ID: 1029743689

View in Genome Browser
Species Human (GRCh38)
Location 7:102505355-102505377
Sequence GCCCGGCCACGTGTGTGAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029743682_1029743689 6 Left 1029743682 7:102505326-102505348 CCTGGGAGAAGTGGCCCTGAGGT 0: 1
1: 2
2: 3
3: 12
4: 215
Right 1029743689 7:102505355-102505377 GCCCGGCCACGTGTGTGAGCGGG No data
1029743684_1029743689 -8 Left 1029743684 7:102505340-102505362 CCCTGAGGTCCCAGAGCCCGGCC 0: 1
1: 2
2: 1
3: 26
4: 254
Right 1029743689 7:102505355-102505377 GCCCGGCCACGTGTGTGAGCGGG No data
1029743677_1029743689 25 Left 1029743677 7:102505307-102505329 CCGTGGGTGACGATGGGTGCCTG 0: 3
1: 0
2: 2
3: 30
4: 853
Right 1029743689 7:102505355-102505377 GCCCGGCCACGTGTGTGAGCGGG No data
1029743685_1029743689 -9 Left 1029743685 7:102505341-102505363 CCTGAGGTCCCAGAGCCCGGCCA 0: 3
1: 0
2: 4
3: 34
4: 316
Right 1029743689 7:102505355-102505377 GCCCGGCCACGTGTGTGAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029743689 Original CRISPR GCCCGGCCACGTGTGTGAGC GGG Intronic