ID: 1029741288

View in Genome Browser
Species Human (GRCh38)
Location 7:102493131-102493153
Sequence CTTCGCGAAGCTGAGGGCCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 4, 1: 0, 2: 0, 3: 5, 4: 117}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029741283_1029741288 -3 Left 1029741283 7:102493111-102493133 CCCACCTTGGAGCTGGGCGTCTT 0: 4
1: 0
2: 0
3: 9
4: 100
Right 1029741288 7:102493131-102493153 CTTCGCGAAGCTGAGGGCCTCGG 0: 4
1: 0
2: 0
3: 5
4: 117
1029741282_1029741288 2 Left 1029741282 7:102493106-102493128 CCTTACCCACCTTGGAGCTGGGC 0: 4
1: 0
2: 1
3: 21
4: 202
Right 1029741288 7:102493131-102493153 CTTCGCGAAGCTGAGGGCCTCGG 0: 4
1: 0
2: 0
3: 5
4: 117
1029741279_1029741288 5 Left 1029741279 7:102493103-102493125 CCTCCTTACCCACCTTGGAGCTG 0: 4
1: 0
2: 0
3: 14
4: 239
Right 1029741288 7:102493131-102493153 CTTCGCGAAGCTGAGGGCCTCGG 0: 4
1: 0
2: 0
3: 5
4: 117
1029741275_1029741288 13 Left 1029741275 7:102493095-102493117 CCGGCCTCCCTCCTTACCCACCT 0: 4
1: 0
2: 6
3: 191
4: 2870
Right 1029741288 7:102493131-102493153 CTTCGCGAAGCTGAGGGCCTCGG 0: 4
1: 0
2: 0
3: 5
4: 117
1029741284_1029741288 -4 Left 1029741284 7:102493112-102493134 CCACCTTGGAGCTGGGCGTCTTC 0: 4
1: 0
2: 1
3: 9
4: 147
Right 1029741288 7:102493131-102493153 CTTCGCGAAGCTGAGGGCCTCGG 0: 4
1: 0
2: 0
3: 5
4: 117
1029741273_1029741288 21 Left 1029741273 7:102493087-102493109 CCCACTTGCCGGCCTCCCTCCTT 0: 4
1: 0
2: 5
3: 41
4: 778
Right 1029741288 7:102493131-102493153 CTTCGCGAAGCTGAGGGCCTCGG 0: 4
1: 0
2: 0
3: 5
4: 117
1029741285_1029741288 -7 Left 1029741285 7:102493115-102493137 CCTTGGAGCTGGGCGTCTTCGCG 0: 4
1: 0
2: 0
3: 4
4: 84
Right 1029741288 7:102493131-102493153 CTTCGCGAAGCTGAGGGCCTCGG 0: 4
1: 0
2: 0
3: 5
4: 117
1029741272_1029741288 22 Left 1029741272 7:102493086-102493108 CCCCACTTGCCGGCCTCCCTCCT 0: 4
1: 0
2: 2
3: 70
4: 617
Right 1029741288 7:102493131-102493153 CTTCGCGAAGCTGAGGGCCTCGG 0: 4
1: 0
2: 0
3: 5
4: 117
1029741278_1029741288 6 Left 1029741278 7:102493102-102493124 CCCTCCTTACCCACCTTGGAGCT 0: 4
1: 0
2: 3
3: 15
4: 236
Right 1029741288 7:102493131-102493153 CTTCGCGAAGCTGAGGGCCTCGG 0: 4
1: 0
2: 0
3: 5
4: 117
1029741274_1029741288 20 Left 1029741274 7:102493088-102493110 CCACTTGCCGGCCTCCCTCCTTA 0: 4
1: 0
2: 0
3: 18
4: 275
Right 1029741288 7:102493131-102493153 CTTCGCGAAGCTGAGGGCCTCGG 0: 4
1: 0
2: 0
3: 5
4: 117
1029741277_1029741288 9 Left 1029741277 7:102493099-102493121 CCTCCCTCCTTACCCACCTTGGA 0: 4
1: 0
2: 1
3: 33
4: 374
Right 1029741288 7:102493131-102493153 CTTCGCGAAGCTGAGGGCCTCGG 0: 4
1: 0
2: 0
3: 5
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029741288 Original CRISPR CTTCGCGAAGCTGAGGGCCT CGG Exonic
903849811 1:26299214-26299236 CATTGAAAAGCTGAGGGCCTGGG + Intronic
908850728 1:68373348-68373370 CTGCGGGAAGCTGGGGGTCTTGG + Intergenic
