ID: 1029755273

View in Genome Browser
Species Human (GRCh38)
Location 7:102569710-102569732
Sequence GCCCAGAGCAAGCCCCCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 4, 1: 0, 2: 2, 3: 20, 4: 226}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029755272_1029755273 -8 Left 1029755272 7:102569695-102569717 CCAAGATTATAAAATGCCCAGAG 0: 3
1: 1
2: 2
3: 17
4: 197
Right 1029755273 7:102569710-102569732 GCCCAGAGCAAGCCCCCAGAAGG 0: 4
1: 0
2: 2
3: 20
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029755273 Original CRISPR GCCCAGAGCAAGCCCCCAGA AGG Intronic
900583120 1:3419057-3419079 GACCAGAGCCAGGGCCCAGAGGG + Intronic
900716904 1:4150837-4150859 GCCCAGAGGAAGCGGCAAGAGGG + Intergenic
901478212 1:9505367-9505389 GCCAAGAGCAAGAGCCCAGGAGG + Intergenic
901506282 1:9687910-9687932 GCCCAGAGCACCCCCCAAGGAGG - Intronic
901768969 1:11521022-11521044 CCCCAGAGCCAGCACCCAGCAGG - Intronic
902384899 1:16070995-16071017 GCCCAGAGCTTGCACCCAGCTGG - Intronic
903778089 1:25805948-25805970 GAACAGAGGAAGCCCACAGAGGG - Intronic
904537214 1:31207777-31207799 GCTCAGTGCAAGTCCCCAGAGGG - Intronic
904943078 1:34178166-34178188 GGCCAGAACATTCCCCCAGAAGG - Intronic
907701922 1:56797152-56797174 GCCCAGAGCATGAACACAGAAGG + Intronic
912648592 1:111418381-111418403 CCACAGAGCAAGATCCCAGAGGG + Intronic
913550875 1:119915850-119915872 CCCCAGAGCAGGCCACCTGAAGG - Exonic
917502334 1:175597255-175597277 TCCCAGACCAAGTCCCCACAGGG + Intronic
917962982 1:180159047-180159069 CTCCAGACCAAGCCCCCAGTGGG + Intronic
922763233 1:228145097-228145119 TCTCAGAGCAGGCTCCCAGAGGG + Intronic
1063146762 10:3302025-3302047 GCCCAGCTCAAGCACACAGAGGG - Intergenic
1063655981 10:7989135-7989157 TCCCAGAGCAAGCTCTCAGTGGG + Intronic
1063666312 10:8062731-8062753 GCCCAGAGGAGGACCCCGGAGGG - Intronic
1063984904 10:11491824-11491846 GCCCTCAGCAAGCACTCAGATGG - Intronic
1065746141 10:28844310-28844332 GGCCAGAGCAGTCCTCCAGATGG + Intergenic
1067094884 10:43293914-43293936 GCCCAGAGCAAGACCCTGGGGGG - Intergenic
1067158019 10:43799252-43799274 GGCCAGAGAAAGCCTCCAGAAGG + Intergenic
1067191135 10:44069143-44069165 TCCCAGAGCAAGACAGCAGAGGG - Intergenic
1068117660 10:52752050-52752072 GCCCAGTGCCAACCCCCACATGG - Intergenic
1068576949 10:58694754-58694776 ACCCAGAGATAGCCCCCAAATGG - Intronic
1068590818 10:58851121-58851143 TCCAAGATCAAGCCACCAGAAGG - Intergenic
1069571796 10:69498640-69498662 GCCCAGAGCAGGCCTGCACAAGG - Intronic
1069759294 10:70797770-70797792 GCCCAGACCGATCCCCCACACGG - Intergenic
1070642100 10:78177608-78177630 GCCCACAGCCAGCCCTGAGAGGG - Intergenic
1070955679 10:80461815-80461837 GCTCAGTGCAAGCCCTCAGCAGG - Intronic
1072656545 10:97334232-97334254 GCGCAGCGCAGGGCCCCAGAGGG + Exonic
1073418760 10:103406580-103406602 GCCCAGACCCAGGCCCCAAAAGG - Intronic
1073479643 10:103778386-103778408 GCACAGAGGAAACCCCCAGAAGG + Intronic
1073968120 10:109014721-109014743 GGCCAGAGAAAGGCCCCTGATGG + Intergenic
1075632223 10:124007273-124007295 GCTGAGGGCAAGCCCGCAGAAGG - Intergenic
1076697939 10:132256067-132256089 TCCCAGAGTAAGACCCCAGTTGG - Intronic
1077355625 11:2115418-2115440 GGCCAGAGCAATGGCCCAGAGGG + Intergenic
1079093105 11:17494436-17494458 AGCCAGAGCAAGGCCCCACAAGG + Intronic
