ID: 1029741286

View in Genome Browser
Species Human (GRCh38)
Location 7:102493124-102493146
Sequence TGGGCGTCTTCGCGAAGCTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 4, 1: 0, 2: 0, 3: 5, 4: 42}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029741274_1029741286 13 Left 1029741274 7:102493088-102493110 CCACTTGCCGGCCTCCCTCCTTA 0: 4
1: 0
2: 0
3: 18
4: 275
Right 1029741286 7:102493124-102493146 TGGGCGTCTTCGCGAAGCTGAGG 0: 4
1: 0
2: 0
3: 5
4: 42
1029741283_1029741286 -10 Left 1029741283 7:102493111-102493133 CCCACCTTGGAGCTGGGCGTCTT 0: 4
1: 0
2: 0
3: 9
4: 100
Right 1029741286 7:102493124-102493146 TGGGCGTCTTCGCGAAGCTGAGG 0: 4
1: 0
2: 0
3: 5
4: 42
1029741279_1029741286 -2 Left 1029741279 7:102493103-102493125 CCTCCTTACCCACCTTGGAGCTG 0: 4
1: 0
2: 0
3: 14
4: 239
Right 1029741286 7:102493124-102493146 TGGGCGTCTTCGCGAAGCTGAGG 0: 4
1: 0
2: 0
3: 5
4: 42
1029741282_1029741286 -5 Left 1029741282 7:102493106-102493128 CCTTACCCACCTTGGAGCTGGGC 0: 4
1: 0
2: 1
3: 21
4: 202
Right 1029741286 7:102493124-102493146 TGGGCGTCTTCGCGAAGCTGAGG 0: 4
1: 0
2: 0
3: 5
4: 42
1029741270_1029741286 25 Left 1029741270 7:102493076-102493098 CCTCTCAGAGCCCCACTTGCCGG 0: 4
1: 0
2: 1
3: 13
4: 170
Right 1029741286 7:102493124-102493146 TGGGCGTCTTCGCGAAGCTGAGG 0: 4
1: 0
2: 0
3: 5
4: 42
1029741269_1029741286 29 Left 1029741269 7:102493072-102493094 CCGGCCTCTCAGAGCCCCACTTG 0: 4
1: 0
2: 2
3: 35
4: 440
Right 1029741286 7:102493124-102493146 TGGGCGTCTTCGCGAAGCTGAGG 0: 4
1: 0
2: 0
3: 5
4: 42
1029741277_1029741286 2 Left 1029741277 7:102493099-102493121 CCTCCCTCCTTACCCACCTTGGA 0: 4
1: 0
2: 1
3: 33
4: 374
Right 1029741286 7:102493124-102493146 TGGGCGTCTTCGCGAAGCTGAGG 0: 4
1: 0
2: 0
3: 5
4: 42
1029741272_1029741286 15 Left 1029741272 7:102493086-102493108 CCCCACTTGCCGGCCTCCCTCCT 0: 4
1: 0
2: 2
3: 70
4: 617
Right 1029741286 7:102493124-102493146 TGGGCGTCTTCGCGAAGCTGAGG 0: 4
1: 0
2: 0
3: 5
4: 42
1029741278_1029741286 -1 Left 1029741278 7:102493102-102493124 CCCTCCTTACCCACCTTGGAGCT 0: 4
1: 0
2: 3
3: 15
4: 236
Right 1029741286 7:102493124-102493146 TGGGCGTCTTCGCGAAGCTGAGG 0: 4
1: 0
2: 0
3: 5
4: 42
1029741275_1029741286 6 Left 1029741275 7:102493095-102493117 CCGGCCTCCCTCCTTACCCACCT 0: 4
1: 0
2: 6
3: 191
4: 2870
Right 1029741286 7:102493124-102493146 TGGGCGTCTTCGCGAAGCTGAGG 0: 4
1: 0
2: 0
3: 5
4: 42
1029741273_1029741286 14 Left 1029741273 7:102493087-102493109 CCCACTTGCCGGCCTCCCTCCTT 0: 4
1: 0
2: 5
3: 41
4: 778
Right 1029741286 7:102493124-102493146 TGGGCGTCTTCGCGAAGCTGAGG 0: 4
1: 0
2: 0
3: 5
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029741286 Original CRISPR TGGGCGTCTTCGCGAAGCTG AGG Exonic
900431757 1:2606043-2606065 TGGGCCTCCTGGCCAAGCTGGGG - Intronic
906511728 1:46413867-46413889 TGGGCGTCATCGTGAGGGTGGGG + Intergenic
907444603 1:54499681-54499703 CGGGCGTCTGCGGGAGGCTGGGG + Intergenic
1067336770 10:45373409-45373431 TGGGCGGCTTCCCGCGGCTGGGG - Intergenic
1078852481 11:15177437-15177459 TGTGGGTCTTCCCAAAGCTGTGG - Intronic
1083222024 11:61258806-61258828 TGGGGGTCTTCGAGGGGCTGGGG + Exonic