909541946 1:76801404-76801426 CTATGCCAAGCTCAGGGCCTTGG + Intergenic
909928891 1:81472380-81472402 CTTTGCGAGGCCGAGGGCCGAGG + Intronic
910609098 1:89121156-89121178 CTGCTCGACACTGAGGGCCTGGG - Exonic
920938415 1:210457527-210457549 CTTCCTGAAGCTGAGGGAATTGG + Intronic
922331649 1:224582154-224582176 CTTTGACATGCTGAGGGCCTGGG + Intronic
923126503 1:231039314-231039336 CTTCGCGGGGCTGAGGGACCCGG + Intronic
1067062845 10:43086840-43086862 CATCGTGCAGCTTAGGGCCTGGG + Intronic
1071660889 10:87501668-87501690 CTTCGGGAAGCTGAGGTGCGTGG - Intergenic
1075223676 10:120605924-120605946 CCTTGCCCAGCTGAGGGCCTGGG - Intergenic
1075759269 10:124843456-124843478 CTTTGCGAAGCTGAGGCACGTGG + Intergenic
1077017393 11:403091-403113 CTCCGCGAAGGTGAGCGCATCGG - Exonic
1081492991 11:43581519-43581541 CTTCGGGAAGGTGCGGGCTTCGG - Intronic
1081901843 11:46635247-46635269 CTTTGGGAAGCTGAGGGCAGGGG - Intronic
1082903639 11:58283413-58283435 CTTCAGGCACCTGAGGGCCTGGG - Intergenic
1083363025 11:62124365-62124387 CTCTAGGAAGCTGAGGGCCTAGG - Intronic
1085546620 11:77324414-77324436 CTTCGCGAGGCTGAGGCCAGTGG - Intronic
1091301552 11:134510997-134511019 CTTGGTAAAGCTGAGGGCATTGG + Intergenic
1091445746 12:543425-543447 CTTCCCGGAGCTGAGGAGCTGGG + Intronic
1091445802 12:543635-543657 CTTCCCGGAGCTGAGGAGCTGGG + Intronic
1091445846 12:543803-543825 CTTCCCGGAGCTGAGGAGCTGGG + Intronic
1091445857 12:543845-543867 CTTCCCGGAGCTGAGGAGCTGGG + Intronic
1091445902 12:544013-544035 CTTCCCGGAGCTGAGGAGCTGGG + Intronic
1095330444 12:40955263-40955285 CTTCTAGAAGCTGAGGGCAATGG + Intronic
1096688961 12:53307786-53307808 GATGGAGAAGCTGAGGGCCTTGG - Intronic
1104287721 12:127440256-127440278 CTTCCTGAAGCTGAGGACCAAGG + Intergenic
1111584165 13:90262455-90262477 CTTCGCAAAGCTGAGGGGTATGG + Intergenic
1113931102 13:113969393-113969415 CTCAGGGAAGCTGATGGCCTTGG - Intergenic
1114560983 14:23590238-23590260 CTTGGCGAGGCTGAGGGTCAAGG + Intergenic
1119777412 14:77257684-77257706 CTTGGCCAAGCTGGGGGCCCAGG - Exonic
1127828309 15:62726062-62726084 CTTTGCAAAGCTGTGGGCCCAGG - Intronic
1128377802 15:67089817-67089839 CTTGGAGAGGCTGAGGGACTTGG + Intronic
1128462207 15:67879039-67879061 CTCCCCCAAGCTGGGGGCCTGGG - Intergenic
1130576050 15:85094104-85094126 CTTTGGGAAGCTGAGGGAGTAGG - Intronic
1133328672 16:4958038-4958060 TTCCCCGAGGCTGAGGGCCTTGG + Intronic
1134097863 16:11431023-11431045 CTTCAAGAGGGTGAGGGCCTGGG - Exonic
1136238803 16:28931964-28931986 CTGCGCGAAGCTGGGTGCCCCGG + Exonic
1139362205 16:66406841-66406863 CTTCGGGAAGGTGGGGGACTAGG - Intergenic
1141940553 16:87273319-87273341 CTTGGTGAGGCTGAGGGACTAGG - Intronic
1142259492 16:89036185-89036207 CTCAGCGAAGCTGGGGGCCTGGG - Intergenic
1143736384 17:8914571-8914593 CTCCGCAAAGCTGAGGGCAGAGG + Intronic
1146894938 17:36534458-36534480 CTTCGCCCAGCTGAGGACCCCGG - Intronic