1080606394 11:33868797-33868819 GCCCAGAGCCAGCTCCGAGGTGG + Intronic
1083551037 11:63590423-63590445 GCTCAGAGCTGGCCCCCAGCCGG + Intronic
1083755264 11:64788774-64788796 GCCCAGGAGGAGCCCCCAGAGGG - Intergenic
1083848217 11:65349170-65349192 GCCGAGATCAGGCACCCAGAAGG + Intronic
1084161582 11:67353237-67353259 GCCTAGAGGAGGCCCCTAGAGGG - Intronic
1084743765 11:71155165-71155187 CCCCAGCCCAAGCTCCCAGAGGG + Intronic
1084743777 11:71155197-71155219 CCCCAGCCCAAGCTCCCAGAGGG + Intronic
1084743813 11:71155296-71155318 CCCCAGCCCAAGCTCCCAGAGGG + Intronic
1084944450 11:72631214-72631236 GCCCCCAGCAAGCCCACGGATGG + Intronic
1086561519 11:88174921-88174943 GCCCAGAGCAGGCCTCCCCAGGG - Intronic
1088835495 11:113574998-113575020 CCCCAGAGAACGCACCCAGAGGG + Intergenic
1088943068 11:114480172-114480194 GCCCAAAGAAAGCCTCTAGATGG + Intergenic
1089168628 11:116497384-116497406 GGCCAGGGCAAGAGCCCAGAGGG + Intergenic
1089293098 11:117450223-117450245 GCTCAGAGGAAGCTCCCAGCAGG - Intronic
1089558731 11:119332396-119332418 CACCAGAGCAGGCCTCCAGAGGG + Intergenic
1089861182 11:121591208-121591230 GCCCAGAGCACACCCCCAGAAGG - Intronic
1089894633 11:121917869-121917891 ACCCAGATCAAGCCCTGAGATGG + Intergenic
1091556453 12:1577178-1577200 ACACAGGGCAGGCCCCCAGAGGG - Intronic
1098371106 12:69760469-69760491 ACACAGAGCAAGTCCCCAAACGG - Intronic
1099285100 12:80707646-80707668 ACCCAGAGGAACCACCCAGATGG - Exonic
1099886200 12:88534279-88534301 ACCCAGAACAAGTGCCCAGAGGG - Intronic
1101815075 12:108140067-108140089 GCCCAGGGCAAGAACTCAGAAGG + Intronic
1101882361 12:108634159-108634181 GGCCAGAGGGAGCCCCCTGAAGG + Intergenic
1102788775 12:115625791-115625813 TCCAAGAGAAAGCCCTCAGATGG + Intergenic
1103926829 12:124427845-124427867 GACCACAGGAAGCTCCCAGAAGG + Intronic
1104423592 12:128656929-128656951 TCCCAGAGGTAGCCCCCAAAAGG - Intronic
1104830823 12:131750065-131750087 GCCCAGGGCCAGCCTCCCGAAGG - Intronic
1104931426 12:132341326-132341348 GCCCAGCGGAAGCCTCCAGCAGG - Intergenic
1104955473 12:132463145-132463167 CCCCTGGGCAAGCACCCAGAAGG + Intergenic
1105805730 13:23950796-23950818 TCCCAGGGCCAGCCCCCAGGAGG + Intergenic
1106248475 13:27967344-27967366 GCCCAGAGACAGCCCCCAAAGGG + Intronic
1106314303 13:28579603-28579625 GCACAGGACAAGCACCCAGAAGG - Intergenic
1106487451 13:30184974-30184996 GCCCACAGAAAGCACCCAGCAGG + Intergenic
1108185232 13:47882092-47882114 TCCCAGAGCACTCACCCAGATGG + Intergenic
1108292629 13:48976334-48976356 GCCCACAGCGCGCCCACAGAAGG - Intronic
1113461642 13:110486049-110486071 ACCCAGCACAAGCCCACAGAAGG - Intronic
1113578804 13:111413901-111413923 GGCCAGAGCAGGCCTTCAGAGGG + Intergenic
1118007535 14:61577124-61577146 TCCCAGAGGAGGCCCCCAAAGGG + Intronic
1119046377 14:71321276-71321298 GCCCGGAGCAGGACCCCAGGAGG + Intronic
1119909714 14:78338488-78338510 TCCCATAGCAAGCCACCTGATGG + Intronic
1121327291 14:93028651-93028673 GCCCAGAGCAGGCCCCCTGCAGG + Intronic
1123940387 15:25213879-25213901 GCCAACAGAAAGCCCACAGAGGG - Intergenic
1124157275 15:27236925-27236947 GCCCAGAGCAAGTCCTCCAAGGG - Intronic
1125213901 15:37247027-37247049 GCCCAGGGCAAACCCCCCGCTGG + Intergenic
1128061720 15:64739575-64739597 ACCAAGAGCAGGCCCCCAGGTGG - