ID: 1029741627

View in Genome Browser
Species Human (GRCh38)
Location 7:102494573-102494595
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 4, 1: 0, 2: 0, 3: 5, 4: 50}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029741616_1029741627 19 Left 1029741616 7:102494531-102494553 CCCGCACCTTGGCCAACAGGAGC 0: 3
1: 1
2: 1
3: 15
4: 289
Right 1029741627 7:102494573-102494595 CGTCCGCGTGGCGCTCCCGCAGG 0: 4
1: 0
2: 0
3: 5
4: 50
1029741617_1029741627 18 Left 1029741617 7:102494532-102494554 CCGCACCTTGGCCAACAGGAGCA 0: 3
1: 1
2: 2
3: 34
4: 427
Right 1029741627 7:102494573-102494595 CGTCCGCGTGGCGCTCCCGCAGG 0: 4
1: 0
2: 0
3: 5
4: 50
1029741622_1029741627 7 Left 1029741622 7:102494543-102494565 CCAACAGGAGCAGGGTGCGGCTG 0: 4
1: 0
2: 2
3: 17
4: 198
Right 1029741627 7:102494573-102494595 CGTCCGCGTGGCGCTCCCGCAGG 0: 4
1: 0
2: 0
3: 5
4: 50
1029741620_1029741627 13 Left 1029741620 7:102494537-102494559 CCTTGGCCAACAGGAGCAGGGTG 0: 3
1: 1
2: 1
3: 23
4: 247
Right 1029741627 7:102494573-102494595 CGTCCGCGTGGCGCTCCCGCAGG 0: 4
1: 0
2: 0
3: 5
4: 50
1029741614_1029741627 27 Left 1029741614 7:102494523-102494545 CCGCAAGGCCCGCACCTTGGCCA 0: 3
1: 1
2: 4
3: 14
4: 155
Right 1029741627 7:102494573-102494595 CGTCCGCGTGGCGCTCCCGCAGG 0: 4
1: 0
2: 0
3: 5
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900240609 1:1615714-1615736 CGTCCGGTTCCCGCTCCCGCTGG + Intronic
902580413 1:17404319-17404341 ATCCCGCGTGGCGCTTCCGCAGG + Intergenic
907490469 1:54806010-54806032 CGCCCACGTGGCGCCCCCACCGG - Intergenic
917904560 1:179575945-179575967 GGTCCGCGTGGCGTGCCCGGGGG + Intronic
1070327296 10:75397126-75397148 CGTCCGGGTGGCTCTGCAGCCGG - Intergenic
1071527302 10:86366133-86366155 CGGCCGCGCCGCGCTCCCGCTGG - Intronic
1074977708 10:118594890-118594912 CGCCTGCGTGCCGCTCACGCTGG - Exonic
1077200458 11:1304484-1304506 CCTCCCCTTGGGGCTCCCGCAGG - Intronic
1091393195 12:138485-138507 CGGCCTCGTGGGGCTGCCGCTGG + Exonic
1092229306 12:6767728-6767750 CGCCCGTGTGGCCCTCCGGCGGG + Intronic
1093711534 12:22334537-22334559 CGGCGGCGAGTCGCTCCCGCCGG + Exonic
1096392278 12:51238771-51238793 CGCCCGAGTGGCGCTGCCGCCGG - Intronic
1096781482 12:53994753-53994775 CGCTCGCGGGGCCCTCCCGCGGG - Intronic
1097057421 12:56258286-56258308 CGTCCGCATCGAGCTCCCGGCGG + Exonic
1097114438 12:56687513-56687535 GGTCCGCGTGGGGCTCTCCCAGG + Intronic
1097173075 12:57128311-57128333 GGTCCGCGTCGCCCTCCCCCGGG + Intronic
1101409417 12:104456783-104456805 TGTGCGCGCCGCGCTCCCGCAGG - Intronic
1112435636 13:99389746-99389768 CTTCTGCGTGGAGCTCACGCAGG - Intergenic
1122993393 14:105249317-105249339 CGTGAGCCTGGCTCTCCCGCAGG - Intronic
1130224254 15:82045714-82045736 CGTGCGCGCCGCGCCCCCGCCGG + Exonic
