ID: 1029741289

View in Genome Browser
Species Human (GRCh38)
Location 7:102493139-102493161
Sequence AGCTGAGGGCCTCGGTAGTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 4, 1: 0, 2: 0, 3: 10, 4: 119}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029741284_1029741289 4 Left 1029741284 7:102493112-102493134 CCACCTTGGAGCTGGGCGTCTTC 0: 4
1: 0
2: 1
3: 9
4: 147
Right 1029741289 7:102493139-102493161 AGCTGAGGGCCTCGGTAGTGAGG 0: 4
1: 0
2: 0
3: 10
4: 119
1029741273_1029741289 29 Left 1029741273 7:102493087-102493109 CCCACTTGCCGGCCTCCCTCCTT 0: 4
1: 0
2: 5
3: 41
4: 778
Right 1029741289 7:102493139-102493161 AGCTGAGGGCCTCGGTAGTGAGG 0: 4
1: 0
2: 0
3: 10
4: 119
1029741279_1029741289 13 Left 1029741279 7:102493103-102493125 CCTCCTTACCCACCTTGGAGCTG 0: 4
1: 0
2: 0
3: 14
4: 239
Right 1029741289 7:102493139-102493161 AGCTGAGGGCCTCGGTAGTGAGG 0: 4
1: 0
2: 0
3: 10
4: 119
1029741274_1029741289 28 Left 1029741274 7:102493088-102493110 CCACTTGCCGGCCTCCCTCCTTA 0: 4
1: 0
2: 0
3: 18
4: 275
Right 1029741289 7:102493139-102493161 AGCTGAGGGCCTCGGTAGTGAGG 0: 4
1: 0
2: 0
3: 10
4: 119
1029741285_1029741289 1 Left 1029741285 7:102493115-102493137 CCTTGGAGCTGGGCGTCTTCGCG 0: 4
1: 0
2: 0
3: 4
4: 84
Right 1029741289 7:102493139-102493161 AGCTGAGGGCCTCGGTAGTGAGG 0: 4
1: 0
2: 0
3: 10
4: 119
1029741278_1029741289 14 Left 1029741278 7:102493102-102493124 CCCTCCTTACCCACCTTGGAGCT 0: 4
1: 0
2: 3
3: 15
4: 236
Right 1029741289 7:102493139-102493161 AGCTGAGGGCCTCGGTAGTGAGG 0: 4
1: 0
2: 0
3: 10
4: 119
1029741277_1029741289 17 Left 1029741277 7:102493099-102493121 CCTCCCTCCTTACCCACCTTGGA 0: 4
1: 0
2: 1
3: 33
4: 374
Right 1029741289 7:102493139-102493161 AGCTGAGGGCCTCGGTAGTGAGG 0: 4
1: 0
2: 0
3: 10
4: 119
1029741272_1029741289 30 Left 1029741272 7:102493086-102493108 CCCCACTTGCCGGCCTCCCTCCT 0: 4
1: 0
2: 2
3: 70
4: 617
Right 1029741289 7:102493139-102493161 AGCTGAGGGCCTCGGTAGTGAGG 0: 4
1: 0
2: 0
3: 10
4: 119
1029741283_1029741289 5 Left 1029741283 7:102493111-102493133 CCCACCTTGGAGCTGGGCGTCTT 0: 4
1: 0
2: 0
3: 9
4: 100
Right 1029741289 7:102493139-102493161 AGCTGAGGGCCTCGGTAGTGAGG 0: 4
1: 0
2: 0
3: 10
4: 119
1029741282_1029741289 10 Left 1029741282 7:102493106-102493128 CCTTACCCACCTTGGAGCTGGGC 0: 4
1: 0
2: 1
3: 21
4: 202
Right 1029741289 7:102493139-102493161 AGCTGAGGGCCTCGGTAGTGAGG 0: 4
1: 0
2: 0
3: 10
4: 119
1029741275_1029741289 21 Left 1029741275 7:102493095-102493117 CCGGCCTCCCTCCTTACCCACCT 0: 4
1: 0
2: 6
3: 191
4: 2870
Right 1029741289 7:102493139-102493161 AGCTGAGGGCCTCGGTAGTGAGG 0: 4
1: 0
2: 0
3: 10
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029741289 Original CRISPR AGCTGAGGGCCTCGGTAGTG AGG Exonic
903014650 1:20354028-20354050 AGCTGTGGGCCACGGTGGTGGGG + Exonic
903849812 1:26299222-26299244 AGCTGAGGGCCTGGGTGCAGTGG + Intronic
906508968 1:46400448-46400470 CGGTGAGGGCCTTGGTAGAGGGG + Intronic
915515329 1:156409388-156409410 AGGTGAGGGCCTTGGTGCTGGGG + Intronic
