTCTGCTCCAGGGTGGGTAGGG + Intergenic
912488576 1:110048463-110048485 GCCCAGCTCCTGGGTGGCTGTGG + Intronic
915548124 1:156614965-156614987 GCCCATCTCAGAGGTGGATAAGG - Intergenic
920013833 1:202889349-202889371 GCCCAGTGGCCAGGTGGGTATGG - Intergenic
922507597 1:226135547-226135569 GCCCAGCTCCAAGCTGAGTGGGG - Intergenic
922791914 1:228315625-228315647 GCCCAGTGCCAAAGTGGGCAGGG + Intronic
1062958698 10:1557252-1557274 GCCCAGCACCAAGGGGAGGACGG - Intronic
1063583561 10:7330963-7330985 GTCCAGCTCCAAGGCAGGTCAGG + Intronic
1065319474 10:24495731-24495753 GCCCAGCTGCAATATGGGGATGG + Intronic
1066586866 10:36945269-36945291 GGCCAGCTGCAAGGTAGGAAGGG - Intergenic
1067767528 10:49098228-49098250 GCCCAGCCCCAAGGCTGGTGAGG - Intronic
1071563539 10:86660211-86660233 GCCCAGCCCCGGGGTGGGTGGGG + Intronic
1071603685 10:86970981-86971003 GCCCAGCTCCCAGGAGGGGCCGG - Intronic
1071737604 10:88318715-88318737 TCCCAGCTGCAATGTGGCTATGG - Intronic
1072082727 10:92047980-92048002 GCCCAGCTTCCAGGTGAGGAGGG + Intronic
1073316229 10:102582790-102582812 GCAAAGCTCCAAGGAGGGAAGGG + Intronic
1076218326 10:128713275-128713297 GCCCAGCACCCTGGTGGGTGAGG - Intergenic
1076620908 10:131786960-131786982 GCCCAGCTCCAAGGACTGTACGG - Intergenic
1077046968 11:551025-551047 GCCCTGCCCCACGGTGGGTCTGG + Intronic
1077110054 11:858349-858371 GCACAGCCCCAGGGTGGGCAGGG - Intronic
1077125488 11:933683-933705 GCCCAGCACCAGGGTGGGAGAGG + Intronic
1080687231 11:34525470-34525492 GCACAGCCCCAAGGAGGGAAGGG - Intergenic
1083270132 11:61567974-61567996 TCCCTCCTCCAAGGTGGGTGGGG + Intronic
1083904124 11:65659155-65659177 GCTCATTGCCAAGGTGGGTATGG - Intronic
1084051964 11:66605840-66605862 GTCCTGCTCAAAGGTGGGCAGGG - Exonic
1084101837 11:66955037-66955059 GGCCAGCACCAAGGTCAGTATGG - Intronic
1084397374 11:68921347-68921369 TCCCAGCACCAAGGTGGCCAAGG - Intronic
1084452890 11:69250615-69250637 GGCCAGCCCCGAGGTGGGTGAGG + Intergenic
1085689325 11:78652575-78652597 GCCCAGCTCCCTGGTGTGAATGG - Intergenic
1086620204 11:88878473-88878495 GGCCAGCTCCACTGTGGGGAGGG - Intronic
1088190233 11:107220346-107220368 GCCCAGATTCAAGGTGGGGTGGG - Intergenic
1089402388 11:118171746-118171768 GCCCCGCTGCAGGGTGGGGAGGG - Intronic
1090629265 11:128632390-128632412 GCCCAGGCCCAGGGTGGGTTTGG - Intergenic
1091053497 11:132396639-132396661 GACCTGCTCCAAAGTGGGGATGG - Intergenic
1091448314 12:557516-557538 CCCCAGCTCCCAGGTGAGTCAGG - Intronic
1092909214 12:13131520-13131542 GCACAGCTCCAGGGTGTGGAAGG - Intronic
1093047957 12:14472453-14472475 GCCCAGCTTGAATGTGTGTAGGG + Intronic
