ID: 1029752439

View in Genome Browser
Species Human (GRCh38)
Location 7:102551020-102551042
Sequence GCATGGGCAGGCAGGTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 652
Summary {0: 4, 1: 0, 2: 8, 3: 65, 4: 575}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029752439_1029752454 9 Left 1029752439 7:102551020-102551042 CCCCAGCACCTGCCTGCCCATGC 0: 4
1: 0
2: 8
3: 65
4: 575
Right 1029752454 7:102551052-102551074 GTGACTCATGAGACAGGGTGGGG 0: 3
1: 1
2: 0
3: 8
4: 236
1029752439_1029752452 7 Left 1029752439 7:102551020-102551042 CCCCAGCACCTGCCTGCCCATGC 0: 4
1: 0
2: 8
3: 65
4: 575
Right 1029752452 7:102551050-102551072 GGGTGACTCATGAGACAGGGTGG 0: 3
1: 1
2: 2
3: 13
4: 219
1029752439_1029752453 8 Left 1029752439 7:102551020-102551042 CCCCAGCACCTGCCTGCCCATGC 0: 4
1: 0
2: 8
3: 65
4: 575
Right 1029752453 7:102551051-102551073 GGTGACTCATGAGACAGGGTGGG 0: 3
1: 1
2: 2
3: 52
4: 320
1029752439_1029752450 3 Left 1029752439 7:102551020-102551042 CCCCAGCACCTGCCTGCCCATGC 0: 4
1: 0
2: 8
3: 65
4: 575
Right 1029752450 7:102551046-102551068 TTTGGGGTGACTCATGAGACAGG 0: 3
1: 1
2: 0
3: 15
4: 120
1029752439_1029752451 4 Left 1029752439 7:102551020-102551042 CCCCAGCACCTGCCTGCCCATGC 0: 4
1: 0
2: 8
3: 65
4: 575
Right 1029752451 7:102551047-102551069 TTGGGGTGACTCATGAGACAGGG 0: 3
1: 1
2: 0
3: 15
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029752439 Original CRISPR GCATGGGCAGGCAGGTGCTG GGG (reversed) Intronic
900149564 1:1172154-1172176 GCCTGAGCTGGCAGGGGCTGGGG - Intergenic
900242928 1:1625483-1625505 GCTTGGGGAGGAAGGGGCTGAGG - Intronic
900288975 1:1915826-1915848 GCCTGGGCAGGAAGGGGCTGAGG + Intronic
900322951 1:2094027-2094049 AAGTGGGCTGGCAGGTGCTGTGG - Intronic
900336394 1:2166129-2166151 TCATGGACAGGCATGTGCAGTGG + Intronic
900390874 1:2433265-2433287 GCAGAGGCAGGCAGGTTTTGTGG + Intronic
900407924 1:2500590-2500612 GCCTGGGCATGCAGGGGCGGCGG - Intronic
900803997 1:4755540-4755562 CCATGGGCAGGCAGGGGGTGGGG - Intronic
901530888 1:9851856-9851878 ACATGGCCAGGGAGGGGCTGTGG + Intronic
901848330 1:11998917-11998939 CCCTGGGCAGGCAGCTGATGGGG + Intronic
902046794 1:13530669-13530691 GCACGAGCAGGGAGGTGCTGGGG - Intergenic
902315797 1:15617578-15617600 GCGTGGCCTGGCTGGTGCTGCGG - Exonic
902649825 1:17829842-17829864 CCAGGGGCAGCCAGGTGCAGAGG + Intergenic
903172867 1:21564364-21564386 GGTTGGGCAGGCAGGCACTGTGG + Intronic
903235962 1:21951013-21951035 GGATGGTCACGCTGGTGCTGGGG + Intergenic
903269356 1:22178020-22178042 TCCTGGGCAGGCAGGGGGTGCGG - Intergenic
903279020 1:22239505-22239527 GCAGGGCCAGGCAGCCGCTGGGG + Intergenic
903321897 1:22548265-22548287 CCTTGGGAAGGCAGGCGCTGCGG + Intergenic
903778076 1:25805902-25805924 AAAAGGGCAGGCAGGGGCTGAGG - Intronic
903974319 1:27139158-27139180 GTATGGGCAGGCACCTGTTGGGG - Intronic
904038682 1:27572020-27572042 GCAGGGTCTGGCAGGAGCTGAGG - Intronic
904618224 1:31761154-31761176 GCCGGGGCAGGCGGGTGATGAGG + Intronic
905352536 1:37357465-37357487 GCATGTTCAGGCAAGGGCTGGGG - Intergenic
905390118 1:37630799-37630821 GCGTGGGCAGGCCGCTGCTGTGG - Intronic
905553066 1:38859489-38859511 GCAGGGGCAGGCGGTGGCTGTGG - Exonic
905933204 1:41804239-41804261 GCAGGTACAGGCAGGGGCTGTGG - Intronic
907839727 1:58145012-58145034 GCATAGGCAGTCAGGGGATGGGG + Intronic
908171004 1:61504634-61504656 GCATGGGCAGGCACCAGCTCTGG - Intergenic
909024649 1:70468290-70468312 GCATGGGCAGGGTGTTGGTGGGG - Intergenic
911189787 1:94936319-94936341 GAAGGGGCTGGCAGGAGCTGAGG + Intergenic
911358203 1:96846652-96846674 GGATGGGGAGGGAGGTACTGGGG + Intergenic
912319522 1:108698771-108698793 AGATGGGAAGGAAGGTGCTGAGG + Exonic
913130311 1:115833146-115833168 GAATGGGCTGGAAGGTGCAGAGG + Intergenic
915128760 1:153682920-153682942 GCAGGGACAGGAAGGCGCTGAGG + Intronic
915162515 1:153930372-153930394 GCATGGGCAAGGAGGAGCTGAGG - Exonic
915218535 1:154355852-154355874 TCAAGGGCAGGCAGGAGGTGAGG + Intergenic
916152301 1:161806753-161806775 TCATGAGAAGGTAGGTGCTGGGG + Intronic
918047939 1:180952675-180952697 GCATGGGGAGGCAGCTGCAGTGG - Intergenic
919390338 1:196976463-196976485 GGATGGGCAGGCAGGCTATGTGG - Intergenic
919774241 1:201183868-201183890 GGCTGGGCAGGCAGCGGCTGGGG - Intergenic
919826036 1:201503936-201503958 GCATGGCCAGGTAGGAGCAGAGG - Intronic
920172545 1:204080746-204080768 GCAGAGGCAGGCAGGTGCTGTGG + Intronic
920245822 1:204586620-204586642 AAATGAGCAGCCAGGTGCTGTGG - Intergenic
921994041 1:221397493-221397515 GCCTGGGCTGGCAGTGGCTGTGG + Intergenic
922573144 1:226645450-226645472 GCAGGAGCAGGCAGGTTCTGGGG + Intronic
922745008 1:228038595-228038617 GCGTGAGCAGGCAGGAGATGGGG + Intronic
924007853 1:239631946-239631968 GCTTAGGCAGGCAGGAGGTGAGG + Intronic
924186629 1:241498447-241498469 GCAGGCGCAGGCAGGGCCTGGGG + Intronic
924235482 1:241996389-241996411 GGATGGGCAGGAGGGTGGTGAGG + Intronic
924946637 1:248851009-248851031 GGATTGGCGGGCAGGGGCTGGGG - Intronic
1063223481 10:3992738-3992760 GCTTTAGCAGGCAGGTGCAGAGG + Intergenic
1064423934 10:15213663-15213685 GCCTGGGAAGACAGGGGCTGGGG + Exonic
1065047717 10:21758892-21758914 AAAAAGGCAGGCAGGTGCTGTGG + Intronic
1065550761 10:26866694-26866716 GCATGGGGTGGCAGGGGTTGGGG - Intergenic
1065871300 10:29958711-29958733 TGACAGGCAGGCAGGTGCTGTGG - Intergenic
1067165617 10:43864359-43864381 ACATGGGCAGGGCTGTGCTGTGG + Intergenic
1067181005 10:43986045-43986067 GCAGGGGAGGGCAGGTTCTGTGG - Intergenic
1067287083 10:44914583-44914605 GGATGGACAGGCAGGAGCTCCGG - Intronic
1067419768 10:46135145-46135167 GCATGGGGAGGGTGGTGCTGGGG + Intergenic
1067426250 10:46214266-46214288 GCATGGGGAGGGTGGTGCTGGGG - Intergenic
1067505119 10:46841742-46841764 GCATGGGGAGGGTGGTGCTGGGG + Intergenic
1067703637 10:48590841-48590863 GCATGGGCAGGGTAGGGCTGGGG + Intronic
1067792255 10:49297158-49297180 GCTGGGGAAGGAAGGTGCTGAGG + Intergenic
1068044703 10:51871487-51871509 GCATGGGCATGCAAATTCTGTGG + Intronic