1083872446 11:65497532-65497554 TGGCCGCCTTCCCGGAGCTGTGG - Intergenic
1090402289 11:126456577-126456599 TGGTGGTCTTCAGGAAGCTGGGG + Intronic
1101759355 12:107646122-107646144 TGGGGGCCTCCGCGAAGCTGTGG + Intronic
1105775956 13:23660424-23660446 TGGGCATATTCGTGGAGCTGAGG - Exonic
1114614160 14:24059530-24059552 TGGGGGTCTTCTGGAAGCTGGGG - Intronic
1116868594 14:50051149-50051171 TCGGTGTGTTCGTGAAGCTGTGG + Intergenic
1125674040 15:41493373-41493395 GGGGCTTCTTCGGGAAGCCGGGG + Intronic
1125814984 15:42576171-42576193 TGGGCTTCTCTGCGAAGATGTGG + Intronic
1131636745 15:94241054-94241076 TCGTGGTCTTCGAGAAGCTGGGG + Intronic
1134290960 16:12902564-12902586 TGGGCATCTTCACCAAGCTGGGG + Exonic
1142829667 17:2539176-2539198 TGGTTGTCTTTGGGAAGCTGTGG - Intergenic
1146058657 17:29593417-29593439 CGGGCGTCCTCGCGAGGCGGCGG - Intronic
1148654765 17:49274990-49275012 TGGGGGTCTGCGTGCAGCTGTGG + Intergenic
1148736051 17:49865497-49865519 TGGGCGTCTGGGAGACGCTGGGG + Intergenic
1151449084 17:74186450-74186472 TTGGAGTCTTCTCCAAGCTGTGG - Intergenic
932220046 2:69992239-69992261 TCGGCGTCTTCGCCTAGCCGAGG + Intergenic
935736493 2:106110718-106110740 TGGTGGTCTTCTGGAAGCTGGGG + Intronic
938922562 2:136008538-136008560 TGTGCTTCTTCTCCAAGCTGTGG - Intergenic
1173454272 20:43190404-43190426 GGGGCGTCTGCCCAAAGCTGGGG + Intergenic
1179155529 21:38847765-38847787 TGGGCGACTTCCAGAAGCTCAGG - Intergenic
1181757210 22:25032403-25032425 TGGGTGTCTTCCCCCAGCTGGGG + Intronic
1182690603 22:32159005-32159027 TCGGCGTCTTCGGGAGGCTGAGG + Exonic
1183303732 22:37070973-37070995 TGGGCTTCTTCACGCAGCTCCGG + Exonic
950861516 3:16151407-16151429 TGGGTGTCTTGGAGAAGCTGGGG - Intergenic
956367709 3:68522823-68522845 TGGGCGACTTTGGGAGGCTGAGG + Intronic
961827309 3:129605931-129605953 CGGGCGTGTTCTCGAAGCGGTGG + Exonic
976130788 4:81881950-81881972 TGGGCGTCTTTGTGAAGTTAAGG - Intronic
980985124 4:139687612-139687634 TGGGCTTCTTGGCTATGCTGAGG - Intronic
985567048 5:624297-624319 TGGGCATCGCCGGGAAGCTGTGG + Intronic
997642440 5:135458120-135458142 TGGGCTTCTACGTAAAGCTGTGG + Intergenic
1002286381 5:178165272-178165294 TGGGCGCCTGCGGGAGGCTGAGG + Intergenic
1002526684 5:179819277-179819299 AGGGAGTCTTTGGGAAGCTGGGG - Intronic
1002691447 5:181053284-181053306 TGGGCGTCCTCCGGAAGCAGCGG + Exonic
1011603403 6:89080608-89080630 TGTGTGTCTACCCGAAGCTGCGG + Intergenic
1023405527 7:39829934-39829956 TGGGCGTACTCGGGAGGCTGAGG - Intergenic
1023830952 7:44038815-44038837 TGGGCGTCTTCGCGAAGCTGAGG + Intergenic
1029741286 7:102493124-102493146 TGGGCGTCTTCGCGAAGCTGAGG + Exonic
1029759276 7:102592293-102592315 TGGGCGTCTTCGCGAAGCTGAGG + Exonic
1029776645 7:102688203-102688225 TGGGCGTCTTCGCGAAGCTGAGG + Intergenic
1037281190 8:17244692-17244714 TGGATGTGTTCGGGAAGCTGGGG - Intronic
1049430743 8:142563017-142563039 TGGGCTTCTTCGTGAAGCCCTGG - Intergenic
1049801261 8:144518364-144518386 GGGGCGTCTTCGCGAAACGCAGG + Intronic
1051279037 9:15423010-15423032 TGGGCGCCTTTGGGGAGCTGTGG + Exonic
1055396165 9:75877429-75877451 TGGGCGGATTGCCGAAGCTGAGG + Intergenic
1060428984 9:123532034-123532056 TGTGCATCTTGGCTAAGCTGGGG + Intronic