1095514490 12:42991037-42991059 GCCCAGGTCCCATGTTGGTAAGG + Intergenic
1096188511 12:49599531-49599553 GCCCAGCTCCATGGTGGTGGTGG + Exonic
1097092588 12:56519045-56519067 TCCCAGCTACAGGGTGGGGAGGG + Intergenic
1097679763 12:62637806-62637828 GCCCAGCAGCAAGGTGGGTGGGG - Intergenic
1098290866 12:68955942-68955964 CCCCACCTCCAAGCTGGGGACGG - Intronic
1099094189 12:78352747-78352769 GCCCAGCTGCAAGGAGGGTTGGG + Intergenic
1100511962 12:95284436-95284458 CCCCACCTCCAGGGTGTGTATGG + Intronic
1103976005 12:124703221-124703243 CCCCAGCTCAAGGATGGGTAAGG - Intergenic
1104323234 12:127771965-127771987 GCCCACCACCAAGGAGGGAAGGG + Intergenic
1104763528 12:131312438-131312460 GCCCAGCACCACGGTGGGCACGG + Intergenic
1104815974 12:131645639-131645661 GCCCAGCACCACGGTGGGCACGG - Intergenic
1107735186 13:43391735-43391757 GTCCAGGTCCCAGGTGAGTAGGG - Intronic
1110193224 13:72755906-72755928 TTCCAGCTCAAACGTGGGTAGGG + Exonic
1110450648 13:75635683-75635705 GCCCGGCTTCCAGGTGGGTGCGG - Intronic
1111349149 13:87003127-87003149 GCCCAGCTCTATGCAGGGTAAGG - Intergenic
1113065485 13:106370108-106370130 GGGCAGCTCCAGGGAGGGTAAGG - Intergenic
1113614736 13:111672057-111672079 GCCCAGCTGCAAGGGGGTTAGGG + Intronic
1113620205 13:111756971-111756993 GCCCAGCTGCAAGGGGGTTAGGG + Intergenic
1113699693 13:112375447-112375469 TCCCAGCTCCATGGTGGAGAGGG - Intergenic
1115157676 14:30359106-30359128 GCCCTGCTCCCAAGTGGATAAGG + Intergenic
1119208273 14:72810750-72810772 GCCCAGCTCCAGGATCGGGAAGG - Intronic
1119601389 14:75979391-75979413 GCCCACCTCCCAGGTGGGCCTGG + Intronic
1120513881 14:85447753-85447775 GAGCAGGTGCAAGGTGGGTAGGG - Intergenic
1122749390 14:103921460-103921482 GTCCTGCGCCAAGGTGAGTACGG - Exonic
1122861665 14:104585237-104585259 GCCCTGCTCCCAGCTGGATAGGG - Intronic
1123714130 15:23014065-23014087 GGCCAGCTCAAAGATGGGTTTGG - Intronic
1128565752 15:68699648-68699670 CCCTAGCTCCAAGGCGGGGAGGG - Intronic
1129228791 15:74184936-74184958 ACCCAGCGCCGAGGTGGGGAAGG - Intronic
1129248862 15:74297141-74297163 GCCCTGCTCCAGGGTGGGCAGGG - Intronic
1130322803 15:82854634-82854656 GCTCCGCAACAAGGTGGGTACGG - Exonic
1132384588 15:101391011-101391033 GCCCAGCTCAAACGTGTGCAAGG - Intronic
1133298204 16:4765931-4765953 GTCCTGCTCCAAGGTTGGCAGGG + Exonic
1134034063 16:11016203-11016225 GGCCATCTCCAAAGTGGGTATGG - Intronic
1134304256 16:13018191-13018213 GCACAGCTTCACAGTGGGTAGGG + Intronic
1135323342 16:21511368-21511390 GGACAACTCCAAGGTGGGGATGG - Intergenic
1136411973 16:30082936-30082958 ACACAGCTCCAAGGTGGGGCTGG - Intronic
1137379404 16:47983525-47983547 GTCCTGCTTCAAGGTGGGCATGG + Intergenic
1137454735 16:48609765-48609787 GCACAGCGCCAAGGTGAGTCCGG - Exonic
1137881209 16:52050355-52050377 GCCCAGATCCAAGAGGGGTTGGG - Intronic
1139719928 16:68844030-68844052 ACCCAGCTCCAGAGAGGGTAGGG + Intronic
1141831385 16:86511536-86511558 GCCGAGCTGCAAGGTGAGTGGGG + Exonic
1142170362 16:88618829-88618851 GCCCACCTCCAAGCTGGGCCAGG - Intronic
1142375950 16:89707250-89707272 GCCCACAGCCAAGGTGAGTAAGG + Exonic
1142850083 17:2700621-2700643 GCCCAGCACCCAGGAGGGCAGGG + Intronic
1143845550 17:9770651-9770673 GCCCACCTCCAAGGAGAGGATGG + Intergenic
1145302915 17:21653471-21653493 ACCCAGCTCTGAGGTGGATATGG + Intergenic
1145347126 17:22048370-22048392 ACCCAGCTCTGAGGTGGATATGG - Intergenic
1145992191 17:29085901-29085923 CCCCAGCCCTAAGGTGGGAAGGG + Intronic
1146352932 17:32111227-32111249 GCCCAGTTCCCAGGTCCGTATGG + Intergenic
1146475711 17:33160992-33161014 GCCCAGCTCCAAGCTGTTTCAGG - Intronic
1146932140 17:36784996-36785018 GCCCAGCAGCAAGGAGGGTTTGG + Intergenic
1147375337 17:40019594-40019616 GTCCAGCCCCAAGGTGGTTCTGG - Exonic
1147948515 17:44093781-44093803 GCCCAGTTCCATGGGGGGTGGGG - Exonic
1148109440 17:45136440-45136462 TCCCAGCTCCAAGGGGCGGAGGG - Intronic
1148460751 17:47837892-47837914 GCCCAGCTCCCAGAGGGGTGGGG + Exonic
1152135233 17:78499732-78499754 GCTCAGATCCAAGCTGGGGAGGG + Intronic
1153987916 18:10369163-10369185 GCCCAGCTCCCAAGTGGGACTGG + Intergenic
1155490599 18:26397863-26397885 GCCCAAATCCAAGGTCGGCAGGG + Intergenic
1157278024 18:46326048-46326070 GGCCAGCTCCAAGGCGGCTGCGG - Intergenic
1157819021 18:50751922-50751944 GCCCACCCACAAGGTGGGGAAGG + Intergenic
1158471969 18:57745117-57745139 GGCCAGCAGCAAGGTGGGTGAGG - Intronic
1158631600 18:59119950-59119972 GTTCCACTCCAAGGTGGGTATGG - Intergenic
1160537439 18:79602679-79602701 TCCCAGCTCCCAGATGGGTCTGG + Intergenic
1161170138 19:2808432-2808454 GCTCTGCTCCCAGGTGGGTGCGG + Exonic
1162752021 19:12834779-12834801 TCCTACCTCCAAGGTGGGGAGGG + Exonic
1162798995 19:13100929-13100951 GCCCAGCTCTGTGGTGGGCATGG + Exonic
1163331838 19:16643886-16643908 GTCCAGCAACAAGGTGGCTAAGG + Intronic
1163758266 19:19119822-19119844 CCCCAGCTGCAAGGTGGGGCCGG - Exonic
1163779820 19:19240308-19240330 GCCCACCTCCAGGCTGGGGAAGG + Intronic
1163779871 19:19240473-19240495 GCCCACCTCCAGGCTGGGGAAGG + Intronic
1164846852 19:31439719-31439741 GCCCAGCCCCTAGCTGGGGAAGG + Intergenic
1165004106 19:32790147-32790169 GCCCAACCCCAACATGGGTAAGG - Intronic
1166251633 19:41575656-41575678 CCCCAGCTCCTAGGTGTGGAGGG - Intronic
1166387700 19:42391352-42391374 CCCCAGCTCCAAATTGGGAAGGG + Intergenic
1167101932 19:47409062-47409084 GCCCAGGTGCAGGGTGGGAATGG - Intronic
1167421936 19:49409096-49409118 CTCCAGCCCCAAGGTGGGCAGGG + Intronic
1167503472 19:49859842-49859864 GCCCACCTCCAGGGTGGGTGGGG + Intronic
1168233737 19:55049024-55049046 GCACAGCTCCAAGGTGAGGGTGG + Intronic
925023677 2:590891-590913 GACCAGCTCCTATGTGGGGAAGG + Intergenic
927932308 2:27052948-27052970 GCGCAGCTCCATGGTGGGGCTGG - Exonic
928471905 2:31583154-31583176 GCCCAGCTCCAGGCTGTGTTTGG + Intergenic
930032776 2:47068665-47068687 GCCCAGGGATAAGGTGGGTAGGG - Intronic
933691809 2:85184654-85184676 GCCCATCTTCATGGTGTGTAAGG + Intronic
939839050 2:147165026-147165048 GGCCAGCTCCAAGGTGGGTGAGG + Intergenic
947822809 2:233083746-233083768 GGCCAGCTCCAGGGTGGCCAGGG + Intronic
1170443993 20:16406098-16406120 GCCCAGTTCCTTGGTGGGAAGGG + Intronic
1171461181 20:25298881-25298903 GCCCAGATGCATGGTGGGTGTGG - Intronic
1175985982 20:62764372-62764394 GCCCAGCTCAGAGGTGGGGATGG + Intergenic
1176060145 20:63168961-63168983 GCCAAGCTCCAGGCTGGGTGGGG - Intergenic
1179719558 21:43307456-43307478 AACCAGCTCCGAGGTGGGTGAGG - Intergenic
1180048036 21:45318682-45318704 GCCCAGCTCCAGGGTGAGGCCGG + Intergenic
1180764200 22:18234237-18234259 TCCCATCCCCAATGTGGGTAGGG + Intergenic
1180771442 22:18390304-18390326 TCCCATCCCCAATGTGGGTAGGG - Intergenic
1180802824 22:18639919-18639941 TCCCATCCCCAATGTGGGTAGGG - Intergenic
1180854066 22:19035475-19035497 TCCCATCCCCAATGTGGGTAGGG - Intergenic
1180961169 22:19763044-19763066 GCCAAGCTCCCAGTTGAGTAGGG + Intronic
1181218894 22:21355342-21355364 TCCCATCCCCAATGTGGGTAGGG + Intergenic
1182269938 22:29147054-29147076 GCCCACATCCAAGGAGGGTCAGG + Intronic
1182394465 22:30025468-30025490 GCCCAGGAACAAGCTGGGTAGGG - Intronic
1182469859 22:30542085-30542107 GCCCAGGTCCAGGCTGGGGACGG - Intronic
1183393549 22:37559687-37559709 GCCCACCTCCATGGAGGGCAGGG - Intergenic
1183909210 22:41065899-41065921 GGCCAACTCCAAAGTCGGTAGGG - Intergenic
1184278927 22:43426324-43426346 GCCCACCCCCAAGCTGGGTCTGG + Intronic
1185399770 22:50609792-50609814 GCCCAGCTCCGAGGTGGGGCTGG - Intronic
1203233281 22_KI270731v1_random:131295-131317 TCCCATCCCCAATGTGGGTAGGG - Intergenic
949948690 3:9211417-9211439 CCCCAGCTTCAAGGTGGTTGGGG - Intronic
950128926 3:10528404-10528426 GCCCAGAGGCAAGGTGGGTGGGG - Intronic
954254176 3:49392311-49392333 TCCCAGCTACTGGGTGGGTAAGG + Intronic
954445198 3:50542568-50542590 CCACAGCTCCAAGGAGGGGATGG + Intergenic
954671686 3:52294417-52294439 GCCCAGAGCCCAGGTGGGGAAGG - Intergenic
961370945 3:126431146-126431168 GCCAGGGTCCAAGGTGGGTGGGG + Intronic
961825485 3:129596964-129596986 GCCCAGCCCCAGGATGGGGAGGG + Intronic
963188933 3:142447794-142447816 CCCCAGCTCTAAGGTGGAGAGGG + Intronic
966660778 3:182412091-182412113 GCCAAGCTCCAAGGTGGAACAGG + Intergenic
968903827 4:3442900-3442922 CCCCAGGCCCAAGGTGGGTCAGG + Exonic
970062174 4:12046933-12046955 GGCCAGCTGCAAGATGGGTGAGG + Intergenic
972182045 4:36479008-36479030 CCCCAACTCCAAGATGGGAATGG + Intergenic
973063673 4:45761903-45761925 GCACCGCTCAAAGGTGGGCATGG + Intergenic
975682921 4:76895184-76895206 GCCCAGCTCCATGGTGGCAAGGG + Exonic
975742893 4:77447644-77447666 GCCCAGCTCCCAAGAGGATAAGG + Intergenic
978327313 4:107574072-107574094 GGCCAGCTCTCAGGTGTGTAAGG + Intergenic
980877149 4:138673005-138673027 GCCCTTCTCCACGGTGGCTAAGG + Intergenic
982149645 4:152438770-152438792 GCACATCTCCCATGTGGGTAGGG - Intronic
984325185 4:178242000-178242022 CCCCAGCTTCAAGCTGGGGAAGG + Intergenic
984701177 4:182819643-182819665 GCCCAGATCCACGGAGGGTGGGG + Intergenic
994946848 5:106404981-106405003 CCCTATCTCCAAGGTGGTTAGGG + Intergenic
995239159 5:109866105-109866127 CACCAGCTCCAAGCAGGGTAGGG - Intronic
997591648 5:135076851-135076873 GCCCTGCTGCAAGGTAGGCAGGG + Intronic
998416841 5:141952303-141952325 TCCCTGCTCCAAGTTGGGTTAGG - Intronic
999780007 5:154841653-154841675 TCACATCTCCAAGGTGGATAAGG + Intronic
1005503788 6:26452324-26452346 CCTCAGCTCCAGGGTGGGCAGGG - Exonic
1012386562 6:98689959-98689981 CCCCAGCTTCAAGGGGGGAAGGG - Intergenic
1013586210 6:111581263-111581285 GCCCAGGCCCAAAGGGGGTAAGG + Intronic
1018614758 6:165676537-165676559 GCCCAGCTGGAAGGTGGTGAGGG + Intronic
1020432445 7:8127863-8127885 GCCTCGCTACAAGGTAGGTAAGG - Exonic
1022721794 7:32948261-32948283 GCACCCCTCAAAGGTGGGTATGG - Intergenic
1023830948 7:44038797-44038819 GCCCAGCTCCAAGGTGGGTAAGG - Intergenic
1024255601 7:47537904-47537926 GCCCAGCCCCCAGGTGTGCAAGG - Intronic
1025782362 7:64613070-64613092 ACCCAGCTCCTAGGCAGGTAAGG + Intergenic
1029741282 7:102493106-102493128 GCCCAGCTCCAAGGTGGGTAAGG - Exonic
1029759272 7:102592275-102592297 GCCCAGCTCCAAGGTGGGTAAGG - Exonic
1029776641 7:102688185-102688207 GCCCAGCTCCAAGGTGGGTAAGG - Intergenic
1032756897 7:134899543-134899565 GCACAGCTCTAGGGTGGGTTAGG - Intronic
1037703328 8:21295267-21295289 GCCCTGGCCCAAGGTGGGGAGGG + Intergenic
1039709923 8:40045435-40045457 GCCCAGTTCCTAGGTAGATAAGG - Intergenic
1039919911 8:41886218-41886240 GGGCAGCCCCAAGGTGGATATGG + Intronic
1039966447 8:42287507-42287529 GCCAAGCGCCAGGGTGGGTGGGG + Intronic
1040471325 8:47737890-47737912 GCACAGCTCCAGGGTGGGCACGG + Exonic
1042304492 8:67316952-67316974 CCCCACCTCCAAGGAGGGGAGGG + Intronic
1042560599 8:70070310-70070332 GCCCAGCCCCGAGGTTGGCAGGG - Intronic
1042677864 8:71342456-71342478 GCCCAGCTTCAAGGAGGAGATGG - Intronic
1043758105 8:84029743-84029765 CCCCATCTCCAAGGTGGGGAAGG + Intergenic
1044809879 8:96048962-96048984 GCCCAGCTACTCGGTGGGCAGGG + Intergenic
1045007451 8:97928666-97928688 GTCCAGCCCCAGGCTGGGTAGGG - Intronic
1045506022 8:102779370-102779392 GCCCAGCTCCAAGCTGAAAATGG + Intergenic
1049337166 8:142092587-142092609 GCCCTGCTCCAACGTGGGTTGGG - Intergenic
1049488073 8:142876718-142876740 GACCAGCCCCAAGGTGTGGAAGG - Exonic
1049828461 8:144685282-144685304 GCCCGGCCCCAATGTGGGTGTGG - Intergenic
1050494133 9:6221926-6221948 GCCCAGCTACCAGGTAAGTAAGG + Intronic
1051244555 9:15096737-15096759 GCCCAGTTCCCAGGTAGGAATGG - Intergenic
1051588788 9:18754682-18754704 CCACAGCTCCAAGATGGGCAAGG - Intronic
1052773215 9:32708293-32708315 GCCCAGCTCCAAAGCTGGTGTGG + Intergenic
1053073520 9:35114956-35114978 GCACAGCTCCTAGATGGGCAAGG + Intronic
1056381619 9:86062145-86062167 GCCAAGCTGCAAGGTGGATGGGG - Intronic
1056950324 9:91036319-91036341 GCCCAGCCCCCAGGAGGGGAGGG - Intergenic
1057271641 9:93654844-93654866 GCGCAGCTCCAAGGTGGCCTCGG - Intronic
1057336016 9:94155905-94155927 GCCCAGCACCAAGCTGGGCACGG - Intergenic
1059443249 9:114322858-114322880 GCCCAAGGCCAAGGTGGGTGCGG - Intergenic
1059444441 9:114329629-114329651 GCCCAAGGCCAAGGTGGGTGCGG - Intergenic
1060109269 9:120894778-120894800 TCCCAGCGCCCAGGTGGGTCCGG - Intronic
1060529840 9:124341688-124341710 GCCCAGCTCCTGGGTGGGTTGGG + Intronic
1061237492 9:129351386-129351408 GCCCAGCTCCAACCTGGGGAGGG + Intergenic
1061818075 9:133207999-133208021 GCCCACCTCCAAGGAGGGGCTGG - Intronic
1061962494 9:133995159-133995181 GCCCATCTCCAAGGTGTGATGGG - Intergenic
1062005747 9:134237661-134237683 GCCCTGCTCCATGGTGGGGGTGG + Intergenic
1062242379 9:135547355-135547377 GCCCACCTCCAAGGAGGGGCTGG + Intronic
1062406899 9:136400921-136400943 GCCCACCTCCTAGGTAGGCAGGG - Intergenic
1187298612 X:18026786-18026808 CCCCTCCTCCAAGTTGGGTAGGG + Intergenic
1190284453 X:48952985-48953007 GCCAAGGTCCAAGGTGTGCAAGG + Intronic
1196639075 X:118037773-118037795 GCACAGCTCCAATATGGGGATGG + Intronic
1200062054 X:153488124-153488146 GCCCAGCCCCAAGGAGCGCATGG + Intronic
1200062457 X:153489660-153489682 GCCCAGCCCCAGGGAGGGCACGG - Intronic
1200067266 X:153509860-153509882 GCCCAGCTCCATGGAGTCTAGGG + Intergenic