ID: 1029741284

View in Genome Browser
Species Human (GRCh38)
Location 7:102493112-102493134
Sequence GAAGACGCCCAGCTCCAAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 4, 1: 0, 2: 1, 3: 9, 4: 147}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029741284_1029741288 -4 Left 1029741284 7:102493112-102493134 CCACCTTGGAGCTGGGCGTCTTC 0: 4
1: 0
2: 1
3: 9
4: 147
Right 1029741288 7:102493131-102493153 CTTCGCGAAGCTGAGGGCCTCGG 0: 4
1: 0
2: 0
3: 5
4: 117
1029741284_1029741287 -10 Left 1029741284 7:102493112-102493134 CCACCTTGGAGCTGGGCGTCTTC 0: 4
1: 0
2: 1
3: 9
4: 147
Right 1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG 0: 4
1: 0
2: 0
3: 0
4: 36
1029741284_1029741290 5 Left 1029741284 7:102493112-102493134 CCACCTTGGAGCTGGGCGTCTTC 0: 4
1: 0
2: 1
3: 9
4: 147
Right 1029741290 7:102493140-102493162 GCTGAGGGCCTCGGTAGTGAGGG 0: 4
1: 0
2: 0
3: 7
4: 146
1029741284_1029741289 4 Left 1029741284 7:102493112-102493134 CCACCTTGGAGCTGGGCGTCTTC 0: 4
1: 0
2: 1
3: 9
4: 147
Right 1029741289 7:102493139-102493161 AGCTGAGGGCCTCGGTAGTGAGG 0: 4
1: 0
2: 0
3: 10
4: 119
1029741284_1029741293 29 Left 1029741284 7:102493112-102493134 CCACCTTGGAGCTGGGCGTCTTC 0: 4
1: 0
2: 1
3: 9
4: 147
Right 1029741293 7:102493164-102493186 GAAGTAGAGCTTCTTGAAGGAGG 0: 4
1: 0
2: 0
3: 14
4: 236
1029741284_1029741292 26 Left 1029741284 7:102493112-102493134 CCACCTTGGAGCTGGGCGTCTTC 0: 4
1: 0
2: 1
3: 9
4: 147
Right 1029741292 7:102493161-102493183 GGAGAAGTAGAGCTTCTTGAAGG 0: 4
1: 0
2: 2
3: 7
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029741284 Original CRISPR GAAGACGCCCAGCTCCAAGG TGG (reversed) Exonic
900202795 1:1418913-1418935 GATGGCCCCCAGCTCCCAGGAGG - Exonic
900372424 1:2337899-2337921 GAAGAGACCCAGCTCCAGGATGG + Intronic
901080529 1:6581267-6581289 GAAGGTGCCCAGCTGCAGGGCGG + Exonic
901096178 1:6682041-6682063 GAATAGGCCCAGGTCCCAGGAGG + Intronic
901449448 1:9327003-9327025 CAAGACCCCCAGGTGCAAGGAGG - Intronic
901491202 1:9597256-9597278 GAAGCAGCTCAGCTCCAACGGGG - Intronic
902528085 1:17072297-17072319 AAAGATGCCCAGCTACAAGCCGG + Intronic
903352673 1:22727392-22727414 GAAGCCCCACAGCTCCCAGGGGG + Intronic
904382161 1:30118964-30118986 GAGAAACCCCAGCTCCAAGGAGG - Intergenic
905016641 1:34782549-34782571 GAAGTCGCCCAGCTACTAAGTGG + Intronic
906524951 1:46488505-46488527 CAAGCAGCCCAGCTCCCAGGAGG + Intergenic
907414424 1:54304422-54304444 GAAGACGCCCTGGTCCTTGGAGG - Intronic
915311653 1:155008374-155008396 GAATTCGGCCAGCTCCCAGGGGG + Intronic
915448392 1:155988149-155988171 GAAGACGGCCACACCCAAGGGGG - Intronic
