ID: 1029741283

View in Genome Browser
Species Human (GRCh38)
Location 7:102493111-102493133
Sequence AAGACGCCCAGCTCCAAGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 4, 1: 0, 2: 0, 3: 9, 4: 100}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029741283_1029741286 -10 Left 1029741283 7:102493111-102493133 CCCACCTTGGAGCTGGGCGTCTT 0: 4
1: 0
2: 0
3: 9
4: 100
Right 1029741286 7:102493124-102493146 TGGGCGTCTTCGCGAAGCTGAGG 0: 4
1: 0
2: 0
3: 5
4: 42
1029741283_1029741292 27 Left 1029741283 7:102493111-102493133 CCCACCTTGGAGCTGGGCGTCTT 0: 4
1: 0
2: 0
3: 9
4: 100
Right 1029741292 7:102493161-102493183 GGAGAAGTAGAGCTTCTTGAAGG 0: 4
1: 0
2: 2
3: 7
4: 188
1029741283_1029741290 6 Left 1029741283 7:102493111-102493133 CCCACCTTGGAGCTGGGCGTCTT 0: 4
1: 0
2: 0
3: 9
4: 100
Right 1029741290 7:102493140-102493162 GCTGAGGGCCTCGGTAGTGAGGG 0: 4
1: 0
2: 0
3: 7
4: 146
1029741283_1029741293 30 Left 1029741283 7:102493111-102493133 CCCACCTTGGAGCTGGGCGTCTT 0: 4
1: 0
2: 0
3: 9
4: 100
Right 1029741293 7:102493164-102493186 GAAGTAGAGCTTCTTGAAGGAGG 0: 4
1: 0
2: 0
3: 14
4: 236
1029741283_1029741289 5 Left 1029741283 7:102493111-102493133 CCCACCTTGGAGCTGGGCGTCTT 0: 4
1: 0
2: 0
3: 9
4: 100
Right 1029741289 7:102493139-102493161 AGCTGAGGGCCTCGGTAGTGAGG 0: 4
1: 0
2: 0
3: 10
4: 119
1029741283_1029741287 -9 Left 1029741283 7:102493111-102493133 CCCACCTTGGAGCTGGGCGTCTT 0: 4
1: 0
2: 0
3: 9
4: 100
Right 1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG 0: 4
1: 0
2: 0
3: 0
4: 36
1029741283_1029741288 -3 Left 1029741283 7:102493111-102493133 CCCACCTTGGAGCTGGGCGTCTT 0: 4
1: 0
2: 0
3: 9
4: 100
Right 1029741288 7:102493131-102493153 CTTCGCGAAGCTGAGGGCCTCGG 0: 4
1: 0
2: 0
3: 5
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029741283 Original CRISPR AAGACGCCCAGCTCCAAGGT GGG (reversed) Exonic
900570735 1:3357100-3357122 AGGACCCCCAGCCCCAAGGAAGG + Intronic
901473142 1:9471580-9471602 AACACGCCCAGATCAAGGGTAGG - Intergenic
901711766 1:11121241-11121263 AAAAGCCCCAGCTCCGAGGTAGG - Exonic
902037851 1:13470617-13470639 AAGATGCCCACATCCAAGCTTGG + Intergenic
904774780 1:32900088-32900110 TAGACACCGAGCTCCCAGGTAGG - Intronic
915888990 1:159753495-159753517 AAGAGTCCCAGAGCCAAGGTGGG + Intergenic
915896097 1:159812100-159812122 AAGCCCACCTGCTCCAAGGTTGG - Intronic
916193784 1:162204229-162204251 AAGAAGCCCAGCTGTAATGTAGG - Intronic
919795107 1:201316839-201316861 AAGATGCCCAGCTCTAACCTTGG - Intronic
922957409 1:229615026-229615048 AAGACTGCCAGCTCTAAGTTAGG + Intronic
923916681 1:238514212-238514234 AAGAAGCTCACCTCCATGGTAGG - Intergenic
1062976503 10:1687702-1687724 AAGACCCCCGGGTCCAAGGCTGG + Intronic
1063377240 10:5561640-5561662 ACGACGCCCAGCTTCACTGTGGG + Intergenic
1063578035 10:7279318-7279340 AAGAAGCCCAGGTGCCAGGTGGG + Intronic
1064142065 10:12798975-12798997 AAAATGCCCAGCTCCACGGTGGG + Intronic
1066586868 10:36945274-36945296 AAGATGGCCAGCTGCAAGGTAGG - Intergenic
1068192127 10:53666377-53666399 AGGACACCCAGATCCAAGGGAGG + Intergenic
1069784642 10:70979929-70979951 AAGAGGCCCATCTCTAAGCTCGG + Intergenic
1070790868 10:79188588-79188610 AAGATTCCTAGCTCCAAGCTGGG - Intronic
1076405089 10:130206419-130206441 CACACGCCCAGCTCCCACGTGGG - Intergenic
