ID: 1029741290

View in Genome Browser
Species Human (GRCh38)
Location 7:102493140-102493162
Sequence GCTGAGGGCCTCGGTAGTGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 4, 1: 0, 2: 0, 3: 7, 4: 146}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029741278_1029741290 15 Left 1029741278 7:102493102-102493124 CCCTCCTTACCCACCTTGGAGCT 0: 4
1: 0
2: 3
3: 15
4: 236
Right 1029741290 7:102493140-102493162 GCTGAGGGCCTCGGTAGTGAGGG 0: 4
1: 0
2: 0
3: 7
4: 146
1029741285_1029741290 2 Left 1029741285 7:102493115-102493137 CCTTGGAGCTGGGCGTCTTCGCG 0: 4
1: 0
2: 0
3: 4
4: 84
Right 1029741290 7:102493140-102493162 GCTGAGGGCCTCGGTAGTGAGGG 0: 4
1: 0
2: 0
3: 7
4: 146
1029741277_1029741290 18 Left 1029741277 7:102493099-102493121 CCTCCCTCCTTACCCACCTTGGA 0: 4
1: 0
2: 1
3: 33
4: 374
Right 1029741290 7:102493140-102493162 GCTGAGGGCCTCGGTAGTGAGGG 0: 4
1: 0
2: 0
3: 7
4: 146
1029741279_1029741290 14 Left 1029741279 7:102493103-102493125 CCTCCTTACCCACCTTGGAGCTG 0: 4
1: 0
2: 0
3: 14
4: 239
Right 1029741290 7:102493140-102493162 GCTGAGGGCCTCGGTAGTGAGGG 0: 4
1: 0
2: 0
3: 7
4: 146
1029741275_1029741290 22 Left 1029741275 7:102493095-102493117 CCGGCCTCCCTCCTTACCCACCT 0: 4
1: 0
2: 6
3: 191
4: 2870
Right 1029741290 7:102493140-102493162 GCTGAGGGCCTCGGTAGTGAGGG 0: 4
1: 0
2: 0
3: 7
4: 146
1029741273_1029741290 30 Left 1029741273 7:102493087-102493109 CCCACTTGCCGGCCTCCCTCCTT 0: 4
1: 0
2: 5
3: 41
4: 778
Right 1029741290 7:102493140-102493162 GCTGAGGGCCTCGGTAGTGAGGG 0: 4
1: 0
2: 0
3: 7
4: 146
1029741283_1029741290 6 Left 1029741283 7:102493111-102493133 CCCACCTTGGAGCTGGGCGTCTT 0: 4
1: 0
2: 0
3: 9
4: 100
Right 1029741290 7:102493140-102493162 GCTGAGGGCCTCGGTAGTGAGGG 0: 4
1: 0
2: 0
3: 7
4: 146
1029741282_1029741290 11 Left 1029741282 7:102493106-102493128 CCTTACCCACCTTGGAGCTGGGC 0: 4
1: 0
2: 1
3: 21
4: 202
Right 1029741290 7:102493140-102493162 GCTGAGGGCCTCGGTAGTGAGGG 0: 4
1: 0
2: 0
3: 7
4: 146
1029741274_1029741290 29 Left 1029741274 7:102493088-102493110 CCACTTGCCGGCCTCCCTCCTTA 0: 4
1: 0
2: 0
3: 18
4: 275
Right 1029741290 7:102493140-102493162 GCTGAGGGCCTCGGTAGTGAGGG 0: 4
1: 0
2: 0
3: 7
4: 146
1029741284_1029741290 5 Left 1029741284 7:102493112-102493134 CCACCTTGGAGCTGGGCGTCTTC 0: 4
1: 0
2: 1
3: 9
4: 147
Right 1029741290 7:102493140-102493162 GCTGAGGGCCTCGGTAGTGAGGG 0: 4
1: 0
2: 0
3: 7
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029741290 Original CRISPR GCTGAGGGCCTCGGTAGTGA GGG Exonic
900227579 1:1540289-1540311 TCTGGGGGCGTCGGTCGTGATGG - Exonic
902033438 1:13439386-13439408 GCTGATGGCCCGGGCAGTGAGGG + Intergenic
902466422 1:16621327-16621349 GCTGAGGGCCCCTGTTCTGAGGG + Intergenic