918204778 1:182299183-182299205 ATCTGAGGGCCTTAGTACTGAGG - Intergenic
922326807 1:224535825-224535847 AGCTGGGGACAGCGGTAGTGTGG + Intronic
923525449 1:234769084-234769106 AGCCTAGGGCCCCAGTAGTGCGG - Intergenic
1067835977 10:49642028-49642050 AGCTGACAGCTTTGGTAGTGTGG - Intronic
1075719543 10:124576697-124576719 AGCTGAGGGCGGGGGTACTGGGG + Intronic
1076572162 10:131439918-131439940 AGCTGAGGGCCACGCAGGTGTGG + Intergenic
1077010411 11:376874-376896 GGCTGGGGGCCTCGGCTGTGTGG - Exonic
1077416600 11:2426949-2426971 AGCTGAGGGCGAAGGGAGTGGGG - Intergenic
1077909932 11:6564719-6564741 AGATGAGGGCCTCGTTGCTGGGG - Exonic
1080594765 11:33761797-33761819 AGCTGAGGGCCTCAGTCCTAAGG - Intronic
1081596107 11:44460738-44460760 AGCTGAGGCCTTTGGTAGAGGGG + Intergenic
1082810576 11:57476828-57476850 AGCGCAGGGCCTCGGGAGTCCGG - Exonic
1083184174 11:61007945-61007967 GGCTGAAGGCCTGGGGAGTGGGG - Intronic
1083363023 11:62124357-62124379 AGCTGAGGGCCTAGGTGGAAAGG - Intronic
1085392105 11:76187561-76187583 AGCCGGGGGCCTGGGTGGTGGGG - Intronic
1085921032 11:80957361-80957383 AGCTGGGGGCCTCTGTTGAGTGG + Intergenic
1090798717 11:130157265-130157287 AGATGAGGCCCTAGGAAGTGGGG + Intergenic
1091289348 11:134428730-134428752 TGCTGAGGACCTAGGTAGAGTGG - Intergenic
1091408519 12:223971-223993 AGGTGAGGGCCTGGGAAGCGGGG - Exonic
1093577347 12:20748413-20748435 AGTTGAGGGCTTTGGGAGTGAGG - Intronic
1097661399 12:62435331-62435353 CCCCGAGGGCCTCGGTATTGCGG + Intergenic
1101599000 12:106192320-106192342 AGTTGAGGGGCTTGGGAGTGTGG + Intergenic
1102587431 12:113933087-113933109 AGGTGAGGGTCTTGGTTGTGGGG + Intronic
1104858559 12:131913120-131913142 AGCAGAGAGCCTCGGTGGGGTGG + Intronic
1105303036 13:19152155-19152177 AGGTGAGGCCCTGGGTGGTGGGG - Intergenic
1114240940 14:20867300-20867322 GGCTGTGGGCCTCAGTTGTGGGG + Intergenic
1114549634 14:23525510-23525532 ACCTGAGGCCCTCGGGGGTGGGG - Exonic
1118348243 14:64955326-64955348 AGCTGAAGGCCCAGGTTGTGTGG - Intronic
1118785654 14:69043669-69043691 AGACGAGGGCCTCGGTGGGGTGG - Intergenic
1118920292 14:70143822-70143844 AGCTCAGAGCCTGGGTAGAGGGG - Intronic
1121636100 14:95454918-95454940 AGCAGAGGCCCACGGTGGTGGGG - Intronic
1122422780 14:101587964-101587986 AGCTGAGGCCTGGGGTAGTGGGG - Intergenic
1122826555 14:104373621-104373643 AGGTGAGGGCCACGGCAGTGGGG + Intergenic
1122902325 14:104786986-104787008 AGCTGAGGGCCTGGGCAGGTGGG + Intronic
1123121147 14:105917730-105917752 AGGTGAGGGCATGGGCAGTGTGG + Intergenic
1125698662 15:41660743-41660765 AGCTGAGCGACGCGGAAGTGAGG - Intronic
1126543047 15:49843046-49843068 AGCTGGTGGCCTGGGGAGTGAGG - Intergenic
1128252073 15:66170784-66170806 AGCTGAGGGCCGTGCTTGTGGGG - Intronic
1129270230 15:74415705-74415727 TGCTGAGGGCCTCCCTGGTGTGG - Intronic
1130147829 15:81288064-81288086 AGGTGAGGGCCTTGAGAGTGAGG + Intronic
1131645586 15:94338667-94338689 AGCTGAGGGCCTGGCTGATGTGG + Intronic
1138555054 16:57766097-57766119 ATCTGAGGGCCCAGATAGTGGGG + Intronic
1139431273 16:66912221-66912243 AGGTGAGGGCCTGGGTAGCTGGG - Exonic