1068841008 10:61614145-61614167 GCATGGCCAGGGAAGGGCTGAGG + Intergenic
1069601183 10:69709292-69709314 GCATGGCCATGCAGGAGGTGAGG - Intergenic
1069606088 10:69739670-69739692 GCATGGGCAGGCGGGGTGTGGGG + Intergenic
1069930818 10:71880517-71880539 GCATGGGCAGGGAGGTCCATGGG - Intergenic
1070663558 10:78327903-78327925 GCATGTGCAGGCATGAGCAGTGG + Intergenic
1070771536 10:79085265-79085287 ACCTGGGCAGGCTGGTTCTGGGG + Intronic
1071481770 10:86070035-86070057 GCCTGGGTAGAGAGGTGCTGTGG + Intronic
1071563963 10:86662197-86662219 GGATGGGCAGACAGATGCAGGGG - Intronic
1072009455 10:91290793-91290815 GCATGGCAAGGCAGGTGCTGGGG - Intergenic
1073006904 10:100331261-100331283 GCATAGGCAGGGATGTGCTTGGG - Intergenic
1073061113 10:100734497-100734519 CCGTGGGCAGGCAGAGGCTGGGG - Intergenic
1073077341 10:100832451-100832473 ACATGGGCAGGAAGTAGCTGTGG - Intergenic
1073190517 10:101647441-101647463 GGATGGGCAGGCAGCTGCCTAGG - Intronic
1073254061 10:102139832-102139854 GCATTGGCAGGTGGGTTCTGAGG - Exonic
1075713471 10:124542921-124542943 CCATGGGCAGGCAGGGACCGGGG - Intronic
1076129254 10:128001610-128001632 GCAGGGGCTGGCAGCTGCTCAGG + Intronic
1076500470 10:130932481-130932503 GCAAGGGCTGGCAGGTGGAGTGG - Intergenic
1076551248 10:131279309-131279331 GCCTGGGCAGGCAGGTGGGCAGG + Intronic
1076733563 10:132449286-132449308 GCAGGACCAGGCAGGGGCTGGGG - Exonic
1076869039 10:133183745-133183767 GCAGGCGCAGGCAGGCTCTGGGG + Intronic
1077002282 11:330278-330300 GCTTGGGAAGGAAGGCGCTGTGG - Intergenic
1077050681 11:565189-565211 GCATGGGAAGGCAGAGGATGGGG + Intergenic
1077096020 11:799489-799511 GGCTGGGCAGCCAGGGGCTGTGG - Exonic
1077200965 11:1307345-1307367 GCCTGTGCTGGCAAGTGCTGAGG - Intronic
1077211065 11:1371170-1371192 GCAGCGGCGGGAAGGTGCTGAGG + Intergenic
1077235859 11:1481732-1481754 GCAGGGGCAGGGAGGGGCAGGGG + Intronic
1077235870 11:1481754-1481776 GCAGGGGCAGGGAGGGGCAGGGG + Intronic
1077325184 11:1960700-1960722 AGATGAGCAGCCAGGTGCTGGGG + Intronic
1078156805 11:8806815-8806837 TCCTGGGGAGGCAGGGGCTGGGG - Intronic
1078465571 11:11547616-11547638 GCTTGAGCAAGCAGGTCCTGTGG - Intronic
1079105386 11:17568963-17568985 GAATGGGCAGGCAGAGGCTCAGG - Intronic
1080922351 11:36721666-36721688 GCGTGGGTAGGCAGGGGATGGGG - Intergenic
1081618603 11:44605196-44605218 AAATGGGCAGGCAGCTGCGGAGG - Intronic
1081630579 11:44686877-44686899 GCATGGGCAGGGAGCAGCAGGGG - Intergenic
1081693560 11:45094425-45094447 GCATGGGCTGGGAGGGGGTGGGG + Intergenic
1081858774 11:46320319-46320341 CCATGGGCAGCAGGGTGCTGCGG - Exonic
1083591792 11:63899801-63899823 CCCTGGGCAGGAAGGAGCTGAGG - Intronic
1083663523 11:64262941-64262963 GCTCGGACAGGCAGGTCCTGGGG - Intronic
1083727678 11:64636977-64636999 GCAGGCCCAGGGAGGTGCTGAGG + Intronic
1083883453 11:65559172-65559194 GCAGGGGCTGGCAGCGGCTGGGG + Intergenic
1083889681 11:65589627-65589649 GCAGGGGCGGGCAGGAGCTGGGG + Intronic
1084175003 11:67418471-67418493 GCACAGGCAGAAAGGTGCTGGGG - Exonic
1084268390 11:68016584-68016606 GCAGGGGCAGGCAGGTGCATGGG - Intronic
1084274385 11:68044083-68044105 GGCTGGGCAGGCAGGTGGGGTGG - Intronic
1084303293 11:68265106-68265128 GGGTGGGCAGGCAGGTGGAGAGG + Intronic
1084520208 11:69658100-69658122 GCAAGGGCAGGCCTGTGCAGGGG + Intronic
1084937995 11:72597457-72597479 GCAGGGGCAGGGAGGGACTGTGG - Intronic
1089189475 11:116643738-116643760 GCCTGCGCAGGCAGAGGCTGAGG - Intergenic
1090403878 11:126465929-126465951 GCAGGGGCGGGGAGGTGGTGAGG + Intronic
1090418767 11:126559015-126559037 GCATGGGCTGGCAGTAGGTGGGG + Intronic
1090745945 11:129704906-129704928 GCAAGGAGAGGCAGGTGCAGAGG + Intergenic
1090843641 11:130513646-130513668 GAATAGGATGGCAGGTGCTGGGG - Intergenic
1091093231 11:132792786-132792808 CAATGGACAGGCAGGGGCTGCGG - Intronic
1202808165 11_KI270721v1_random:15879-15901 AGATGAGCAGCCAGGTGCTGGGG + Intergenic
1091616259 12:2053169-2053191 GCCTGGGCCGGCAGGGGCCGAGG - Intronic
1092355850 12:7794683-7794705 GCTGGGGTAGGTAGGTGCTGAGG - Exonic
1092368683 12:7898491-7898513 GCTGGGGTAGGTAGGTGCTGAGG - Intergenic
1092397679 12:8142630-8142652 GCAGGGCCCAGCAGGTGCTGAGG + Intronic
1095506355 12:42903271-42903293 GAATGGGCAGCCAGGTGCAGTGG + Intergenic
1096638205 12:52974605-52974627 ACAAGGGCTGGCAGGGGCTGTGG + Intergenic
1096652525 12:53068886-53068908 GCTGGGTCAGGGAGGTGCTGAGG + Intronic
1096775295 12:53960030-53960052 GCTTGGGCAGCCATGAGCTGGGG + Intergenic
1097178975 12:57160087-57160109 GCAGGGGAAGGCAGGTGAGGCGG + Intronic
1097317396 12:58186670-58186692 GCATGGGCAATCAGATACTGTGG + Intergenic
1099874554 12:88389010-88389032 AAATGGGCAGGCAGCTGCTTAGG + Intergenic
1100391634 12:94149612-94149634 GCCTGGCCACGCAGGAGCTGGGG + Exonic
1101397822 12:104363866-104363888 GAATGTGCAGCCAGGTGCAGTGG + Intergenic
1101768928 12:107730409-107730431 GGGTGAGGAGGCAGGTGCTGGGG + Intergenic
1102105946 12:110323470-110323492 GTATCGGCAGCCAGGTGCAGTGG - Intronic
1102205139 12:111085153-111085175 GGATGGGGATGGAGGTGCTGTGG + Intronic
1102292540 12:111713023-111713045 ACATCGGCAGGCGGGTGCGGTGG + Intronic
1102419626 12:112793507-112793529 GCCTGAGCAGGCACATGCTGTGG - Intronic
1103321606 12:120095626-120095648 GCCTGGGAAGGAGGGTGCTGTGG - Exonic
1103937036 12:124482363-124482385 GCTTGGGCTGGCAGGAGGTGGGG - Intronic
1103984899 12:124760650-124760672 GGAAGGTCAGGGAGGTGCTGGGG + Intergenic
1104144490 12:126019324-126019346 GCTGGGGCAGGGAGGAGCTGAGG + Intergenic
1104410398 12:128553016-128553038 GCAGGTGCAGGGAAGTGCTGTGG + Intronic
1104754993 12:131263769-131263791 GGAGGGGCAGGGAGGTGCTTTGG + Intergenic
1105012592 12:132765673-132765695 GCAGGGACAGGCAGGTGGCGGGG + Intergenic
1106184718 13:27399274-27399296 ACATGGGTAGGGAGGTGCCGAGG + Intergenic
1106720644 13:32431537-32431559 GGACGGGCAGGCAGCTGCTTAGG - Intergenic
1106747904 13:32722836-32722858 GCATGGCCTGGCTGTTGCTGGGG + Intronic
1107306436 13:39025368-39025390 GCAAGGGCAGGTAGGAGATGAGG - Intronic
1107403903 13:40095452-40095474 GGATGGAAAGGCAGGTGCTCTGG + Intergenic