903455457 1:23484077-23484099 GCTGAGGTCCTCCGCGGTGACGG + Exonic
903675554 1:25062463-25062485 GCTCAGGGCCTGGGCAGAGAAGG + Intergenic
903935526 1:26892441-26892463 CCTGAGGCCCTGGATAGTGATGG - Exonic
905415402 1:37800389-37800411 GCTGAGGTGCTCTGTGGTGATGG + Exonic
906526786 1:46498140-46498162 GCTGAAGACCTCAGTAGTGCAGG + Intergenic
907185564 1:52606728-52606750 GCTGCAGGGCTCGGTAGTGCTGG - Exonic
917306306 1:173628502-173628524 GCTGTGGGCCTGGGCAGTGGTGG + Intronic
1067776239 10:49166862-49166884 CCTGGGGGCCTCAGTGGTGAGGG - Exonic
1072717254 10:97760227-97760249 CCTGGGGGCCTGGGTAGTGTAGG + Exonic
1076872262 10:133199879-133199901 GCAGGGGGCCTGGGCAGTGATGG + Intronic
1077178099 11:1199653-1199675 GCCGAGCGCCTCGGCACTGAGGG + Intronic
1077412610 11:2410619-2410641 CATGGGGGCCTCTGTAGTGATGG - Intronic
1083363022 11:62124356-62124378 GCTGAGGGCCTAGGTGGAAAGGG - Intronic
1084163927 11:67366399-67366421 GCTGAGGGGCTGGGGAGAGACGG + Intronic
1089270969 11:117300932-117300954 GCTGAGCGCTTTGGTTGTGAAGG - Intronic
1090915758 11:131160667-131160689 GATGAGGGTCTCCGTAGGGATGG - Intergenic
1091781795 12:3218568-3218590 CCTGAGGGCCTTGGCAGAGATGG + Intronic
1091843002 12:3633815-3633837 CCTGAGGGCCACTGTAGGGATGG - Intronic
1092077032 12:5682456-5682478 GCTGGAGGCCTGGGTAGTAATGG + Intronic
1095599876 12:44002299-44002321 GCTGAGGGCCTCCCTAATGGAGG + Intronic
1096547205 12:52348264-52348286 GCTGAGGTCCTGGGTAGAGCAGG + Intergenic
1101746328 12:107544397-107544419 GGTAAGGGCCTCTGCAGTGATGG + Intronic
1103921171 12:124399928-124399950 ACTGAGGCCCACGGAAGTGAAGG + Intronic
1105250731 13:18697223-18697245 GCGGAGGGCCACGGTGGTGGTGG + Intergenic
1108395685 13:49988966-49988988 GGTGAGGGCCTCGTTAGGGAAGG + Intergenic
1114657756 14:24326186-24326208 TCTGAGGGTCTCTGTGGTGATGG - Intronic
1115502063 14:34059264-34059286 TCTGTGGGCCACGGTAGTTAAGG + Intronic
1123409780 15:20048569-20048591 GCTGAGGGTCACGGCTGTGAGGG + Intergenic
1123519112 15:21055277-21055299 GCTGAGGGTCACGGCTGTGAGGG + Intergenic
1124621815 15:31278332-31278354 GGTCAGGACCTCGGTAGGGAAGG - Intergenic
1127961976 15:63896715-63896737 GCTGAGGGCTTTGGAACTGATGG - Intergenic
1128346928 15:66859890-66859912 GCTGAGGGCCCAGGCAGGGAAGG - Intergenic
1128729168 15:70009188-70009210 GCTGAGGGCCTCAGGAGAGGAGG - Intergenic
1130147830 15:81288065-81288087 GGTGAGGGCCTTGAGAGTGAGGG + Intronic
1130866849 15:87940561-87940583 GCTGAGGGCCCAGGGAGGGAAGG - Intronic
1132498920 16:276119-276141 GCTGAGGCCCTCGTGGGTGAAGG + Intronic
1132727892 16:1346649-1346671 GCTGAACGCCTCGCTGGTGAAGG + Exonic
1132995581 16:2820787-2820809 GCTGAGGGCCTCTGTTGTGCTGG + Intronic
1134090964 16:11391594-11391616 GCTTAGGGCCCCGGTGGAGAGGG + Intronic