916052526 1:161046282-161046304 AAAGACGCCCTGCGCCAAGATGG - Intergenic
916147127 1:161749984-161750006 GGAGGAGCCCAGCTTCAAGGCGG + Exonic
916533645 1:165682217-165682239 GAACACATCCAGCTCCCAGGTGG - Exonic
921054235 1:211532074-211532096 GAAGACGCCCTGCACCAGAGAGG - Intergenic
1063825711 10:9895646-9895668 GGAGAGGACCAGCTGCAAGGGGG - Intergenic
1064142064 10:12798974-12798996 GAAAATGCCCAGCTCCACGGTGG + Intronic
1064962679 10:20983100-20983122 GGATAGGCCCAGCTCCAAGTTGG - Intronic
1070050306 10:72882497-72882519 GAAGACGGCCACACCCAAGGGGG - Intronic
1070790869 10:79188589-79188611 GAAGATTCCTAGCTCCAAGCTGG - Intronic
1071094963 10:81962779-81962801 GAGCAAGACCAGCTCCAAGGAGG - Intronic
1073678573 10:105677736-105677758 GAAGACGGCCACACCCAAGGGGG - Intergenic
1074983841 10:118640511-118640533 GAAGACGGCCACACCCAAGGGGG + Intergenic
1077797783 11:5509459-5509481 GAAGACGCCCAAAGACAAGGAGG - Exonic
1077903400 11:6509240-6509262 GGAGTAGCCCAGCTCCAAAGTGG - Exonic
1078205968 11:9229648-9229670 GAAGACCCTCAGCTCCAGCGGGG + Intronic
1082811802 11:57482940-57482962 GCAGACGCCCTTCTCCTAGGAGG + Intergenic
1083785099 11:64940373-64940395 GAAGCCCCCCAGCTCCCAGAAGG - Intronic
1085047735 11:73363210-73363232 GGAGACCCCGAGTTCCAAGGAGG + Exonic
1085901395 11:80703838-80703860 GAAGATGGCCAGCTACAAGTAGG + Intergenic
1085910303 11:80816810-80816832 GAAGAGGACCTGCTCCAAAGAGG - Intergenic
1086399067 11:86446140-86446162 GAAGAAGTCAAGCTTCAAGGTGG + Intronic
1089628897 11:119771160-119771182 GAGGACCCCCAGCTCCAGAGAGG - Intergenic
1093074745 12:14746141-14746163 GAAGACGGCCACACCCAAGGGGG + Intergenic
1094411729 12:30174212-30174234 GAAGACGGCCACACCCAAGGGGG - Intergenic
1094492404 12:30969314-30969336 TCAGCCACCCAGCTCCAAGGTGG + Intronic
1095472115 12:42548485-42548507 GAAGACACCCATCTAGAAGGGGG + Intronic
1096188509 12:49599525-49599547 GAGCGCGCCCAGCTCCATGGTGG + Exonic
1096675863 12:53225534-53225556 GAAGGCGCCCTGCTTCCAGGAGG - Intronic
1096740260 12:53688342-53688364 GAAGACATCCAGCTGCAAGCTGG - Intergenic
1102655938 12:114482228-114482250 GAAACCTCCCAGCACCAAGGAGG + Intergenic
1106785774 13:33106851-33106873 GAGGAAGCCCAGCTCCTGGGTGG - Exonic
1106861461 13:33913218-33913240 GAAACCACCCAGCTCCTAGGTGG - Intronic
1108598840 13:51973290-51973312 AAAGAAGCCCAAATCCAAGGAGG + Intronic
1108730758 13:53233035-53233057 AAAGACTCCCAGATCCAAGCAGG - Intergenic
1110090917 13:71446760-71446782 AAAGAAGCCCTGCTCCCAGGAGG - Intronic
1113815405 13:113166563-113166585 GAAGCCACCCAGCTCCAAGGTGG + Intronic