1141843078 16:86586955-86586977 AGCTGAGAGCCCCTGCAGTGAGG + Intergenic
1143378097 17:6479060-6479082 AGCTGAGGACCCAGCTAGTGTGG + Intronic
1143471282 17:7177542-7177564 AGCTCAGGGCCTCGGTGGGATGG - Intronic
1145867527 17:28250528-28250550 AACTAAGGGCCTCGGGACTGGGG - Intergenic
1149296890 17:55269033-55269055 AGCTGAGGGCCTTAGCTGTGGGG + Intronic
1156476638 18:37409706-37409728 AGCTGAGGGACATGGTAGGGAGG + Intronic
1160803129 19:979691-979713 AGCTGAGGGCCTCAGAGGCGGGG + Intergenic
1163144187 19:15369708-15369730 TGCTGTGGGCCTCTGTGGTGGGG - Intronic
1164137742 19:22428654-22428676 AGCTGGGGGCCCCGGCAGGGCGG + Intronic
1164148289 19:22526673-22526695 AGCTGTTGGCCTCGGTAAAGGGG - Intronic
1166327921 19:42062557-42062579 AGCTGACGTCCTCGTTACTGGGG + Exonic
926798416 2:16638005-16638027 TGCTGAGGGCCTGGGTAACGGGG + Intronic
926994751 2:18722402-18722424 TGCTGAGGGCCTGGCTACTGAGG + Intergenic
927578280 2:24218997-24219019 AGCTGAGGGCCAGGCTGGTGAGG - Intronic
931917172 2:66969019-66969041 AGCTGGGGGCCTCTCAAGTGAGG - Intergenic
933727194 2:85433658-85433680 AGCTGAGGGCCTCGGGCAGGAGG - Intronic
937608211 2:123826998-123827020 AGCTGCCGGCCTGGGCAGTGAGG - Intergenic
938289104 2:130140158-130140180 AGGTGAGGCCCTGGGTGGTGGGG - Exonic
938317431 2:130339829-130339851 AGCAGAGGGCCTGGGGAGTATGG - Intronic
938467424 2:131532780-131532802 AGGTGAGGCCCTGGGTGGTGGGG + Exonic
938756557 2:134385540-134385562 AGCTGAGGGCTTCTGAAGTCAGG - Intronic
940334744 2:152514081-152514103 AGCTGAGGGCCTCAGCAGGGTGG - Intronic
940388521 2:153103411-153103433 AGCTGGGGGCCTATGTAGAGTGG - Intergenic
942449760 2:176101372-176101394 AGGGGAGGGGCTGGGTAGTGGGG + Intergenic
1170956977 20:20990425-20990447 AGTTGAAGACCTCAGTAGTGTGG - Intergenic
1170967725 20:21090686-21090708 AGATGAGGTCCTTGGTGGTGAGG + Intergenic
1172983301 20:38961803-38961825 TGCTGTGGGCCCAGGTAGTGCGG - Intergenic
1173495484 20:43514784-43514806 AGCTCAGGGCCTGGGGAGCGGGG - Intronic
1173617723 20:44413837-44413859 AGGTGAGCTCCTCTGTAGTGTGG - Intronic
1173648779 20:44650265-44650287 GGCTGGGGGCATCAGTAGTGGGG + Intronic
1174565754 20:51463360-51463382 AGCTGTGGGCCTCGGTGGCGGGG + Intronic
1175857383 20:62129526-62129548 AGCTCAGGGCTTTGGGAGTGGGG + Intronic
1176064882 20:63189151-63189173 AGATGAGGACCTCGGCAGGGGGG + Intergenic
1176083901 20:63287198-63287220 AGCTGAGGGCGTCGCTCGGGAGG + Intronic
1177591805 21:23180223-23180245 AGTTGAGGGACTAGGAAGTGGGG + Intergenic
1181020886 22:20101729-20101751 ACCTGAGAGCCTCGCTAGGGAGG - Intronic
1181108390 22:20587808-20587830 AGGTGAGGCCCTGGGTGGTGGGG - Intergenic
1182012593 22:27012758-27012780 AGCTGTGGACCTCAGTGGTGGGG + Intergenic
953751194 3:45609800-45609822 ATCTGAGCTCCTTGGTAGTGGGG + Intronic
954642823 3:52112033-52112055 AGCTGAGGACATCAGTAGTAAGG - Intronic
955325010 3:58003256-58003278 AACTGAGGGCCTTGGTCGTGGGG + Intergenic
955368905 3:58333507-58333529 AGCTGAGGGTCTGGGTGATGGGG + Intronic
964344922 3:155745374-155745396 GCCAGAGGGCCTCGGTGGTGGGG + Intergenic