1135406299 16:22200522-22200544 GCTGTGGGATTCGGTTGTGAAGG - Intergenic
1145273355 17:21416262-21416284 GCTGCGGGCCTGGGTGGTCATGG - Exonic
1145311544 17:21703706-21703728 GCTGCGGGCCTGGGTGGTCATGG - Exonic
1145711311 17:26981839-26981861 GCTGCGGGCCTGGGTGGTCATGG - Intergenic
1147742978 17:42679256-42679278 GCTGAGGGCCTGGGTGGGGGTGG - Exonic
1150821663 17:68439475-68439497 GCTGGGGGCATAGGGAGTGATGG + Intronic
1152394349 17:80023462-80023484 GCTGTGGGCCTCCGCAGGGAAGG - Intronic
1153479309 18:5530905-5530927 GCTGGGTGCCTGGGTAGTGCTGG + Intronic
1154438116 18:14361703-14361725 GCGGAGGGCCACGGTGGTGGTGG - Intergenic
1156476639 18:37409707-37409729 GCTGAGGGACATGGTAGGGAGGG + Intronic
1160181371 18:76639412-76639434 GCTGAATGCCACGGTAGTCAAGG + Intergenic
1161358730 19:3834286-3834308 CCTGAGTGCCTCGGTTGGGAAGG + Intronic
1163583555 19:18152462-18152484 GCTGAGCGCCCCGGAAGTAACGG - Intergenic
1165436411 19:35797663-35797685 TCTGAGGGCCGCGGAAGAGAAGG + Intergenic
1168681092 19:58316334-58316356 TCTGATGGCCTGGGCAGTGATGG - Intergenic
925099314 2:1231899-1231921 GCTGAGGGCCTCAGCACAGAGGG - Intronic
925930302 2:8701992-8702014 GCTGAAGGCCTCAGTGTTGAAGG + Intergenic
926798417 2:16638006-16638028 GCTGAGGGCCTGGGTAACGGGGG + Intronic
926994752 2:18722403-18722425 GCTGAGGGCCTGGCTACTGAGGG + Intergenic
927503050 2:23595167-23595189 GCAGAGGGCCTGGGAAGGGAAGG + Intronic
930338768 2:50084461-50084483 CCTGTGGGCCCCGGCAGTGATGG - Intronic
930775190 2:55163961-55163983 GCTGAGTGACTTGGCAGTGAAGG - Intergenic
931234458 2:60401495-60401517 GCTGATGGCCTCCTTTGTGAAGG - Intergenic
931917171 2:66969018-66969040 GCTGGGGGCCTCTCAAGTGAGGG - Intergenic
933727193 2:85433657-85433679 GCTGAGGGCCTCGGGCAGGAGGG - Intronic
935677674 2:105609755-105609777 GCTAGAGGCCTGGGTAGTGAGGG - Intergenic
936163574 2:110102312-110102334 GCTGGGGGACTTGGTAGTCAAGG - Intronic
937608210 2:123826997-123827019 GCTGCCGGCCTGGGCAGTGAGGG - Intergenic
940484957 2:154286952-154286974 CTTGAGGGTCTTGGTAGTGATGG - Intronic
946393530 2:219430990-219431012 TCTGTGGGCCTGGGTAGGGAGGG - Intergenic
1168944187 20:1737883-1737905 GCTGAGGGTCTAAGTAGAGATGG - Intergenic
1173648780 20:44650266-44650288 GCTGGGGGCATCAGTAGTGGGGG + Intronic
1174565755 20:51463361-51463383 GCTGTGGGCCTCGGTGGCGGGGG + Intronic
1174929245 20:54794753-54794775 GTTGAGGGCAACAGTAGTGAGGG + Intergenic
1176083902 20:63287199-63287221 GCTGAGGGCGTCGCTCGGGAGGG + Intronic
1178898809 21:36582954-36582976 GCTCAGAGCCTCAGTAGAGATGG + Intergenic
1179308146 21:40173514-40173536 GCTGAGGGCCTGGTTGGTCATGG + Intronic
1179646631 21:42779929-42779951 GCCCAGGGACTCGGTGGTGAGGG - Intergenic
1179994329 21:44967083-44967105 GCGGAGGGCCACGGTGGTGGTGG + Exonic
1180258682 21:46651328-46651350 GCTGGGGGCCGGGGTAGGGAGGG + Intronic
1181058809 22:20272323-20272345 GAGGAGGCCCTCGCTAGTGAAGG - Intronic
1183540583 22:38427218-38427240 GCTGCGGGCCTGGGTGGTCATGG + Exonic
1183698250 22:39435435-39435457 GGTGAGGGCCGCGGGAGTGAAGG - Intronic
950479303 3:13234956-13234978 GCTGAGGCCCTGGGAAGAGATGG + Intergenic
950503274 3:13377634-13377656 GCTGAGGGCCCCTGTGCTGAGGG - Intronic
954083024 3:48223591-48223613 GCTGAGGACCTGGGCAATGATGG - Exonic
955325011 3:58003257-58003279 ACTGAGGGCCTTGGTCGTGGGGG + Intergenic
959528780 3:107408424-107408446 ACTGAGGTCCTCAGTGGTGAAGG - Intergenic
961675598 3:128563772-128563794 GCTGAGGACTTCCGCAGTGATGG + Intergenic
961781931 3:129325495-129325517 GCTGAGGGCCCCTGTGCTGAGGG - Intergenic
964344924 3:155745375-155745397 CCAGAGGGCCTCGGTGGTGGGGG + Intergenic
968782442 4:2593318-2593340 GCTGAGGGCCACTGAAGTCAAGG - Intronic
975732896 4:77354770-77354792 GCTGAGGGCCACAGTAGTGGAGG + Intronic
975734494 4:77367879-77367901 GCTGAGGGCCACAGTAGTCCGGG + Intronic
977655806 4:99519333-99519355 GCTGAGAGCCTAGGTGCTGAAGG + Intronic
985774508 5:1833853-1833875 GCAGGGGGCCTGGGTAGAGACGG - Intergenic
985898435 5:2764835-2764857 GCTGAGGGCCTTGGGTGTGGTGG - Intergenic
987078102 5:14403095-14403117 GGTGAGGGCATAGGTTGTGAGGG + Intronic
989579383 5:43017686-43017708 GCTGGGGGCCTCGGTAATTACGG + Intergenic
991079625 5:62584254-62584276 GATGAGGGCTTCAGTGGTGATGG + Intronic
997980186 5:138464072-138464094 TCTGGGCGCCTCGGCAGTGACGG + Intergenic
1002949924 6:1799647-1799669 GCTGAGGGGCTGGGGAGGGAGGG + Intronic
1005866955 6:29943891-29943913 GCTGAGGGACTCAGAAGTGCTGG - Intronic
1005922907 6:30416992-30417014 GCTGAGGGCCTGGATGATGATGG + Intergenic
1006302292 6:33200098-33200120 GCTAAGGCCCTCGGGAGGGAGGG + Intronic
1007180054 6:39923303-39923325 ACTGAGGCCCTCGGTGGGGAAGG + Intronic
1011555276 6:88566674-88566696 GCTGAGGGCCACGGGAGGCATGG - Intergenic
1012401091 6:98843442-98843464 GCTGAGGGCCCGGAAAGTGAGGG + Intergenic
1012655665 6:101816781-101816803 GCTGGGGACCTGGGTAGGGAAGG - Intronic
1012979204 6:105812185-105812207 CCTGAGAGCATCTGTAGTGATGG - Intergenic
1013507402 6:110814615-110814637 GCTCCGGCCCTGGGTAGTGACGG - Intronic
1017020331 6:150134890-150134912 CCTAAGGGCATCTGTAGTGAAGG - Intergenic
1017718784 6:157230539-157230561 GCTGAGGGCCACGGAAAGGAAGG + Intergenic
1017819578 6:158039556-158039578 ACTGAGGGCCTGGGTTGGGACGG + Intronic
1019432454 7:1005564-1005586 GCAGTGGGCCTGGGTAGGGAAGG + Intronic
1019592341 7:1841935-1841957 GCTGAGGGCTGGGGTGGTGACGG - Intronic
1023830956 7:44038831-44038853 GCTGAGGGCCTCGGTAGTGAGGG + Intergenic