1107447427 13:40481337-40481359 GCATGGGGTGGGAGGTGCGGAGG + Intergenic
1107614661 13:42152874-42152896 ACATGGGCCAGCAGGTCCTGGGG + Intronic
1107997105 13:45871776-45871798 ACATGGAGATGCAGGTGCTGTGG - Intergenic
1108087068 13:46804624-46804646 ACATGGACAGGTAGGTGCTCTGG - Intergenic
1108471727 13:50773890-50773912 ACAGAGGCAGGCAGGAGCTGTGG + Intronic
1110617297 13:77555216-77555238 TCCTGGGCAGACTGGTGCTGTGG + Intronic
1111188894 13:84782075-84782097 GCATGCACTGGCAAGTGCTGGGG - Intergenic
1112292858 13:98160310-98160332 GCCTGGGCTGCCTGGTGCTGGGG + Intronic
1112580651 13:100674421-100674443 GGCTGTGCAGGCAGGGGCTGGGG + Intronic
1112775491 13:102839350-102839372 GCATGGGGAGGAAGGTGTTTTGG + Intronic
1113417286 13:110138240-110138262 GGAGGGGGAGGCAGATGCTGCGG + Intergenic
1113447909 13:110384684-110384706 GCTTGGGAAGGCAGGTGTTTGGG - Intronic
1114392071 14:22320443-22320465 TCCTGGGCAGTCAGGTTCTGAGG - Intergenic
1114635767 14:24186000-24186022 GAATGGGCAGGCTCTTGCTGGGG - Intronic
1117678927 14:58183503-58183525 GCATGGCCAGGCACATGCAGTGG - Intronic
1117958467 14:61140724-61140746 CCATGGGCATGCACATGCTGTGG + Intergenic
1119049247 14:71350013-71350035 GGGAGGGCAGGCAGGTGCTGAGG + Intronic
1119413981 14:74457280-74457302 GAATGGGGAGGCAAGGGCTGTGG - Intergenic
1119774759 14:77241370-77241392 GCATGGGCTGCCAGAGGCTGGGG - Intronic
1120962166 14:90135368-90135390 CCAAGGGAAGGGAGGTGCTGAGG + Intronic
1120998495 14:90434777-90434799 GCATGCCCAGGCTGGGGCTGGGG + Intergenic
1121148176 14:91604792-91604814 GCTGGGGTAGGTAGGTGCTGAGG + Intronic
1121487747 14:94331537-94331559 GCAGGGGCTGGCAGGTGGGGAGG - Intergenic
1121571875 14:94952293-94952315 GGCTGGCCAGGCAGGTCCTGCGG - Intergenic
1121816394 14:96932203-96932225 GCATGGTCAAGCAGAGGCTGAGG - Intergenic
1121844461 14:97160554-97160576 GCCTGCACAGGCAGGGGCTGGGG + Intergenic
1122204370 14:100141317-100141339 GCATGGCCAGGCAGGCCCTGGGG + Intronic
1122428218 14:101623854-101623876 GCATGGTGGGCCAGGTGCTGGGG - Intergenic
1122868904 14:104625096-104625118 GCAGGGGCAGGCATGGGATGAGG - Intergenic
1122945253 14:105005709-105005731 GCCTGGCCAGCCTGGTGCTGAGG - Intronic
1123473755 15:20572492-20572514 GGGTGGGCAGGCAGGAGCAGGGG + Intergenic
1123644254 15:22427861-22427883 GGGTGGGCAGGCAGGAGCAGGGG - Intergenic
1123726956 15:23112642-23112664 TCAAGGGCAGGAAGGTGATGTGG - Intergenic
1123734055 15:23167503-23167525 GGGTGGGCAGGCAGGAGCAGGGG + Intergenic
1123961943 15:25412138-25412160 GCATAGGTAGGCAGGCCCTGTGG + Intronic
1124118109 15:26866778-26866800 GCCTGGGCAGGGAGGCGTTGGGG + Exonic
1124284558 15:28388814-28388836 GGGTGGGCAGGCAGGAGCAGGGG + Intronic
1124298139 15:28522800-28522822 GGGTGGGCAGGCAGGAGCAGGGG - Intronic
1124617818 15:31255228-31255250 GCAGGGGCAGCCAGGAGCAGGGG + Intergenic
1124617823 15:31255244-31255266 GCAGGGGCAGCCAGGAGCAGGGG + Intergenic
1125032262 15:35084583-35084605 GCTGGGGTAGGTAGGTGCTGAGG + Intergenic
1125506512 15:40270768-40270790 GGGTGGGCAGGCAGGTGTGGGGG + Intronic
1125535063 15:40437797-40437819 GCAGTGGCGGGGAGGTGCTGGGG + Intergenic
1126288468 15:47043959-47043981 GCATGGGGGGGCAGGTGCGGTGG + Intergenic
1126864345 15:52921140-52921162 GGCTGGGAAGGCAGGTGCTCTGG - Intergenic
1127966224 15:63924734-63924756 GCCTGGGCAGCCAGATGCAGAGG - Intronic
1128290673 15:66476231-66476253 GCCTGGCCAGCCAGCTGCTGGGG + Intronic
1129038721 15:72666149-72666171 GGGTGGGCAGGCAGGGGCAGGGG + Intronic
1129167317 15:73786072-73786094 AGAGGGGCAGGGAGGTGCTGGGG + Intergenic
1129211170 15:74071081-74071103 GGGTGGGCAGGCAGGGGCAGGGG - Intronic
1129245729 15:74277664-74277686 GCATGTGCAGGCAGGAGTGGTGG - Intronic
1129324068 15:74790333-74790355 CCAAGGCCAGGCACGTGCTGAGG - Intronic
1129399233 15:75270006-75270028 GGGTGGGCAGGCAGGGGCAGGGG + Intronic
1129402840 15:75294282-75294304 GGGTGGGCAGGCAGGGGCAGGGG + Intronic
1129476371 15:75786703-75786725 GGGTGGGCAGGCAGGAGCAGGGG + Intergenic
1129728303 15:77915355-77915377 GGGTGGGCAGGCAGGAGCAGGGG - Intergenic
1130259268 15:82343075-82343097 GGGTGGGCAGGCAGGAGCAGGGG - Intronic
1130269408 15:82436090-82436112 GGGTGGGCAGGCAGGAGCAGGGG + Intronic
1130276015 15:82476743-82476765 GGGTGGGCAGGCAGGAGCAGGGG - Intergenic
1130281996 15:82526107-82526129 GGGTGGGCAGGCAGGAGCAGGGG + Intergenic
1130468375 15:84204134-84204156 GGGTGGGCAGGCAGGAGCAGGGG - Intergenic
1130473363 15:84242270-84242292 GGGTGGGCAGGCAGGAGCAGGGG + Intronic
1130480777 15:84356334-84356356 GGGTGGGCAGGCAGGAGCAGGGG + Intergenic
1130485375 15:84395616-84395638 GGGTGGGCAGGCAGGAGCAGGGG + Intergenic
1130490935 15:84431425-84431447 GGGTGGGCAGGCAGGAGCAGGGG - Intergenic
1130495891 15:84469408-84469430 GGGTGGGCAGGCAGGAGCAGGGG + Intergenic
1130502519 15:84510224-84510246 GGGTGGGCAGGCAGGAGCAGGGG - Intergenic
1130590668 15:85208732-85208754 GGGTGGGCAGGCAGGAGCAGGGG - Intergenic
1130595643 15:85246849-85246871 GGGTGGGCAGGCAGGAGCAGGGG + Intergenic
1131114418 15:89785145-89785167 GCAGGGGCTGGGAGGTGCTCAGG + Exonic
1131335229 15:91542666-91542688 TCATGTGTAGGCAGGTGCTCAGG - Intergenic
1132184697 15:99792745-99792767 GGGTGGGCAGGCAGGGGCAGGGG + Intergenic
1132432286 15:101771909-101771931 GGGTGGGCAGGCAGGGGCAGGGG - Intergenic
1132602946 16:782011-782033 CCCAGGGCAGGAAGGTGCTGGGG + Exonic
1132855523 16:2042970-2042992 GGGTGGGGAGGGAGGTGCTGGGG - Intronic
1133292794 16:4734112-4734134 GCAGGTGCCGGCAAGTGCTGGGG + Exonic
1134890905 16:17841133-17841155 GCAGGGGCAGGTAGGAGATGAGG + Intergenic
1135587775 16:23683995-23684017 GAATGGTCAGGCAGGTGATGGGG - Exonic
1136625198 16:31458080-31458102 GGATGGGCAGGTGGGAGCTGTGG + Intronic
1136654527 16:31702028-31702050 GCAGGAGCCGGCAGGAGCTGGGG + Intergenic
1136685238 16:31990164-31990186 GCAGGAGCAGGGAGGGGCTGGGG + Intergenic
1136785851 16:32933699-32933721 GCAGGAGCAGGGAGGGGCTGGGG + Intergenic
1136883920 16:33920105-33920127 GCAGGAGCAGGGAGGGGCTGGGG - Intergenic
1137394504 16:48107239-48107261 GCAGGGGCAGTCAGATGCTCTGG + Intronic
1137582321 16:49640898-49640920 GAATTGGCAGGCAGGGGCTGGGG - Intronic
1137744435 16:50810393-50810415 GCAGAAGCAGGCAGGAGCTGAGG - Intergenic
1138393291 16:56685341-56685363 GCATGGGCAGGAGCGTGATGTGG + Intronic
1139478487 16:67215339-67215361 GCATGGGCAGGTGGATACTGAGG - Intronic
1139592647 16:67942069-67942091 GGCTGGGCAGGCAGGCTCTGGGG + Intronic
1140661757 16:77195616-77195638 GCAGGGGTCGGGAGGTGCTGTGG - Exonic
1141962756 16:87420546-87420568 GCAAGGACAGGCTGGTCCTGTGG - Intronic
1142251320 16:88993350-88993372 GCAGGGGGAAGCAAGTGCTGAGG - Intergenic
1142299310 16:89247376-89247398 GCATGAGCGGGCAGGGGCTCGGG + Intergenic
1142372497 16:89690891-89690913 GCCTGCACAGGCAGGTGCTGGGG - Intronic
1142425767 16:90001524-90001546 CCAGGGGCAGCCACGTGCTGGGG - Intergenic
1203088088 16_KI270728v1_random:1195361-1195383 GCAGGAGCAGGGAGGGGCTGGGG + Intergenic
1142715543 17:1745200-1745222 CCTTGGGCCGGCAGGTACTGGGG + Exonic
1142867848 17:2801691-2801713 GCATGGGCAGCCTGGCCCTGGGG + Intronic
1143282129 17:5762829-5762851 CCTTGGACAGGCTGGTGCTGAGG - Intergenic
1143479425 17:7220010-7220032 GCTTGGGGCGGCAGCTGCTGAGG + Intronic
1143529774 17:7496064-7496086 ACATGTGCAGGTAAGTGCTGGGG + Exonic
1143901651 17:10178934-10178956 GCCAGGACAGACAGGTGCTGGGG + Intronic
1143965452 17:10753653-10753675 GCAGGGGCAGGCAAGGGCTGGGG + Intergenic
1144038921 17:11391218-11391240 GGGTGGGCAGGAAGGTGATGGGG + Intronic
1144074813 17:11707811-11707833 GCATGTGTGTGCAGGTGCTGAGG - Intronic
1144105445 17:11980704-11980726 GCATGATCAGGCTGGTGCGGTGG - Intronic
1144814001 17:18020574-18020596 GCCTGGGCAGGTAGGAGCTGTGG - Intronic
1145281191 17:21468238-21468260 GCGGGGGCAGGAAAGTGCTGGGG - Intergenic
1145312620 17:21708775-21708797 GCCTAGGCAGGAAGGAGCTGAGG + Intergenic
1145396135 17:22496512-22496534 GCGGGGGCAGGAAAGTGCTGGGG + Intergenic
1145996919 17:29110203-29110225 GCATGTCCTGGCTGGTGCTGGGG - Intronic
1146005203 17:29156384-29156406 GCCTGGGAAGGGAGGTCCTGGGG - Intronic
1146546295 17:33741752-33741774 GCATGGGTAGGCTGGTGCTGGGG - Intronic
1146789676 17:35744202-35744224 GCAGGGGGAGGCAGGTTCAGTGG + Intronic
1147146183 17:38485845-38485867 GCAGGAGCAGGGAGGGGCTGGGG + Intronic
1147339602 17:39745739-39745761 GCATGGGCAGGCTGAGGCGGTGG - Exonic
1147605081 17:41769798-41769820 GAATGGCCAGTCATGTGCTGGGG - Intronic
1147648905 17:42050781-42050803 GCGTGGGGCGGCAGGGGCTGGGG - Intronic
1147910622 17:43853844-43853866 GCAGGGGAAGACAGGGGCTGAGG + Exonic
1148071617 17:44911833-44911855 CCATGGGCAGGCACGGGCTCTGG + Intronic
1148147333 17:45374010-45374032 GCTTGCGCAGGCAGAGGCTGGGG - Intergenic
1148213393 17:45821295-45821317 GGATGGTCAGGCAGGGGCCGGGG + Intronic
1148460289 17:47835832-47835854 GCATGGGCAGATGGGTGCAGAGG - Intronic
1148872535 17:50667307-50667329 GCCTGGGGAGGCCGGTGCAGTGG + Intronic
1149661486 17:58336411-58336433 GTACGAGCAGGCAGGGGCTGAGG - Intergenic
1149684765 17:58528980-58529002 GGATGGACAGGCAGGAGGTGAGG - Intronic
1150134557 17:62688802-62688824 GCACAGGGAGGCAGCTGCTGGGG + Intronic
1150653515 17:67024891-67024913 GCAGGAGCAGGATGGTGCTGAGG - Exonic
1150961437 17:69916901-69916923 GGATGGGCAGACACATGCTGAGG + Intergenic
1151232517 17:72694931-72694953 CCGAGGCCAGGCAGGTGCTGTGG + Intronic
1151555262 17:74843292-74843314 GGGTGGGCAGGCATGGGCTGGGG + Exonic
1151855123 17:76715621-76715643 GCATTGGCAGGCAGGTGGGAAGG - Exonic
1152495598 17:80669128-80669150 GCAGGAGCAGCCAGGGGCTGGGG + Intronic
1152667546 17:81580070-81580092 GCACTGGGAGGCAGGAGCTGGGG - Intronic
1152750617 17:82060852-82060874 GCGGTGTCAGGCAGGTGCTGGGG - Exonic
1152879752 17:82808297-82808319 GCAGGGGCCAGCAGGTGCTGAGG + Intronic
1152879769 17:82808359-82808381 GCAGGGGCCAGCAGATGCTGGGG + Intronic
1152879811 17:82808480-82808502 GGAGGGGCTGACAGGTGCTGGGG + Intronic
1152879858 17:82808601-82808623 CCAAGGGCTGGCAGGTGCTGGGG + Intronic
1152879877 17:82808662-82808684 GGAGGGGCTGGCAGGTGCTGGGG + Intronic
1152879895 17:82808723-82808745 GCAGGGGCCGGCAGGTGCTGAGG + Intronic
1152879914 17:82808785-82808807 GGAGGGGCTGGCAGGTGCTGAGG + Intronic
1152879930 17:82808847-82808869 GGAGGGGCTGGCAGGTGCTGAGG + Intronic
1152879955 17:82808927-82808949 GCAGGGGCTGGCAGGTGCTGGGG + Intronic
1152920263 17:83063024-83063046 AAAAGGACAGGCAGGTGCTGGGG - Intergenic
1153544533 18:6192458-6192480 ACAGGAGCAGGCAGGTGCAGCGG + Intronic
1153551067 18:6262218-6262240 GCAAGGGCAGGAAGGCGCAGCGG + Intronic
1153631769 18:7077490-7077512 GCATAGACAGCCAGGTGCAGTGG - Intronic
1153752234 18:8244730-8244752 GTATGGGAAGGCAGTAGCTGAGG - Intronic
1155179324 18:23330573-23330595 ACATGAGCAGGCATGGGCTGGGG - Intronic
1156369121 18:36456767-36456789 ACATGGGCAGGCAAGAGCTGAGG - Intronic
1156476987 18:37411752-37411774 GCAGTGGCAGGCAGGAGATGAGG + Intronic
1157088783 18:44610610-44610632 GAAGGGGCAGGCTGGTCCTGAGG - Intergenic
1157223144 18:45841247-45841269 GCCTGGGCAGGTAGGAGCGGTGG + Intronic
1157278389 18:46328934-46328956 ACCTGGGCAGCCAGGTGCTCAGG + Intronic
1157475236 18:48019812-48019834 GCAGGCTCAGGCAGGTGCAGTGG - Intergenic
1157542169 18:48518798-48518820 GGAGGGGTAGGCAGGTCCTGAGG + Intergenic
1157681921 18:49614028-49614050 GGAAGGGCAGGCAGGTGGGGAGG + Intergenic
1157713121 18:49863646-49863668 GCTGGGGTAAGCAGGTGCTGAGG - Intronic
1158783873 18:60685361-60685383 GCAGGGGCAGGAAGGGGTTGCGG + Intergenic
1159122556 18:64187507-64187529 GTGTGGGCAGCGAGGTGCTGTGG - Intergenic
1159256528 18:65954387-65954409 CCATGGACGGGCTGGTGCTGGGG + Intergenic
1159942100 18:74416173-74416195 GCAGGGCCGGGCATGTGCTGAGG + Intergenic
1160352063 18:78191916-78191938 GCATGGGCAGGCAGGAGGTATGG - Intergenic
1160977404 19:1800069-1800091 GCCTTGGCAGGCACGTCCTGCGG + Exonic
1160978294 19:1804878-1804900 GCATGGGCTGGCAATTCCTGTGG - Intronic
1161449514 19:4337070-4337092 ACATGGGCAGGGAGGAGCTGGGG + Intronic
1161613619 19:5257644-5257666 GGGTGGGCAGGCAGGTGGGGTGG + Intronic
1162478523 19:10915065-10915087 GCTTGTGCAGGCAGGGGCAGGGG + Intronic
1162875454 19:13617924-13617946 CCATGGGCAGACAGGAGGTGTGG - Intronic
1162925675 19:13929709-13929731 GCATGGGGGGGGAGGTGCTCAGG + Intronic
1163571167 19:18083277-18083299 GAATGGGCCAGCAGGTGGTGGGG + Intronic
1163798285 19:19349584-19349606 GCCTGGGCAGGCAGGGCCAGAGG + Intronic
1164708792 19:30339784-30339806 TTCTGAGCAGGCAGGTGCTGTGG + Intronic
1164838505 19:31374660-31374682 GCATTAGCAGACAGCTGCTGGGG - Intergenic
1165830866 19:38729554-38729576 GGGTGGGCAGGGAGGGGCTGGGG + Exonic
1165874439 19:38996006-38996028 ACATGAGCAGCCAGGTGCAGTGG - Intronic
1166174542 19:41057416-41057438 GCATGGACAGAGAGGTGGTGGGG + Intergenic
1166536249 19:43576730-43576752 GCATGTCCAGGCTGGTCCTGCGG - Intronic
1167285371 19:48596197-48596219 GCAAGGGGAGGCAGGTGGGGAGG + Intronic
1167291126 19:48625823-48625845 GCAGGGGCAGGGAGGGGCAGGGG - Intronic
1167708015 19:51093360-51093382 GCAGGGGCAGGGAGCTGCTGAGG - Intergenic
1167721426 19:51182767-51182789 GCAGGGGCAGCGAGGGGCTGCGG + Intergenic
1167763550 19:51464003-51464025 GCAGGGGCAGCGAGGGGCTGCGG - Intergenic
1168254063 19:55156560-55156582 GAAAGAGCAGGCAGGTGCTCAGG - Intronic
925130844 2:1493044-1493066 GCCTGGGCAGGGAGCAGCTGAGG + Intronic
925169430 2:1741967-1741989 GCCTGGGGAGGCAGGGACTGAGG - Intronic
925422030 2:3720086-3720108 GCATGGGGAGGCAGCAGCTGTGG + Intronic
926196663 2:10768280-10768302 GCAGGGGCAGGGAGGTGCAGTGG - Intronic
926622566 2:15060292-15060314 GCATGGGGACGCAGGTGGGGAGG - Intergenic
926976423 2:18520923-18520945 GCATGGGCAGGCTGGCCCAGAGG - Intergenic
927193325 2:20531828-20531850 CCAAGGGCAGGCAGGTTCTGGGG - Intergenic
927742643 2:25586221-25586243 GCACGGGCGGCCAGGTGCGGTGG + Intronic
927845048 2:26467052-26467074 GCAAGGGCTGGCGGGTGCTCAGG + Intronic
927849577 2:26490476-26490498 GCCTGGGTGTGCAGGTGCTGAGG + Intronic
929790615 2:45019916-45019938 GCATGTGGAGCCAGGTGCGGTGG - Intergenic
929862516 2:45691859-45691881 GCATGGGAAGCCAGGTGAAGAGG + Intronic
934487252 2:94726690-94726712 GCATCGGCAGGAAAGTGCAGTGG - Intergenic
935060136 2:99600256-99600278 GCCAGGGCAGAAAGGTGCTGAGG + Intronic
936918308 2:117662280-117662302 GCAGGTCCAGGCAGGTCCTGGGG + Intergenic
937233775 2:120418263-120418285 GAATGGGCAGGCAAGTCTTGAGG + Intergenic
937355913 2:121197949-121197971 GCGTGGGCAGGCCGGGGGTGTGG - Intergenic
938734614 2:134175037-134175059 CCATGGGCAGGGTGGGGCTGTGG + Intronic
939882642 2:147647604-147647626 GCTTGGGGAGACAGGAGCTGTGG + Intergenic
939968425 2:148633822-148633844 GTATGGGTAGGAAGATGCTGGGG - Intergenic
940028930 2:149240095-149240117 GCATGTGCATACAGGTGCTTTGG + Intergenic
944190556 2:196998907-196998929 GAATGGGCAGGCAGGCGCTGTGG - Intronic
945347130 2:208731840-208731862 GCATGGCCAGGCAGGGACCGCGG + Intronic
945801222 2:214433744-214433766 GCAGGGGCAGGCAGGAGCAATGG + Intronic
946301073 2:218824352-218824374 TGCTGGGCAGCCAGGTGCTGGGG + Exonic
946355589 2:219182420-219182442 TCAGGGGCAGGCAGGGGCTGGGG - Exonic
946402374 2:219475406-219475428 CCATGGGCTGGGAGGTGGTGGGG - Intronic
946419577 2:219557428-219557450 CCGGGGCCAGGCAGGTGCTGCGG - Exonic
946705315 2:222452780-222452802 GCTGGGGTAGGTAGGTGCTGAGG + Intronic
946756649 2:222953977-222953999 GCATGGGCATGGAGGTGGGGAGG - Intergenic
946955165 2:224921810-224921832 GCAAGGACAGCCAGGCGCTGTGG + Intronic
947715944 2:232338884-232338906 GCCCTGGCCGGCAGGTGCTGTGG - Intronic
947734967 2:232449626-232449648 GCCCTGGCCGGCAGGTGCTGTGG - Intergenic
947999038 2:234552695-234552717 GAAAGGCAAGGCAGGTGCTGTGG + Intergenic
948029569 2:234806001-234806023 CCATGGGCAGACAGCTTCTGTGG - Intergenic
948231362 2:236351705-236351727 GCCCAGGCAGGGAGGTGCTGCGG + Intronic
948540610 2:238689323-238689345 GCAAGGGCAGACAGGAGCAGTGG - Intergenic
948646482 2:239408231-239408253 GCATTGCTAGCCAGGTGCTGTGG + Intergenic
948736952 2:240015056-240015078 GCATGTGCAGACAGCAGCTGTGG + Intronic
949045300 2:241870064-241870086 GCATGGCGAGGCAGGGGCTCCGG - Intronic
1168948314 20:1779637-1779659 GAATGGGCAGTCAGGTGGGGTGG - Intergenic
1170353755 20:15470281-15470303 GCATAGGCAGGCAGATCATGGGG - Intronic
1170431238 20:16278795-16278817 GCAGGGGATGGCGGGTGCTGTGG - Intronic
1170713010 20:18808926-18808948 GCATGAACAAGCAGGAGCTGGGG - Intergenic
1171892497 20:30728809-30728831 GCCTGCGCAGGCAGGTGAGGCGG - Intergenic
1172100132 20:32480355-32480377 GCAGGGGCAGGGATGTGCAGGGG + Intronic
1172781131 20:37437622-37437644 GGAAGGGCAGGAAAGTGCTGGGG - Intergenic
1173809965 20:45949588-45949610 GCATGGCGAGGCAGGTGCTGAGG + Intronic
1175720448 20:61282846-61282868 GCATTTGCACGCATGTGCTGTGG + Intronic
1175776347 20:61656235-61656257 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776353 20:61656255-61656277 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776359 20:61656275-61656297 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175952054 20:62588799-62588821 CCAGGGGTGGGCAGGTGCTGTGG - Intergenic
1175977424 20:62718045-62718067 CCCAGGGCAGGCACGTGCTGGGG + Intronic
1176044754 20:63086786-63086808 GCAGGGCCTGGCAGGAGCTGAGG + Intergenic
1176062375 20:63178114-63178136 GCAGGGGAAGGCAGCTGCGGAGG + Intergenic
1176263874 20:64198445-64198467 ACCTGGTCAGGCAGGTGCTGAGG - Intronic
1176376147 21:6087728-6087750 GCATGGCCAGGCAGGAGGTGGGG - Intergenic
1176382908 21:6122240-6122262 GCAAGGGCACGCAGGGGCTCAGG - Exonic
1176721718 21:10399045-10399067 CCATGGGCAGCCAGGAGCTGTGG + Intergenic
1177257391 21:18683124-18683146 GCACGGGCAGGCATGTGTTTTGG + Intergenic
1178493151 21:33067192-33067214 TCAAGGGGAGGCAGCTGCTGCGG - Intergenic
1178704385 21:34861322-34861344 GCAGAGGGAGGCAGGTCCTGGGG + Intronic
1179227474 21:39467813-39467835 GCAGGGGCAGGAAGGCACTGAGG - Intronic
1179477844 21:41659384-41659406 GGAGAGGGAGGCAGGTGCTGAGG + Intergenic
1179740561 21:43415999-43416021 GCAAGGGCACGCAGGGGCTCAGG + Exonic
1179747328 21:43450516-43450538 GCATGGCCAGGCAGGAGGTGGGG + Intergenic
1179883171 21:44301870-44301892 GCATGGGGTGGCAGGGGGTGGGG - Intronic
1180061927 21:45390104-45390126 GCATGGCCAGGCAGGGACAGGGG - Intergenic
1180302905 22:11051823-11051845 CCATGGGCAGCCAGGAGCTGTGG + Intergenic
1180796123 22:18606641-18606663 GGAAGGGCAGGCTGGCGCTGAGG - Exonic
1180999956 22:19983399-19983421 GCCTTGGCAGGCAGGTCCTGAGG - Intronic
1181045453 22:20212082-20212104 GGCTGGAAAGGCAGGTGCTGGGG - Intergenic
1181225599 22:21388630-21388652 GGAAGGGCAGGCTGGCGCTGAGG + Exonic
1181253035 22:21546183-21546205 GGAAGGGCAGGCTGGCGCTGAGG - Exonic
1181305358 22:21913732-21913754 GCCTGGGCAGGCAGATCATGAGG + Intergenic
1181603504 22:23966371-23966393 GCTTGGGCAGTCAGGAGATGTGG - Intergenic
1181605009 22:23974936-23974958 GCTTGGGCAGTCAGGAGATGTGG + Intronic
1182070832 22:27462545-27462567 GTCTTGGCAGGCAGGAGCTGGGG + Intergenic
1182281465 22:29220031-29220053 GGATGGGCTGGCAGGAGGTGGGG - Intronic
1182438194 22:30344908-30344930 GCCTGGGCAGGATGGGGCTGGGG - Intronic
1182454378 22:30440380-30440402 GAATGGGAAGGGAGGTTCTGAGG + Intergenic
1182886213 22:33776274-33776296 CCACAGGCAGGCAGGTGGTGTGG + Intronic
1183000595 22:34855558-34855580 GCCTTGGCAGGCAGGTCTTGAGG - Intergenic
1183298141 22:37044146-37044168 ACATAGGCAGGCAGGTGCTCTGG + Intergenic
1183309400 22:37101294-37101316 ACAGGGGCAGGCGGGTGCTGGGG + Intronic
1183456182 22:37924571-37924593 TCCTGGGGAGGCAGGTGCTGTGG + Intronic
1183484029 22:38079863-38079885 GCCTGGGCAGGCTGGTTTTGTGG + Intronic
1183573396 22:38671184-38671206 ACATGGTGAGGCAGGTGATGGGG + Exonic
1183732099 22:39624319-39624341 GCCAGGGCAGGCTGGTGCTGGGG - Intronic
1184018031 22:41800527-41800549 GGAGGGGCAGGCAGGGGCGGTGG + Intergenic
1184211501 22:43038486-43038508 CCGTGGGCAGCCAGGAGCTGTGG - Intergenic
1184415717 22:44350761-44350783 AGATGGGCAGGCAGGTGGGGTGG + Intergenic
1184425984 22:44409599-44409621 GCAGAGGAAGGCTGGTGCTGGGG - Intergenic
1184526320 22:45025622-45025644 GCATGGGCTGGTAGGGGCAGAGG - Intergenic
1184693296 22:46127142-46127164 GCATGGGCTGGCACGGGCCGGGG + Intergenic
1184794330 22:46722851-46722873 GCTGGGGCAGGGAGGTGGTGGGG + Intronic
1185280421 22:49967471-49967493 GCCTGGACAGGCAGCGGCTGAGG - Intergenic
1185315512 22:50177366-50177388 GCTTGGCCAGGAAGTTGCTGCGG - Exonic
950018257 3:9769148-9769170 GGATGGACAGGCAGGTGTTCGGG - Intronic
950182848 3:10927274-10927296 GCAGAGGGAGGCAGGGGCTGGGG + Intronic
950419390 3:12888893-12888915 GCATTGGGAGGCAGGTGCAGTGG + Intergenic
951611433 3:24495463-24495485 ACCTGGGGAGGCAGGTGCGGAGG - Intergenic
953023267 3:39129537-39129559 GCATGTGCAAGCAGGTGAGGGGG - Intronic
953203658 3:40800566-40800588 TCCAGGGTAGGCAGGTGCTGAGG + Intergenic
953215819 3:40917092-40917114 ATCTGTGCAGGCAGGTGCTGTGG + Intergenic
953338777 3:42116703-42116725 GCTTGGGGAGGCAGGCGCTCTGG - Intronic
954146980 3:48639368-48639390 GAATGGGAGGGCAGGAGCTGAGG - Intronic
954380304 3:50215705-50215727 GGGCGGGCAGGCAGGCGCTGAGG - Intronic
954596766 3:51831485-51831507 CCCTGGGGAAGCAGGTGCTGAGG - Intergenic
955396537 3:58561773-58561795 GCATGGTCAGGCTGGTGCAGGGG + Intergenic
956123331 3:65987951-65987973 GCAGGGGCATGCAAGTGCAGGGG - Intronic
959881418 3:111448416-111448438 GCATGGCTAGGCTGGGGCTGTGG - Intronic
960148301 3:114226430-114226452 GGATGGGGTGGCAGGTGCGGGGG + Intergenic
961294453 3:125873407-125873429 CCATGGGCTGCCGGGTGCTGTGG - Intergenic
961467257 3:127089396-127089418 GGTGGGGCAGGCAGGAGCTGGGG - Intergenic
961741184 3:129034029-129034051 TACTGGGCAGGCAGGTGCCGTGG + Intronic
961984257 3:131115815-131115837 CCATGGGCAGTGAGGTGATGAGG - Intronic
964442739 3:156728774-156728796 CCATGGGCAGCCAGCGGCTGTGG + Intergenic
964660337 3:159113687-159113709 GCTGGGGCAGGCAAGTGCCGAGG + Intronic
964689855 3:159438235-159438257 GCATGGTCAGGGAGGAGCTCTGG - Intronic
966691086 3:182742381-182742403 GCAGGGTCAGCCAGGTGCGGTGG + Intergenic
966940167 3:184741132-184741154 GCATGGAGTGGCAGGAGCTGGGG - Intergenic
967201982 3:187079819-187079841 TCCTTGGGAGGCAGGTGCTGTGG - Intergenic
967632201 3:191757763-191757785 ACAAAGGCATGCAGGTGCTGGGG - Intergenic
967996846 3:195173344-195173366 TAATGGCCAGGCAGATGCTGGGG - Intronic
968167842 3:196482092-196482114 GAAAGGGCAGCCAGGTGTTGTGG - Intronic
968524908 4:1051639-1051661 GCTTAGACAGGCAGGTGATGTGG + Intergenic
968699548 4:2048048-2048070 GCAGGGGCCGGCAGAGGCTGTGG + Intergenic
968741404 4:2333317-2333339 GCAAGGGGAGGCGGGGGCTGGGG - Intronic
968973721 4:3810382-3810404 CCAGGGCCAGGCATGTGCTGGGG + Intergenic
969132806 4:5004162-5004184 GAATGGGGGGTCAGGTGCTGGGG + Intergenic
969239055 4:5887810-5887832 GCATGGGCCGGACGGTGCGGGGG + Intronic
969402874 4:6968601-6968623 GCAGGGCCAGGCAGGTAGTGGGG + Intronic
969448610 4:7259955-7259977 GCTGGTGCAGGCAGGGGCTGAGG + Intronic
969609267 4:8217963-8217985 GCTGGGGGAGGCAGGTGCTTTGG + Intronic
969912713 4:10460366-10460388 GCAGGCACAGGCTGGTGCTGAGG + Intergenic
971359494 4:25923667-25923689 GCAGGGGCAGCAAGGTGCAGCGG - Intronic
975656020 4:76641894-76641916 CCAGGGAGAGGCAGGTGCTGGGG + Intronic
979099805 4:116599736-116599758 GGGTGGGCAGGGAGGGGCTGGGG + Intergenic
980275050 4:130640024-130640046 GGATGGCCAGGCAGGTTGTGGGG - Intergenic
981054804 4:140349791-140349813 CCATTGGGAGGCAGGTGCTGTGG - Intronic
981098983 4:140810422-140810444 GCATTGTCAGCCAGGTGCAGTGG - Intergenic
981103928 4:140859158-140859180 ACATGGCCAGGCAGGAGCTGTGG - Intergenic
982346568 4:154366932-154366954 GCATGGGCAGGGGGGTGCCCTGG + Intronic
984826812 4:183932581-183932603 GTATGGGCAGGCTGATGTTGAGG - Intronic
985188533 4:187345687-187345709 GTATTGGAAAGCAGGTGCTGGGG - Intergenic
985241481 4:187935327-187935349 GCATGCACAGCCAGGTGCTGTGG + Intergenic
985572167 5:652879-652901 GCATGGGCACGAAGGTGCCCTGG - Intronic
986550880 5:8953676-8953698 GCAGGGGCGGGCAGATCCTGAGG - Intergenic
987700661 5:21393764-21393786 TTATGAGCAGCCAGGTGCTGAGG + Intergenic
988432375 5:31134336-31134358 TCTTGGCCAGGCAGGTGCGGTGG + Intergenic
992039622 5:72816916-72816938 GCCTGGGCGGGCAGCTGTTGGGG - Intronic
992087342 5:73289782-73289804 ACATGGGCAGGCAGCTGGTGAGG + Intergenic
992359483 5:76022261-76022283 TCATGGGCAGTCAGGTACTTGGG - Intergenic
993475452 5:88358560-88358582 ACATATCCAGGCAGGTGCTGAGG - Intergenic
993554203 5:89315397-89315419 CCCTGCGCAGGCGGGTGCTGTGG - Intergenic
995015362 5:107303427-107303449 GTGTGGGGAGGCAGGTGCTTGGG + Intergenic
995594638 5:113734719-113734741 ACATGAGCAGGCAGGGGCAGGGG + Intergenic
996835507 5:127787356-127787378 GCCTGGGCTGGCAGGTGAGGAGG - Intergenic
997206051 5:132050822-132050844 GAATGGGGAGGCAGGTGCATGGG + Intergenic
998138082 5:139684909-139684931 GCGGGGGCAGGCAGGGGCGGTGG + Intergenic
998623822 5:143823440-143823462 ACAAGGTCAGGCAGGTGTTGGGG - Intergenic
999331148 5:150674207-150674229 GACTGGGCAGGCAGGGTCTGAGG - Intronic
999379569 5:151110699-151110721 GGTTGGGGAGGCTGGTGCTGGGG + Intronic
999408139 5:151325257-151325279 TCATGGGCTGTCAGGTGGTGGGG - Intronic
1000146048 5:158454424-158454446 GGCTGGGAAGACAGGTGCTGCGG + Intergenic
1001514982 5:172349371-172349393 GCATGGGCACGCTGGTGCCCAGG - Intronic
1001747246 5:174101024-174101046 GCAATGGCAGGCTGGGGCTGAGG + Intronic
1001950675 5:175814493-175814515 GCGGGGGCAGGAAGGAGCTGAGG + Intronic
1002106220 5:176880592-176880614 GCAGGGGCAGGGAGGAGCCGTGG - Exonic
1002347474 5:178557908-178557930 GCATGGACAGGGGTGTGCTGAGG + Intronic
1002447282 5:179297378-179297400 GCATTGCCAGGCAGGTGGGGTGG - Intronic
1002994322 6:2268586-2268608 GCAAGACCAGGCAGGTGATGGGG + Intergenic
1003319090 6:5036518-5036540 CCATGGCCAAGCAGGGGCTGAGG - Intergenic
1003498109 6:6682248-6682270 GCCTGGGCAGACAGTTGGTGAGG + Intergenic
1004754952 6:18601149-18601171 CCATGGGCAGGCAGCCTCTGGGG - Intergenic
1005887950 6:30111504-30111526 GCCTGGCCGGTCAGGTGCTGAGG + Intronic
1006669928 6:35723787-35723809 GCACGGGCAGTGTGGTGCTGTGG + Intronic
1007074278 6:39056900-39056922 GCACAGGCTGGGAGGTGCTGAGG - Intronic
1007400509 6:41599993-41600015 GACTGGGAGGGCAGGTGCTGGGG - Exonic
1007454035 6:41962385-41962407 GCTTGGGCAGCCAGGCGCAGTGG - Intronic
1007473886 6:42106787-42106809 CCTTGGGCTGGCTGGTGCTGTGG + Exonic
1007731615 6:43951016-43951038 GCATGGGCATGCAGATGCAGAGG + Intergenic
1007744055 6:44031341-44031363 GCATGGCCAGGGAAGAGCTGAGG - Intergenic
1009643092 6:66362722-66362744 CCATGGGCAGGCCGGGGCGGGGG + Intergenic
1009977073 6:70682748-70682770 GAATGGCTAGGCAAGTGCTGTGG + Intronic
1010447498 6:75964442-75964464 GCAGGGGCAGGCAGATCTTGAGG + Intronic
1011974735 6:93282650-93282672 AGAGGGGCAGGCAGGAGCTGGGG + Intronic
1013316386 6:108947142-108947164 GCATGGGCAGGAGGGAGCTGGGG + Intronic
1013769934 6:113617137-113617159 GCAAAGTCAGCCAGGTGCTGTGG + Intergenic
1014425133 6:121295246-121295268 CGATGGGTAGGCAGGTGCTGAGG - Intronic
1014647386 6:123991328-123991350 TCATGGGCAGGCATGAGATGGGG + Intronic
1016041724 6:139438520-139438542 GCATGGGCATGGAGTGGCTGTGG - Intergenic
1016663727 6:146610914-146610936 GCATGGACAGGCCAGTGGTGGGG + Intronic
1017722406 6:157253133-157253155 GCATGGACAGCCGTGTGCTGTGG + Intergenic
1018253363 6:161894492-161894514 GCTTGGAAAGGCAGGTGCTGTGG - Intronic
1018613296 6:165662889-165662911 GCAGGGGTGGGCAGGTCCTGCGG - Intronic
1018859768 6:167703119-167703141 GCAGCTGCAGGCAGGTCCTGTGG - Intergenic
1019131700 6:169881723-169881745 GCATGTGCAGGCAGCAGCGGGGG - Intergenic
1019450104 7:1093156-1093178 GCAGCGGCAGGCAGGTGCAGCGG - Exonic
1019567775 7:1693124-1693146 GCATGGGCAGTCACTTCCTGGGG - Exonic
1019614547 7:1953185-1953207 GCACCAGCAGGCAGGTGGTGCGG - Intronic
1019697091 7:2451966-2451988 GCATGGCCAGCATGGTGCTGAGG - Intergenic
1021747107 7:23752716-23752738 GCAAGAGAAGGCAGCTGCTGTGG + Exonic
1021934192 7:25614155-25614177 TCAGTGCCAGGCAGGTGCTGAGG + Intergenic
1022312769 7:29212805-29212827 GCTGGGGTAGGTAGGTGCTGAGG - Intronic
1023824174 7:43997691-43997713 GCATGGGCAGGCAGGTGCTGGGG - Intergenic
1023843980 7:44111022-44111044 GCATGCGCCTGGAGGTGCTGGGG + Exonic
1024063900 7:45717594-45717616 GCATGGCCAAGCAAGGGCTGAGG - Exonic
1024974002 7:55096754-55096776 GCAGGGGCTGACAGGTGCTGTGG - Intronic
1026765578 7:73157427-73157449 GCATGGGGTGGCAGGTCCTCAGG - Intergenic
1026944254 7:74306134-74306156 GCCTGGGCAGGCAGCACCTGCGG - Intronic
1027000347 7:74648651-74648673 GCATTTGCAGCCAGGTGCGGTGG - Intergenic
1027042051 7:74967120-74967142 GCATGGGGTGGCAGGTCCTCAGG - Intronic
1027081590 7:75235234-75235256 GCATGGGGTGGCAGGTCCTCAGG + Intergenic
1027327924 7:77062742-77062764 GCATGGGCAGGCAGGTGCTGGGG + Intergenic
1028774001 7:94657986-94658008 GCCTGGGCAGGCAGGCGCTAAGG - Intronic
1028928100 7:96382375-96382397 GAATGACCAGCCAGGTGCTGTGG - Intergenic
1029152606 7:98491632-98491654 GGATGGACTGGCAGGTGCTCAGG - Intergenic
1029272703 7:99386378-99386400 GGAGGGGCTGGCAGGTGCAGGGG + Intronic
1029590238 7:101502559-101502581 TCAGGGACTGGCAGGTGCTGTGG + Intronic
1029752439 7:102551020-102551042 GCATGGGCAGGCAGGTGCTGGGG - Intronic
1029770391 7:102650113-102650135 GCATGGGCAGGCAGGTGCTGGGG - Intronic
1030090128 7:105851008-105851030 GCAAGGGGAGGGAGGTGTTGTGG - Intronic
1031513523 7:122675918-122675940 GCATGGGCGTGCATGTGCCGTGG - Intronic
1032202831 7:129835096-129835118 GAGTGGGCAGGCATGTGCTTTGG + Intronic
1033056725 7:138061839-138061861 GCAATGTCAGGCAGGTGGTGGGG - Intronic
1033262050 7:139852357-139852379 GGAAGGTCAGGCAGGTTCTGTGG + Intronic
1033597830 7:142869188-142869210 GCATGCCCCAGCAGGTGCTGGGG + Intronic
1033953632 7:146816448-146816470 GCATGGGCAGTCAGTTGGTGAGG - Intronic
1034161355 7:148996224-148996246 GCATGGGAGGCCAGGTGCAGTGG - Intergenic
1034418077 7:150975514-150975536 CCAAGGGCAGTCAGGAGCTGAGG + Intronic
1034441280 7:151087137-151087159 GCATGGCCAGGCACGGCCTGTGG - Intronic
1034474633 7:151275395-151275417 GCATGGGCCAGCTGGGGCTGGGG + Intronic
1034561930 7:151885889-151885911 GCAGGGGCAGGGAGGGGCTGGGG + Intergenic
1034940419 7:155226908-155226930 GCATCAGCTGGGAGGTGCTGGGG - Intergenic
1034961176 7:155365533-155365555 TCAGGGACAGGCAGGTTCTGAGG + Intronic
1035125408 7:156605321-156605343 GGATGAGCAGGCAGGTGCACTGG + Intergenic
1035333440 7:158111196-158111218 GAAGGGACAGGCAGGTGCGGCGG + Intronic
1035397339 7:158543881-158543903 GCAGGGGCAGCCTGGTGCAGAGG - Intronic
1035472474 7:159119241-159119263 TCAGGGGCAGCCAGGAGCTGTGG - Intronic
1035570747 8:670950-670972 GCTGGGGCTGGCAGGTGCAGAGG - Intronic
1035570764 8:671008-671030 GCAGGGGCCGGCAGGTTCAGAGG - Intronic
1035695443 8:1592131-1592153 GCCTGGGCGGGCGTGTGCTGGGG - Intronic
1035842183 8:2825075-2825097 TCCTGGCCAGGCTGGTGCTGAGG - Intergenic
1037465377 8:19154615-19154637 GCAGGGGCAGGCAGATTATGAGG + Intergenic
1037998150 8:23368306-23368328 GCATAGCCAGGCAGCTGCAGAGG + Exonic
1038048866 8:23790495-23790517 GGATGGGCAAGCAGGTCCTCAGG + Intergenic
1038479056 8:27889007-27889029 GAATGGGGAGGCAGGTGCTGTGG - Intronic
1038652783 8:29420823-29420845 GCAGGGGCCTGGAGGTGCTGGGG + Intergenic
1040063746 8:43127658-43127680 GCATGGGCAGGCTTTAGCTGTGG + Intergenic
1041010857 8:53542206-53542228 GAATGCACAAGCAGGTGCTGTGG - Intergenic
1041394433 8:57376625-57376647 GCCAGGCCAGGCAGGGGCTGTGG + Intergenic
1041804648 8:61836781-61836803 GGCTGGGCAGGCTTGTGCTGAGG + Intergenic
1042143857 8:65707063-65707085 GCAGGGGGAGGCAGGGGCGGTGG - Exonic
1042571229 8:70167338-70167360 GCATGGGGAGGCTTGTGCAGGGG - Intronic
1043820287 8:84854930-84854952 ATATGGGCTGACAGGTGCTGGGG + Intronic
1046135313 8:110018524-110018546 GGATGGGCAGGCAGGTTCTTAGG + Intergenic
1049048486 8:140172140-140172162 GGAAGGGCAGGCAGAGGCTGTGG + Intronic
1049210228 8:141382982-141383004 GCATGGCCAGGCGCGTGCAGGGG - Intergenic
1049351083 8:142165160-142165182 GCAGAGGCAGGCAGGACCTGTGG + Intergenic
1049366174 8:142237966-142237988 GCGTGGGCAGGCGGGTGGCGTGG - Intronic
1049386558 8:142345677-142345699 GCTTGGAGATGCAGGTGCTGAGG - Intronic
1049415230 8:142491982-142492004 GCAGAGGCAGGCAGGGGCTCAGG + Intronic
1049561988 8:143316598-143316620 CCAGGGGAAGCCAGGTGCTGGGG - Intronic
1049696611 8:143986991-143987013 GAATGGGCAGGCAAGACCTGAGG - Intronic
1049701990 8:144019524-144019546 GCACGGGCAGGTGGGAGCTGCGG + Intronic
1049782283 8:144434532-144434554 GCATGGGCTGGGAGCTGCTGGGG - Intronic
1050694240 9:8261206-8261228 GGATGGGCAGGGAGGTGGAGGGG + Intergenic
1051482915 9:17578983-17579005 GAACGCCCAGGCAGGTGCTGTGG - Intergenic
1053670551 9:40357661-40357683 GCATCGGCAGGAAAGTGCAGTGG + Intergenic
1054356325 9:64066926-64066948 GCCTGCGCAGGCAGGTGAGGCGG + Intergenic
1054381674 9:64497724-64497746 GCATCGGCAGGAAAGTGCAGTGG + Intergenic
1054514062 9:66018639-66018661 GCATCGGCAGGAAAGTGCAGTGG - Intergenic
1056259648 9:84835057-84835079 GCATGGGTAGGCAGTTGTTATGG - Intronic
1056693579 9:88827957-88827979 GCATGCGGATGCATGTGCTGAGG + Intergenic
1057881442 9:98795808-98795830 GGAAGGGAAGGCAGGTTCTGAGG + Intronic
1058995130 9:110292185-110292207 GCGTGGGCAGCCGGGGGCTGTGG - Intergenic
1059381564 9:113931127-113931149 GTAAGGGCAGAGAGGTGCTGTGG + Intronic
1059423249 9:114205755-114205777 GCAGGGGCAGCCAGGACCTGAGG + Exonic
1060104252 9:120863681-120863703 GGATGGGAAGACAGGGGCTGAGG + Intronic
1060231186 9:121826837-121826859 GGATGGGCAGAGATGTGCTGGGG + Intronic
1060484094 9:124036388-124036410 GTGAGGGGAGGCAGGTGCTGAGG + Intergenic
1060822410 9:126669144-126669166 GCATGGGCAGGAAGGTGGAAGGG + Intronic
1060966542 9:127715129-127715151 GCGTGGGCATGGCGGTGCTGGGG - Exonic
1061174639 9:128986688-128986710 GCATGGGCAGGGAAGACCTGGGG + Intronic
1061486691 9:130923914-130923936 GGCTGGGCAGGAACGTGCTGGGG - Intronic
1061662355 9:132138652-132138674 GCATGCGCAGGCACGTGTAGAGG - Intergenic
1061826303 9:133260445-133260467 TCATGGGCAGACAGTGGCTGGGG - Intronic
1062142643 9:134968226-134968248 GCAAGGCCAGGCAGCTGCTCCGG - Intergenic
1062252355 9:135604722-135604744 ACATGGGGAGGCCAGTGCTGTGG - Intergenic
1062267465 9:135693837-135693859 GGCAGGGCAGGCAGGTGCTCTGG + Intronic
1062392155 9:136338126-136338148 TCATGGGGAGGCAGGCGGTGGGG + Intronic
1062497666 9:136839272-136839294 GCCTGGCCAGGGGGGTGCTGCGG - Exonic
1062510702 9:136904081-136904103 GCGAAGGCTGGCAGGTGCTGCGG - Intronic
1062524609 9:136973196-136973218 GCAAGGGCTGCCAGGTGCTGTGG - Intergenic
1062635193 9:137486952-137486974 GCAGGGGCACGCAGGTGGTGGGG - Intronic
1187474850 X:19601843-19601865 GACAGGGCAGGCAGTTGCTGGGG - Intronic
1189670943 X:43408033-43408055 GCTGGGGTAGGTAGGTGCTGAGG + Intergenic
1190119106 X:47645846-47645868 GCAAGGGCAGGCAGGTTATTTGG - Intronic
1190180442 X:48187166-48187188 GCATGGTTAGGCAGGCGCAGAGG + Intronic
1190215860 X:48478968-48478990 CCATGGGCAGGCGGGATCTGAGG + Intronic
1191185602 X:57607838-57607860 GCAGGGGCTGGCAGCTGCTCGGG - Intergenic
1194035346 X:88863997-88864019 GCTGGGGCTGGCACGTGCTGGGG + Intergenic
1195314723 X:103666303-103666325 GTGTGGGTAGGCAGGTGGTGAGG - Intergenic
1195357021 X:104048622-104048644 GTATGGGAAGCCAGGTTCTGTGG - Intergenic
1195495273 X:105524149-105524171 ATATAGGTAGGCAGGTGCTGGGG + Intronic
1195673461 X:107488127-107488149 GCATGGGTAGGCAGGAGCCAAGG - Intergenic
1196895854 X:120334819-120334841 ACATGGGCTGGCAGGGACTGAGG - Intergenic
1197772497 X:130098113-130098135 CCATGGGCAGGCAGGGGGTGTGG + Intronic
1197846570 X:130810381-130810403 TCATGGCCAGCCTGGTGCTGGGG - Intronic
1198116780 X:133551851-133551873 GAGGGTGCAGGCAGGTGCTGGGG - Intronic
1198437274 X:136629580-136629602 GCCTGAGCAAGCAGGAGCTGAGG + Intergenic
1199684474 X:150254270-150254292 GCAAAGGCAGGCAGGAGCTGGGG + Intergenic
1199769177 X:150963278-150963300 GTTTGGGAAGCCAGGTGCTGTGG + Intergenic
1200230827 X:154443163-154443185 GCAAGGGCTGGGAGGGGCTGGGG - Exonic
1202367306 Y:24174173-24174195 GGGTGGGCAGGCAGGAGCAGGGG + Intergenic
1202503475 Y:25495950-25495972 GGGTGGGCAGGCAGGAGCAGGGG - Intergenic