967782070 3:193450834-193450856 AGCTGAGGCCCTGAGTTGTGAGG + Intronic
970557174 4:17246000-17246022 TGCTGAGGGCCTGGGTACAGTGG - Intergenic
975734493 4:77367878-77367900 GGCTGAGGGCCACAGTAGTCCGG + Intronic
985627037 5:994426-994448 AGCTCAGGGCCCAGGAAGTGGGG + Intergenic
996351034 5:122542116-122542138 AGCTGAGGACTTTGGCAGTGAGG - Intergenic
1002302740 5:178266740-178266762 AGCTCAGGGCCGCGGAGGTGCGG + Intronic
1004289526 6:14353461-14353483 AGCTCAGGGTCTAGGTAGTCAGG - Intergenic
1006400093 6:33812770-33812792 CTCTCAGGGCCTCGGCAGTGAGG + Intergenic
1011837865 6:91456418-91456440 AGTTGAGGGACTCAGTAGTTGGG - Intergenic
1012401090 6:98843441-98843463 AGCTGAGGGCCCGGAAAGTGAGG + Intergenic
1016454357 6:144215710-144215732 ATATGAGGTCCTGGGTAGTGGGG + Intergenic
1023830955 7:44038830-44038852 AGCTGAGGGCCTCGGTAGTGAGG + Intergenic
1024266529 7:47611089-47611111 GGCAGAGGGGCACGGTAGTGGGG - Intergenic
1028658043 7:93232842-93232864 AGCTGATAGCCTGGGTAGGGTGG + Intronic
1029741289 7:102493139-102493161 AGCTGAGGGCCTCGGTAGTGAGG + Exonic
1029759279 7:102592308-102592330 AGCTGAGGGCCTCGGTAGTGAGG + Exonic
1029776648 7:102688218-102688240 AGCTGAGGGCCTCGGTAGTGAGG + Intergenic
1035006142 7:155662603-155662625 AGCTGAGTGCCTGGGAACTGGGG + Intronic
1035287995 7:157818574-157818596 AGCTGGGGGCCTCGGTGTCGTGG - Intronic
1035750237 8:1991163-1991185 TGCTGTGGGCCTCTGTAGTTTGG + Intronic
1036796756 8:11761667-11761689 AGCTGGGGGGCTCTGCAGTGCGG - Exonic
1037965382 8:23129918-23129940 AGCTGAGGGAGCCGGTACTGAGG - Intergenic
1039612780 8:38932569-38932591 AGCTGAGGGCCTGGTTAGCCAGG - Intronic
1040020521 8:42736949-42736971 AGCAGCAGGCCTCGGTGGTGGGG + Exonic
1041382243 8:57261724-57261746 AGCTGGGGGCTTGGGGAGTGGGG + Intergenic
1049403226 8:142440184-142440206 AGCTGAGGCTCTGGGCAGTGAGG - Intergenic
1049415871 8:142494829-142494851 TGCTGAGGGCCTGGGGAATGGGG + Intronic
1049539601 8:143202070-143202092 AGCTGGAGGCCTGGGTAGCGGGG - Intergenic
1049654772 8:143792687-143792709 AGGTGAGGGGCACGGAAGTGGGG - Exonic
1053222663 9:36325139-36325161 CGCTGAGGCCCTCGGGAGTGGGG - Intergenic
1055013286 9:71590350-71590372 ATCTGAGGGCCACGGTGATGAGG + Intergenic
1057787203 9:98096128-98096150 AGATGAGGGCCTCAGGAGGGAGG + Intronic
1057798538 9:98175225-98175247 AGCAGAGGGGCTCGGTAGGGTGG + Intronic
1060281068 9:122216032-122216054 AGCTTAGGGCCAAGGTGGTGTGG + Intronic
1061444066 9:130627699-130627721 GGCTGACGGCCTGGGTAGTGTGG - Intronic
1061806003 9:133138075-133138097 GGCTGAGGGCCTGGGAAGTGGGG + Intronic
1062155981 9:135048754-135048776 AGCAAAGGGACTCGGAAGTGTGG + Intergenic
1190441700 X:50481402-50481424 AGCTGAGGCCCTCAGTCGTGTGG - Intergenic
1191749802 X:64529450-64529472 ATCTTAGGGCCTTGGCAGTGAGG + Intergenic
1196890139 X:120283554-120283576 AACTGAGGGCCACGGGAGGGAGG - Intronic
1198471099 X:136947956-136947978 AGCTGAGAGTCTCGGTGGAGGGG - Intergenic
1199745924 X:150771967-150771989 ACCTGAGGGCCACAGTGGTGGGG + Intronic
1199791648 X:151160967-151160989 AGATGAGGGGCTGGGAAGTGAGG - Intergenic