1024041621 7:45560231-45560253 GCTGAGAGACTGGGGAGTGAAGG - Intergenic
1024214739 7:47239074-47239096 GCGGAGGGCGTCTGTTGTGATGG - Intergenic
1024266528 7:47611088-47611110 GCAGAGGGGCACGGTAGTGGGGG - Intergenic
1029741290 7:102493140-102493162 GCTGAGGGCCTCGGTAGTGAGGG + Exonic
1029759280 7:102592309-102592331 GCTGAGGGCCTCGGTAGTGAGGG + Exonic
1029776649 7:102688219-102688241 GCTGAGGGCCTCGGTAGTGAGGG + Intergenic
1032238637 7:130144287-130144309 GCTGAGCCCATCGGTAGTGGTGG - Intergenic
1032958733 7:137004533-137004555 GCTGAGGTCTTCGGAAGAGAGGG + Intronic
1034729311 7:153370239-153370261 GCTGAAGGCCTGGGGAGTGCAGG + Intergenic
1034795121 7:154005914-154005936 GCTCAGTGCCTAGGTAGTGCTGG - Intronic
1035112853 7:156497785-156497807 GCTCAGGGCCTGGGTATTAAAGG - Intergenic
1036178435 8:6562278-6562300 GCTGAGAGCCTCCCTGGTGATGG + Intronic
1037114391 8:15206225-15206247 ACTTAGGGCCACGGTAGTCAGGG + Intronic
1040003707 8:42600318-42600340 GCTGCCGGCCTGGGCAGTGACGG - Intergenic
1041831633 8:62161695-62161717 GTTGAGGTCCTCATTAGTGAAGG - Intergenic
1044931953 8:97259772-97259794 GCTGGGGGAGTGGGTAGTGAGGG - Intergenic
1045064943 8:98436351-98436373 GGTGTGGGGCTCGGGAGTGAGGG - Intronic
1046748898 8:117905917-117905939 GCGGAGGGGCTTGGAAGTGATGG - Intronic
1047258620 8:123236137-123236159 GCTGAGGTCCTATGCAGTGAAGG + Intronic
1049018697 8:139939468-139939490 GCTGAGGGTCTCGGTTGGGGAGG - Intronic
1049425307 8:142535505-142535527 GCTGAGGACCTGGGTAGGCAAGG - Intronic
1049457967 8:142703673-142703695 TCTGAGGGCTTCAGTATTGATGG + Exonic
1049665872 8:143842214-143842236 GCTGAGGCCCTCTGCAGTAAAGG + Intergenic
1051714035 9:19963031-19963053 TCTGAGGGCTTAGGTATTGATGG - Intergenic
1053912485 9:42921099-42921121 GCTTGGAGCCTCGTTAGTGAGGG + Intergenic
1055013287 9:71590351-71590373 TCTGAGGGCCACGGTGATGAGGG + Intergenic
1056162491 9:83910701-83910723 GCTGTGGGCTTAGGTAGTGCTGG - Intronic
1056350481 9:85743847-85743869 GCTGAGGTTCTCGGGAGAGATGG - Intergenic
1057787204 9:98096129-98096151 GATGAGGGCCTCAGGAGGGAGGG + Intronic
1057798539 9:98175226-98175248 GCAGAGGGGCTCGGTAGGGTGGG + Intronic
1061249266 9:129416983-129417005 TCAGAGGGCCTCAGTAGGGAGGG - Intergenic
1061444065 9:130627698-130627720 GCTGACGGCCTGGGTAGTGTGGG - Intronic
1062513405 9:136920445-136920467 GCTGCAGGCCTCGGCAGTCATGG - Exonic
1062689456 9:137833927-137833949 GCTGAGGGGGTCGGGAGGGATGG - Intronic
1191749803 X:64529451-64529473 TCTTAGGGCCTTGGCAGTGAGGG + Intergenic
1195000596 X:100639625-100639647 GATGAGGGGCTTGGTAGGGATGG - Intronic
1195929828 X:110063473-110063495 GCTGAGAGGTTCGGTAGAGAAGG + Intronic
1196890138 X:120283553-120283575 ACTGAGGGCCACGGGAGGGAGGG - Intronic