1130296109 15:82647855-82647877 CGGCCCCATGGCGTTCCCGCTGG - Intronic
1132591116 16:726918-726940 CGTGCGCGTGGCGCCCCACCGGG + Intronic
1132862653 16:2079226-2079248 CTTGCCCGTGGAGCTCCCGCAGG - Intronic
1136453696 16:30369187-30369209 CTTCCCCGAGGCGGTCCCGCTGG + Intronic
1143323111 17:6080769-6080791 GGTCCGCGTGGCTCTCCCACAGG + Exonic
1148534839 17:48430332-48430354 GGTGCACGTGGCGCTCACGCCGG + Intergenic
1148786942 17:50150222-50150244 CGTGCGCCTGTCGCTGCCGCGGG - Exonic
1150358048 17:64505468-64505490 CGGCCGGGCGGCGTTCCCGCTGG + Intronic
1161032541 19:2064854-2064876 CGTCCTCGTGGCTCTGCTGCCGG - Intergenic
1161752835 19:6110259-6110281 CGTCCGGGTGGTGCGCCCGCGGG - Intronic
1163806896 19:19405276-19405298 CTTCCGCGTGACGACCCCGCGGG + Intronic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
948850880 2:240704708-240704730 CTGCCATGTGGCGCTCCCGCCGG + Intergenic
948910293 2:240999220-240999242 CGCCCGCGCGCCTCTCCCGCGGG - Intronic
1171968329 20:31547405-31547427 AGGCCGCGTGGCGCCCGCGCCGG + Intronic
1172447057 20:34998772-34998794 CCTCCTCGTGTTGCTCCCGCAGG - Exonic
1176159528 20:63641382-63641404 CGGCCGCGTGCAGCTCCTGCAGG + Exonic
1183032173 22:35114472-35114494 CGTGCACGTGGAGCTCCAGCTGG - Intergenic
1183586482 22:38755832-38755854 TTTCCGCGTGGGGATCCCGCGGG + Exonic
1183989696 22:41589671-41589693 TGTCCGCGTGACACTCCCGGTGG + Intronic
974265343 4:59580096-59580118 AGTCCGTGTGGCGATTCCGCAGG - Intergenic
976629315 4:87220515-87220537 CGTCCGCCGGGTGCTCGCGCGGG - Exonic
979205606 4:118033779-118033801 CGCCCGCTTGTCGCCCCCGCCGG + Intronic
981504089 4:145481665-145481687 CGGCCGCGCTGCGCTCACGCCGG + Intronic
986928950 5:12794869-12794891 CCTCAGCGCGGCGCTGCCGCAGG - Intergenic
990347329 5:54883727-54883749 CCTCCGCGTGGCCTTCCCGGAGG - Intergenic
991406135 5:66302577-66302599 CTTGCACGTGGCGCTCCTGCTGG - Intergenic
1001589278 5:172854502-172854524 CGTCTGCGTGGCTCTTCTGCAGG + Intronic
1017696587 6:157021719-157021741 CGTCCGCCCCGCGCGCCCGCAGG + Intronic
1023831297 7:44040267-44040289 CGTCCGCGTGGCGCTCCCGCAGG + Intergenic
1029224159 7:99012935-99012957 GATGCGTGTGGCGCTCCCGCAGG - Exonic
1029741627 7:102494573-102494595 CGTCCGCGTGGCGCTCCCGCAGG + Exonic
1029759618 7:102593742-102593764 CGTCCGCGTGGCGCTCCCGCAGG + Exonic
1029776984 7:102689652-102689674 CGTCCGCGTGGCGCTCCCGCAGG + Intergenic
1034324616 7:150219798-150219820 CGCGCGCGGGGCTCTCCCGCGGG - Intergenic
1034768578 7:153749433-153749455 CGCGCGCGGGGCTCTCCCGCGGG + Intergenic
1034900183 7:154903455-154903477 CGACTGCATGGCGCTCCCTCTGG - Intergenic
1038596455 8:28890550-28890572 CTTCCGCGTGGGGCGCCCGTCGG - Exonic
1062659154 9:137619233-137619255 CGTCCGGCCCGCGCTCCCGCCGG + Intronic