1119400616 14:74359863-74359885 GAAGACGCTCAGCAGAAAGGTGG - Exonic
1119696818 14:76719884-76719906 GCAGACGCACAGAGCCAAGGAGG + Intergenic
1120443590 14:84566430-84566452 GAAAAGGCCCAGCTCCAGGATGG + Intergenic
1121950327 14:98166076-98166098 GCTGAGGCCCAGCTGCAAGGTGG + Intergenic
1122090963 14:99340209-99340231 GAAGACCTTCAGCTTCAAGGAGG + Intergenic
1124412636 15:29449197-29449219 GAAGCTGCCAAGCTCAAAGGAGG + Intronic
1125999328 15:44194793-44194815 GAAGACGCCCTGCACTAGGGCGG + Intronic
1128251498 15:66167121-66167143 CAAGATGCCCAGCTCCATGGTGG - Intronic
1128565757 15:68699654-68699676 CAAGATCCCTAGCTCCAAGGCGG - Intronic
1129150522 15:73684927-73684949 GAAAACGCCCAGCTCCGGGAGGG + Intronic
1136021852 16:27445535-27445557 AAAGTCACACAGCTCCAAGGTGG + Intronic
1138372257 16:56536500-56536522 GACGACGCCCCCCTCCAAGTGGG - Intergenic
1139630378 16:68228216-68228238 GAAAACACCCAGCTCCAAGAGGG - Exonic
1140406740 16:74716534-74716556 GAAGACGCCGATCACCAGGGAGG + Exonic
1141764132 16:86047442-86047464 GAAGACGCTGAGGTCCTAGGGGG + Intergenic
1142278902 16:89137658-89137680 GAAGAGCCCCAGGTCCCAGGAGG + Intronic
1143324753 17:6091517-6091539 GAAGGGGCCCAGCTCAAAGGAGG + Intronic
1143424494 17:6823598-6823620 GAAGATGCCCATCTACATGGTGG - Intronic
1144021379 17:11241875-11241897 ACAGACGCCCAGCACCAAGGTGG + Exonic
1144156677 17:12510997-12511019 GTAGACGGCGAGCTCCAGGGAGG - Intergenic
1144448257 17:15352025-15352047 GTAAACACCCAGCTCAAAGGTGG + Intergenic
1145311699 17:21704387-21704409 GAAGCAGCCCAGCTCGATGGTGG + Exonic
1151815431 17:76469341-76469363 TGCGACGCCCAGCTCCAGGGAGG + Intronic
1159574214 18:70156272-70156294 GAAGACGGCCACACCCAAGGGGG - Intronic
1160256284 18:77250844-77250866 GAAGGCGCCCAGCACCCAGGTGG - Exonic
1160789930 19:918616-918638 GAAGTCGCCCAGCACCCAGCCGG - Exonic
1160851627 19:1195550-1195572 GGAGAGGCCCAGGTCCCAGGTGG - Intronic
1160851651 19:1195624-1195646 GGAGAGGCCCAGGTCCCAGGTGG - Intronic
1160852051 19:1197364-1197386 GGAGAGGCCCAGGTCCCAGGTGG - Intronic
1160852075 19:1197438-1197460 GGAGAGGCCCAGGTCCCAGGTGG - Intronic
1163654643 19:18538595-18538617 CAAGTCCCGCAGCTCCAAGGCGG - Intronic
1164286585 19:23822564-23822586 GAACAGGGCCAGGTCCAAGGGGG - Intronic
1164549625 19:29198321-29198343 GAAGACGGCCACACCCAAGGGGG + Intergenic
1165798802 19:38535165-38535187 GGAGATGCCCAGCTTCAGGGTGG - Exonic
1166558941 19:43719367-43719389 GATGACGCCCAACACCAGGGCGG - Exonic
926062384 2:9812523-9812545 GGAGACGCCCAGCTCCAGTGGGG - Intergenic
926305365 2:11634117-11634139 GAGAACTCCCTGCTCCAAGGAGG - Exonic