1147193418 17:38749711-38749733 AGCCGCGAAGCTGGGGGCCTCGG + Exonic
1148784749 17:50140611-50140633 CTTCCTGAAGCTCAGGGGCTTGG - Intronic
1151249455 17:72822498-72822520 CCACGTGAAGCTGAGGGCATAGG - Intronic
1151270394 17:72990531-72990553 CCTCGCGAGGCTGAGGGCTGAGG - Intronic
1153883588 18:9442485-9442507 CTTCGGGAAGCTGAGGCCAGCGG - Intergenic
1156771584 18:40733808-40733830 CTTTGGGAAGCTGAGGGGGTTGG - Intergenic
1157722557 18:49936686-49936708 CTTCCTAAACCTGAGGGCCTGGG + Intronic
1158743395 18:60168783-60168805 GTGAGCGAAGCTGAAGGCCTAGG - Intergenic
1160793806 19:934702-934724 CTCCGAGAAGATGAGGGCCTAGG + Intronic
1163059087 19:14745151-14745173 CTTTGGGAAGCTGAGGGGCGGGG - Intronic
1163104535 19:15115813-15115835 CTGAGGGAAGCTTAGGGCCTGGG - Intronic
1165172445 19:33903596-33903618 CTTTGGGAAGCTGAGGGCCGGGG - Intergenic
1165431936 19:35777819-35777841 CCTCGAGGAGCTGAGAGCCTGGG - Exonic
1165507873 19:36245811-36245833 CTTCGCCCAGCTGCGGGCCTCGG + Intronic
1166411691 19:42559940-42559962 CTTTGCCCAGATGAGGGCCTGGG + Intronic
925571948 2:5321778-5321800 CTTCCCCAACCTGAGGCCCTTGG - Intergenic
927488702 2:23506272-23506294 CTTCGCGAAGTTGAAGGCACAGG + Intronic
930156181 2:48110007-48110029 CTTTGCTAAGTTCAGGGCCTAGG + Intergenic
931427218 2:62182235-62182257 CTGAGAGAAGCAGAGGGCCTAGG - Intergenic
933727197 2:85433666-85433688 CTGTGAGCAGCTGAGGGCCTCGG - Intronic
934768968 2:96895908-96895930 CTCCCAGAAGCTGAGGCCCTGGG - Intronic
937258603 2:120571539-120571561 CTTCTCAAAGCTGGGGCCCTGGG + Intergenic
938753701 2:134360703-134360725 TTTTGAGAAGCTGAGGGCATAGG - Intronic
943069574 2:183124689-183124711 CGCCGGGAAGCTGAGGGCCCTGG + Intronic
946160336 2:217831816-217831838 CAGCGAGAAGCTAAGGGCCTAGG - Intronic
946614755 2:221497493-221497515 CTTTGAGAAGCTGAGGTCCATGG + Intronic
947724243 2:232387547-232387569 CTTCCCGCAGCTGAGGCCCCAGG - Intergenic
1170692707 20:18629544-18629566 CTTTGGGAGGCTGAGGCCCTAGG - Intronic
1172884738 20:38223453-38223475 CTTCGAGAAGGGGACGGCCTGGG - Intronic
1174622692 20:51888316-51888338 CTTCGGGAAGCCGAGGGCGGAGG + Intergenic
1180341851 22:11626461-11626483 CTTTGGGAGGCTGAGGCCCTAGG + Intergenic
1181943815 22:26499482-26499504 CAGCGCGAAGCCGGGGGCCTTGG + Exonic
1182659678 22:31916435-31916457 CTTTGCAAAGCTGACTGCCTCGG - Intergenic
949336616 3:2981799-2981821 CTTCGGGAGGCTGAGGCCCTCGG + Intronic
949597013 3:5558695-5558717 CTTCACTAAACTGAGGGCATGGG - Intergenic
953676835 3:45009310-45009332 CTTGGTGGAGCTGAGAGCCTTGG + Intronic
953691008 3:45119455-45119477 CTCCGGGCAGCTGATGGCCTGGG + Intronic
954659911 3:52221537-52221559 CTTTGAGAACCTGTGGGCCTCGG - Exonic
956719487 3:72105402-72105424 CTCCCAGAAGCTGGGGGCCTAGG - Intergenic
960785846 3:121372208-121372230 CTTAGCCAGGCTGGGGGCCTGGG + Intronic
962543697 3:136409975-136409997 CCTTGGGAGGCTGAGGGCCTGGG + Intronic
963608847 3:147439843-147439865 CTTCGGGAAGCTGAGGCCAGTGG - Intronic