1076581833 10:131517133-131517155 AAGCCACCCAGCTTCCAGGTAGG - Intergenic
1077125487 11:933678-933700 GAGATGCCCAGCACCAGGGTGGG + Intronic
1077903399 11:6509239-6509261 GAGTAGCCCAGCTCCAAAGTGGG - Exonic
1083304036 11:61753597-61753619 GAGAGGCACAGCTCCAGGGTTGG - Intronic
1083952979 11:65967025-65967047 AGGTTGCCCAGCTCCTAGGTGGG - Intronic
1084311899 11:68321909-68321931 AAGACACCCAGCACCCAGGCTGG - Intronic
1084452368 11:69247002-69247024 AAGACACCCATCTCCAAGCCAGG - Intergenic
1088000964 11:104879838-104879860 AACACACCCATCTCCAAAGTTGG + Intergenic
1094492405 12:30969315-30969337 CAGCCACCCAGCTCCAAGGTGGG + Intronic
1097272573 12:57786209-57786231 AAGCTGCCAAGCTCCAAGGGAGG + Exonic
1099997273 12:89792519-89792541 AAGACGCTCAGCTCCATGCTTGG + Intergenic
1104763527 12:131312433-131312455 AATATGCCCAGCACCACGGTGGG + Intergenic
1104815975 12:131645644-131645666 AATATGCCCAGCACCACGGTGGG - Intergenic
1105884493 13:24630243-24630265 AAGAAGCCAAGCCCCAAGGGAGG + Intergenic
1116251831 14:42495008-42495030 AAGACACCCAACTCCAAACTAGG - Intergenic
1116976080 14:51117437-51117459 AAGCCTGCCAGCTCCAAGTTAGG - Intergenic
1117494482 14:56289240-56289262 ATGAAGGCCAGCTCCAGGGTTGG + Intronic
1127714701 15:61638466-61638488 AAGACGTATAGCTCCAAGTTGGG - Intergenic
1128234746 15:66059798-66059820 AAGAAGCCCGGCTCCCAGGCAGG + Intronic
1128565756 15:68699653-68699675 AAGATCCCTAGCTCCAAGGCGGG - Intronic
1133518263 16:6531020-6531042 AAGAGGCTCACCTGCAAGGTGGG - Intronic
1134442478 16:14307568-14307590 AAAAGGCTCAGCTCCCAGGTGGG - Intergenic
1135795241 16:25435128-25435150 AAGACTCCAACCTTCAAGGTGGG + Intergenic
1139630377 16:68228215-68228237 AAAACACCCAGCTCCAAGAGGGG - Exonic
1145311700 17:21704388-21704410 AAGCAGCCCAGCTCGATGGTGGG + Exonic
1152511759 17:80794793-80794815 CAGAAGCCCATCTCCAAGGGTGG + Intronic
1154141685 18:11829678-11829700 TAAATGCCCAGCTCCTAGGTGGG + Intronic
1155490597 18:26397858-26397880 TAGAAGCCCAAATCCAAGGTCGG + Intergenic
1157885946 18:51366460-51366482 AAGACACCCTTCTTCAAGGTAGG + Intergenic
1160046695 18:75393006-75393028 AAGACTCCCAGCGTCAAGGGAGG + Intergenic
1160256283 18:77250843-77250865 AAGGCGCCCAGCACCCAGGTGGG - Exonic
1160820369 19:1054982-1055004 GAGGCTCCCAGCTCCCAGGTGGG - Intronic
1160851626 19:1195549-1195571 GAGAGGCCCAGGTCCCAGGTGGG - Intronic
1160851650 19:1195623-1195645 GAGAGGCCCAGGTCCCAGGTGGG - Intronic
1160852050 19:1197363-1197385 GAGAGGCCCAGGTCCCAGGTGGG - Intronic
1160852074 19:1197437-1197459 GAGAGGCCCAGGTCCCAGGTGGG - Intronic
1160956362 19:1693915-1693937 ACATCTCCCAGCTCCAAGGTAGG - Intergenic
1163369512 19:16894109-16894131 ATGATGCCCAGCTCCAAGGCTGG + Intronic
1164620495 19:29693051-29693073 AGGACGGCAAGATCCAAGGTGGG + Intergenic
926062383 2:9812522-9812544 GAGACGCCCAGCTCCAGTGGGGG - Intergenic
926304358 2:11627329-11627351 ATGACGACCACCTCCACGGTCGG - Intronic
927095841 2:19747080-19747102 AATGCCCCCACCTCCAAGGTTGG + Intergenic
929584041 2:43102216-43102238 GAGAGGCCCAGGTCCCAGGTCGG + Intergenic
932233857 2:70105584-70105606 GAGATGCCCAGCTCCAAGCCAGG - Intergenic
932307790 2:70716197-70716219 AAAACGCACAGCTCCCAGCTGGG - Intronic
945688898 2:213007942-213007964 AAGGGCCTCAGCTCCAAGGTAGG + Exonic
948695160 2:239729566-239729588 AAGTCACACAGCTCAAAGGTAGG - Intergenic
948801787 2:240436404-240436426 AAGACGCCCAGCTCCAGCCGTGG - Intronic
948913555 2:241018674-241018696 GAGACGCCCTGCTCCCAGGCTGG + Intronic
1169576187 20:6964434-6964456 AAGAGGCCATGCCCCAAGGTTGG - Intergenic
1169894412 20:10487572-10487594 AAGACACCCAGGTCCATGGCTGG - Intronic
1173336218 20:42114218-42114240 AAGTTGCCCAGCTGCAAGGTTGG - Intronic
1175306068 20:57976418-57976440 AGGGAGCCCAGCTCCCAGGTTGG + Intergenic
1177245672 21:18519601-18519623 AAAACTCTCAGGTCCAAGGTTGG + Intergenic
1180186607 21:46143197-46143219 AAGACCCCCAGCCCTAAGTTGGG - Intronic
1183265043 22:36819607-36819629 CAGACACCCAGCACCACGGTTGG - Intergenic
1184022730 22:41832303-41832325 AACACGACCAGCTGCAAGATGGG + Intergenic
1184230297 22:43155098-43155120 CAGACACCCAGCTCAAAGGGAGG + Intronic
952436475 3:33277307-33277329 AAGAGGCCCAGTTCCAGGGCCGG + Intronic
954459944 3:50620626-50620648 AAGAGGCCCAGCTCCCTGGGAGG - Intronic
955557597 3:60154876-60154898 AAGAATCCCAGCACCAAGTTAGG + Intronic
960569910 3:119175569-119175591 GAGATGCCCAGCTCCAGGGCAGG - Intronic
961374239 3:126452101-126452123 AAGATGACCAGGTCCCAGGTCGG + Intronic
968912531 4:3483431-3483453 AAGATGCCCATCTCCAATGCTGG - Intronic
984040735 4:174730258-174730280 AGGAAGCACAGCTCCATGGTTGG + Intronic
988525463 5:31983279-31983301 CGGTCACCCAGCTCCAAGGTAGG - Exonic
990434525 5:55774807-55774829 AAGAAGCTCAACTCCAAGGAGGG - Intronic
996771437 5:127090593-127090615 AAGACGCTTCCCTCCAAGGTAGG + Intergenic
999116556 5:149169265-149169287 GAGAGGGCCAGTTCCAAGGTAGG + Intronic
1002424621 5:179167793-179167815 AAGCCCCCCAGCTCCAAGCTCGG - Intronic
1002761479 6:205789-205811 AAGAAGCCCAGTGCCAGGGTAGG - Intergenic
1005987719 6:30884656-30884678 AAGAGGCCCCGCTCCCGGGTCGG + Intronic
1007830336 6:44633650-44633672 AAGAAGCCCAGCTCTATGGATGG - Intergenic
1013276407 6:108589306-108589328 AAGACTCCCAGCTCCGGGGCAGG - Intronic
1015424848 6:133053690-133053712 AAGACCCCTATCTCTAAGGTTGG + Intergenic
1023139902 7:37091478-37091500 AAGATGCCCAGCTCCTAGCTGGG - Intronic
1023830949 7:44038802-44038824 AAGACGCCCAGCTCCAAGGTGGG - Intergenic
1027252642 7:76408694-76408716 TACCCTCCCAGCTCCAAGGTGGG + Intronic
1029741283 7:102493111-102493133 AAGACGCCCAGCTCCAAGGTGGG - Exonic
1029759273 7:102592280-102592302 AAGACGCCCAGCTCCAAGGTGGG - Exonic
1029776642 7:102688190-102688212 AAGACGCCCAGCTCCAAGGTGGG - Intergenic
1036432196 8:8701947-8701969 CAGCCGCCCGGCTGCAAGGTGGG + Exonic
1045649249 8:104327170-104327192 AAGATGCCCACCTGCATGGTAGG + Intergenic
1045663674 8:104464522-104464544 AACACTCCCACCTGCAAGGTGGG - Intronic
1049805411 8:144536600-144536622 AAGAGGGCCAGCTGCAATGTAGG - Intronic
1055643794 9:78343759-78343781 TCCACACCCAGCTCCAAGGTGGG - Intergenic
1056665211 9:88576394-88576416 TAGACCCCCAGCTCCCACGTGGG + Intronic
1060842121 9:126801973-126801995 CAGACGCCCACCACCACGGTTGG + Intergenic
1061594566 9:131620615-131620637 AGGACTCCCAACTCCAAGCTTGG + Intronic
1062620150 9:137416969-137416991 AACACGCCCAACTCCACGGGAGG + Intronic
1188100263 X:26073963-26073985 AGGAGGCCCTGCCCCAAGGTTGG + Intergenic
1196797385 X:119513200-119513222 AAGATGCCAAGGTCCCAGGTGGG + Intergenic
1200327873 X:155261421-155261443 AAGATGCCCATCTCAAAGTTTGG - Intronic