ID: 1029753108

View in Genome Browser
Species Human (GRCh38)
Location 7:102555438-102555460
Sequence TTGTGCTTCTAGAAGAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85959
Summary {0: 8, 1: 0, 2: 152, 3: 5593, 4: 80206}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029753108_1029753115 24 Left 1029753108 7:102555438-102555460 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1029753115 7:102555485-102555507 CACCTGTAATCCCAGCTACTTGG 0: 27298
1: 77225
2: 165100
3: 221696
4: 302720
1029753108_1029753112 -3 Left 1029753108 7:102555438-102555460 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1029753112 7:102555458-102555480 CAAAAATGAGCTGGGCGTTCTGG 0: 7
1: 9
2: 712
3: 22770
4: 95694
1029753108_1029753113 0 Left 1029753108 7:102555438-102555460 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1029753113 7:102555461-102555483 AAATGAGCTGGGCGTTCTGGTGG No data
1029753108_1029753116 25 Left 1029753108 7:102555438-102555460 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1029753116 7:102555486-102555508 ACCTGTAATCCCAGCTACTTGGG 0: 15366
1: 98640
2: 233329
3: 337639
4: 469862
1029753108_1029753118 28 Left 1029753108 7:102555438-102555460 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1029753118 7:102555489-102555511 TGTAATCCCAGCTACTTGGGAGG 0: 48952
1: 142577
2: 242332
3: 522592
4: 386712
1029753108_1029753114 1 Left 1029753108 7:102555438-102555460 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1029753114 7:102555462-102555484 AATGAGCTGGGCGTTCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029753108 Original CRISPR TTGTGCTTCTAGAAGAGACA GGG (reversed) Intronic
Too many off-targets to display for this crispr