968865146 4:3204722-3204744 CTTTGAGAAGCTGAGGGCGGAGG + Intronic
968896730 4:3408667-3408689 CCTCGGGAAGCTGAGGAGCTGGG + Intronic
969799125 4:9548746-9548768 CTTTGAGAAGCTGAGGGCGGTGG + Intergenic
976168699 4:82281901-82281923 CTTCGGGAGGCTGAGGGGGTCGG + Intergenic
983844987 4:172506859-172506881 CTTCAGGAAGCCAAGGGCCTTGG - Intronic
984764419 4:183388823-183388845 CTTTGTGAAGCTCAGGGCTTTGG - Intergenic
986761361 5:10882773-10882795 GTTCTCGAAGCTGAGACCCTGGG + Intergenic
987916094 5:24216656-24216678 CTTCTAAAAACTGAGGGCCTCGG - Intergenic
991376790 5:65976228-65976250 CTTTGGGAAGCTGAGGTGCTTGG + Intronic
992561532 5:77957683-77957705 CTCCCCGGAGCTGGGGGCCTCGG + Intergenic
999327458 5:150651934-150651956 CTTCGCAAGGCTGGGGGCCGAGG + Exonic
1004275094 6:14229190-14229212 CTTGGCCAGGCTGAGTGCCTTGG + Intergenic
1005874042 6:29997975-29997997 CTTCCTGTAGCTGAGGGGCTGGG - Intergenic
1006517982 6:34555310-34555332 CTGGGGGAAGCTGAGAGCCTTGG - Intronic
1006907640 6:37543878-37543900 CTTGGCGTAGCAGATGGCCTAGG - Intergenic
1015876534 6:137828336-137828358 CTTCTCTTAGCTGAGGGCCAGGG - Intergenic
1018116827 6:160594544-160594566 CTTCAAGAAGCTGAAGGCTTTGG - Intronic
1021144451 7:17067533-17067555 CTTCCCCAAACTGAGAGCCTTGG - Intergenic
1022156093 7:27663029-27663051 CTTCGCACAGCTGCGGACCTGGG - Intergenic
1023830954 7:44038822-44038844 CTTCGCGAAGCTGAGGGCCTCGG + Intergenic
1029741288 7:102493131-102493153 CTTCGCGAAGCTGAGGGCCTCGG + Exonic
1029759278 7:102592300-102592322 CTTCGCGAAGCTGAGGGCCTCGG + Exonic
1029776647 7:102688210-102688232 CTTCGCGAAGCTGAGGGCCTCGG + Intergenic
1032727847 7:134607664-134607686 CTTCAGGCAGCTGAGAGCCTGGG - Intergenic
1033260674 7:139841237-139841259 CTTCGAGAAGCAGAAGGTCTTGG + Intronic
1033598330 7:142871825-142871847 CTTCGAGACACTGAGGGCATAGG + Exonic
1035665871 8:1379269-1379291 CTTAGCGAAGATGTGGCCCTCGG - Intergenic
1039078115 8:33710668-33710690 CATGGGGAAACTGAGGGCCTAGG + Intergenic
1040711732 8:50196711-50196733 CTTCGAGAAGCTGAGGCCGGTGG + Intronic
1049665095 8:143839496-143839518 CTGCGCTCAGGTGAGGGCCTGGG - Exonic
1049955597 9:689810-689832 CTACCCCACGCTGAGGGCCTGGG - Intronic
1050641729 9:7675618-7675640 CTTCGGGAAGCTGAGGGAGGAGG + Intergenic
1053073580 9:35115137-35115159 CTTCCCTAAGCTGAGGTCCCGGG - Intronic
1056600645 9:88044153-88044175 CCTCGCGATGCTGAGAGTCTGGG + Intergenic
1057530778 9:95843989-95844011 CTTTGGGAAGCTGAGGCCGTTGG - Intergenic
1185808685 X:3084448-3084470 CTTTGGGAAGCTGAGCGGCTGGG + Exonic
1189120057 X:38385019-38385041 CTTTGGGAAGCCGAGGGGCTGGG + Intronic
1190234852 X:48607474-48607496 ATTCGGGAAGCTGAGGCCCGAGG - Exonic
1192232682 X:69276910-69276932 CTTCTGGAGGCTGAGGGCCAAGG - Intergenic
1192659748 X:73029760-73029782 CTTCTGGAACCTGATGGCCTAGG + Intergenic
1195072723 X:101296049-101296071 CTTCGGGAAGCTGAGGCCGGTGG + Intergenic