ID: 1029741287

View in Genome Browser
Species Human (GRCh38)
Location 7:102493125-102493147
Sequence GGGCGTCTTCGCGAAGCTGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 4, 1: 0, 2: 0, 3: 0, 4: 36}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029741269_1029741287 30 Left 1029741269 7:102493072-102493094 CCGGCCTCTCAGAGCCCCACTTG 0: 4
1: 0
2: 2
3: 35
4: 440
Right 1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG 0: 4
1: 0
2: 0
3: 0
4: 36
1029741279_1029741287 -1 Left 1029741279 7:102493103-102493125 CCTCCTTACCCACCTTGGAGCTG 0: 4
1: 0
2: 0
3: 14
4: 239
Right 1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG 0: 4
1: 0
2: 0
3: 0
4: 36
1029741284_1029741287 -10 Left 1029741284 7:102493112-102493134 CCACCTTGGAGCTGGGCGTCTTC 0: 4
1: 0
2: 1
3: 9
4: 147
Right 1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG 0: 4
1: 0
2: 0
3: 0
4: 36
1029741275_1029741287 7 Left 1029741275 7:102493095-102493117 CCGGCCTCCCTCCTTACCCACCT 0: 4
1: 0
2: 6
3: 191
4: 2870
Right 1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG 0: 4
1: 0
2: 0
3: 0
4: 36
1029741274_1029741287 14 Left 1029741274 7:102493088-102493110 CCACTTGCCGGCCTCCCTCCTTA 0: 4
1: 0
2: 0
3: 18
4: 275
Right 1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG 0: 4
1: 0
2: 0
3: 0
4: 36
1029741278_1029741287 0 Left 1029741278 7:102493102-102493124 CCCTCCTTACCCACCTTGGAGCT 0: 4
1: 0
2: 3
3: 15
4: 236
Right 1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG 0: 4
1: 0
2: 0
3: 0
4: 36
1029741283_1029741287 -9 Left 1029741283 7:102493111-102493133 CCCACCTTGGAGCTGGGCGTCTT 0: 4
1: 0
2: 0
3: 9
4: 100
Right 1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG 0: 4
1: 0
2: 0
3: 0
4: 36
1029741272_1029741287 16 Left 1029741272 7:102493086-102493108 CCCCACTTGCCGGCCTCCCTCCT 0: 4
1: 0
2: 2
3: 70
4: 617
Right 1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG 0: 4
1: 0
2: 0
3: 0
4: 36
1029741273_1029741287 15 Left 1029741273 7:102493087-102493109 CCCACTTGCCGGCCTCCCTCCTT 0: 4
1: 0
2: 5
3: 41
4: 778
Right 1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG 0: 4
1: 0
2: 0
3: 0
4: 36
1029741282_1029741287 -4 Left 1029741282 7:102493106-102493128 CCTTACCCACCTTGGAGCTGGGC 0: 4
1: 0
2: 1
3: 21
4: 202
Right 1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG 0: 4
1: 0
2: 0
3: 0
4: 36
1029741270_1029741287 26 Left 1029741270 7:102493076-102493098 CCTCTCAGAGCCCCACTTGCCGG 0: 4
1: 0
2: 1
3: 13
4: 170
Right 1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG 0: 4
1: 0
2: 0
3: 0
4: 36
1029741277_1029741287 3 Left 1029741277 7:102493099-102493121 CCTCCCTCCTTACCCACCTTGGA 0: 4
1: 0
2: 1
3: 33
4: 374
Right 1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG 0: 4
1: 0
2: 0
3: 0
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029741287 Original CRISPR GGGCGTCTTCGCGAAGCTGA GGG Exonic
900412624 1:2519814-2519836 GGCCGACTTCCCGAAGCTGCTGG + Exonic
901623946 1:10612823-10612845 TGGCTTCTGAGCGAAGCTGATGG + Intronic
901726005 1:11242621-11242643 GGGTGTCTTCGCTAAGGCGAGGG - Intronic
907444604 1:54499682-54499704 GGGCGTCTGCGGGAGGCTGGGGG + Intergenic
917679935 1:177355337-177355359 GGGGGTCTGTGCCAAGCTGAAGG + Intergenic
923520891 1:234734341-234734363 GGGCTTCTTGGCAAAGGTGACGG + Intergenic
1083331742 11:61901667-61901689 GGGTGTCCTCTAGAAGCTGAGGG + Intronic
1101759356 12:107646123-107646145 GGGGGCCTCCGCGAAGCTGTGGG + Intronic
1102681994 12:114697127-114697149 AGGCGTCTTTGCAAAGCTGGTGG - Intergenic
1104885521 12:132104859-132104881 GGGCGTCCTCTCGAAGCCCAGGG - Exonic
1105258875 13:18763991-18764013 GGGGGTCTTAGCTAAGATGATGG - Intergenic
1105261542 13:18783295-18783317 GGGGGTCTTAGCCAAGATGATGG - Intergenic
1114656111 14:24316545-24316567 GGGCTTCGTCGCCAAGCTGCTGG + Exonic
1119400620 14:74359876-74359898 GAGCGTCTTCTCGGAGCTGGAGG + Exonic
1125674041 15:41493374-41493396 GGGCTTCTTCGGGAAGCCGGGGG + Intronic
1129263981 15:74384166-74384188 GGGCTTTTTCACCAAGCTGATGG + Intergenic
1129452110 15:75656960-75656982 AGGCGCCTTCGCCAAGGTGAAGG + Exonic
1131829204 15:96343712-96343734 GGGCTTCTAGGCGAAGCTAATGG + Intergenic
1132665465 16:1079492-1079514 GGGCTTCTTCGCGCCGCTGCTGG + Exonic
1137558732 16:49489616-49489638 GGGAGTCTTCTAGAAGATGATGG + Exonic
1154432174 18:14316741-14316763 GGGGGTCTTAGCCAAGATGATGG + Intergenic
1168297386 19:55384076-55384098 CGGCGTGTTCGCGCAGCTGCAGG - Exonic
928093281 2:28389591-28389613 TGGCCTCTTCTCTAAGCTGAGGG + Intergenic
932220047 2:69992240-69992262 CGGCGTCTTCGCCTAGCCGAGGG + Intergenic
932317823 2:70797830-70797852 GGGCCTCTTCACGAGGCTGTAGG - Intergenic
946168457 2:217879480-217879502 GGGTGTCTTGGCCAATCTGAGGG + Intronic
948826466 2:240575564-240575586 GAGCTTCTTCCCGGAGCTGAAGG + Exonic
1179155528 21:38847764-38847786 GGGCGACTTCCAGAAGCTCAGGG - Intergenic
1181082723 22:20425325-20425347 GGGCGGCGCTGCGAAGCTGAGGG + Exonic
1184028705 22:41878012-41878034 GAGCGTCTTTGTGAAGCTGCTGG + Exonic
965774125 3:172210191-172210213 GGGCGGCTTCGTGGAGCTGGCGG - Intronic
976130787 4:81881949-81881971 GGGCGTCTTTGTGAAGTTAAGGG - Intronic
980985123 4:139687611-139687633 GGGCTTCTTGGCTATGCTGAGGG - Intronic
1003117192 6:3290866-3290888 GGGAGACTTCCCGAAGCGGAGGG + Intronic
1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029759277 7:102592294-102592316 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1062106218 9:134756471-134756493 TGGCGTCTTCTCGAAGCCCAGGG + Intronic
1200057733 X:153470449-153470471 GGAGGTGTTCGGGAAGCTGAAGG - Exonic