927858315 2:26541176-26541198 GGAGGGGCCCTGCTCCAAGGTGG + Intronic
933760165 2:85667220-85667242 GGAGGCTCCCAGCTCCAATGGGG + Intronic
937062491 2:118990942-118990964 GAAGGGGCACAGCTCCATGGCGG - Intronic
938065592 2:128280415-128280437 GGAGACGACCCGCTCCCAGGAGG + Intronic
940342813 2:152599123-152599145 GAAGACGTCCCTCTCCAATGTGG - Intronic
940948572 2:159646137-159646159 GAAGACGGCCACACCCAAGGGGG + Intergenic
944244974 2:197521608-197521630 GAAGACGGCCATACCCAAGGGGG + Intronic
945066680 2:205953447-205953469 GAAGACGGCCACACCCAAGGGGG + Intergenic
1173922832 20:46758898-46758920 GAAGTCGCTCATCGCCAAGGGGG + Intergenic
1174418257 20:50382186-50382208 GAAGAAGCCAAGGTTCAAGGAGG - Intergenic
1175349514 20:58308863-58308885 GAAGTCACCCACCTCCCAGGTGG + Intergenic
1178014583 21:28329196-28329218 GAAGACGGCCACACCCAAGGGGG + Intergenic
1178342389 21:31796922-31796944 TAAGAAGCCCAGGTCAAAGGAGG - Intergenic
1179003150 21:37482754-37482776 GAAGACGGCCACACCCAAGGGGG + Intronic
1179792688 21:43764594-43764616 GAAGACCCCGAGCCCCAGGGAGG - Intergenic
1181786055 22:25228047-25228069 CCAGACCTCCAGCTCCAAGGTGG - Intronic
1184760633 22:46542154-46542176 GAGGGCGCCGAGCTCCCAGGAGG - Intergenic
1185320623 22:50198774-50198796 CAAGACACCCAGCTCCGAGGGGG + Exonic
1185398276 22:50603574-50603596 GAGGAGGGCCAGCTCCCAGGGGG - Intronic
949772620 3:7595630-7595652 GAATACTCCCACCTCCAAGATGG - Intronic
955054500 3:55443759-55443781 GCAGACTTCCAGCTCCAAGAGGG + Intergenic
955755199 3:62218875-62218897 TAAGCCGCCCTGCTCCAGGGAGG + Exonic
961698149 3:128720916-128720938 GAAGACGGCCACACCCAAGGGGG - Intergenic
962290410 3:134131557-134131579 GAAGACGGCCACACCCAAGGGGG + Intronic
963176586 3:142304117-142304139 GAAGACGGCCACACCCAAGGGGG + Intergenic
967412788 3:189183562-189183584 GAAGACGACCACACCCAAGGGGG + Intronic
969502146 4:7559626-7559648 GAGGAGGCACAGGTCCAAGGGGG + Intronic
969526314 4:7705878-7705900 GCAGGCGCACAGCTCCCAGGAGG + Intronic
977473495 4:97473379-97473401 GAAGACGGCCACACCCAAGGGGG - Intronic
979555438 4:122041387-122041409 GAAGACGCCCAGTTGCTAGCTGG + Intergenic
982807858 4:159789047-159789069 GAAGACGGCCACACCCAAGGGGG - Intergenic
985696646 5:1344794-1344816 GAACACGCCCACCACCAAGCTGG + Exonic
988094194 5:26581925-26581947 GAACATGCCCAACTACAAGGAGG - Intergenic
988547784 5:32174271-32174293 AAACACCCCGAGCTCCAAGGCGG + Exonic
989317871 5:40103466-40103488 GAAGACGGCCACACCCAAGGGGG - Intergenic
989572297 5:42955766-42955788 GAAGACGGCCACACCCAAGGGGG + Intergenic
990434526 5:55774808-55774830 CAAGAAGCTCAACTCCAAGGAGG - Intronic
998391008 5:141787012-141787034 GAAAAGGCCCAGCTCCCTGGAGG - Intergenic
998940006 5:147271657-147271679 GAAGACGGCCACACCCAAGGGGG - Intronic
1001911285 5:175520584-175520606 GCACATGCCCACCTCCAAGGTGG + Intronic
1003220098 6:4153561-4153583 GAAGAACCGCAGCTCCAAGAAGG - Intergenic
1003577872 6:7314227-7314249 GAAAAAGCACAGCTCTAAGGAGG - Intronic
1007588822 6:43009086-43009108 CAAGACCCACAGCCCCAAGGAGG + Exonic
1011878461 6:91992350-91992372 GAAGATGGCCACATCCAAGGGGG + Intergenic
1015318174 6:131841292-131841314 GAAGACTCCCAGCACCAGGCTGG + Intronic
1016962398 6:149686553-149686575 GAAGAAAACCAGCTTCAAGGAGG - Intronic
1017852215 6:158314539-158314561 GAAGACGCCCAGCAGTAGGGAGG + Intronic
1018167122 6:161108513-161108535 GAAGAGGCCCTGCTCCGAGAGGG - Intronic
1018899718 6:168044951-168044973 GAAGCCGCCCAGCTCCCAAACGG + Exonic
1020803520 7:12760565-12760587 GAAGACGGCCACACCCAAGGGGG + Intergenic
1022200688 7:28114198-28114220 GAGCATGGCCAGCTCCAAGGAGG - Intronic
1023139903 7:37091479-37091501 GAAGATGCCCAGCTCCTAGCTGG - Intronic
1023830950 7:44038803-44038825 GAAGACGCCCAGCTCCAAGGTGG - Intergenic
1029741284 7:102493112-102493134 GAAGACGCCCAGCTCCAAGGTGG - Exonic
1029759274 7:102592281-102592303 GAAGACGCCCAGCTCCAAGGTGG - Exonic
1029776643 7:102688191-102688213 GAAGACGCCCAGCTCCAAGGTGG - Intergenic
1030699515 7:112622601-112622623 GAGGAGACCCAGCTCCCAGGTGG + Intergenic
1037579451 8:20235985-20236007 GAAGACCCCCAGCACCCTGGGGG - Intergenic
1039575315 8:38618960-38618982 GAAGACTCCAAGCTCAAAAGAGG + Intergenic
1045663675 8:104464523-104464545 GAACACTCCCACCTGCAAGGTGG - Intronic
1048820242 8:138373739-138373761 GAAGACGGCCACACCCAAGGGGG - Intronic
1048978050 8:139684060-139684082 AAAGAAGCCCAGGTCCCAGGTGG + Intronic
1049749453 8:144276437-144276459 GAGAACACCCAGCTCTAAGGGGG + Intronic
1051099806 9:13507641-13507663 CAAGAATCCCAGCTCCAAGTGGG - Intergenic
1053440118 9:38109141-38109163 GTAGATGCCCAGCTAGAAGGGGG + Intergenic
1054774059 9:69109760-69109782 AAAGATGCCCACCTCCTAGGTGG - Intergenic
1058419791 9:104822624-104822646 GGACACGCCCAGCTTCAAGTGGG + Exonic
1062730508 9:138105713-138105735 GAACATGCCCATCTCCAACGAGG + Exonic
1185647008 X:1623149-1623171 AAACACGCCCAGCTCGCAGGCGG - Exonic
1190616287 X:52236478-52236500 GAAGACGGCCACACCCAAGGGGG - Intergenic
1194101966 X:89717180-89717202 GAAGACGGCCACACCCAAGGGGG - Intergenic
1195785265 X:108512949-108512971 GAAGACGGCCACACCCAAGGGGG + Intronic
1196610970 X:117714438-117714460 GAAGACACCCATCCCCAGGGAGG + Intergenic
1197364734 X:125549563-125549585 GAAGACGGCCACACCCAAGGGGG + Intergenic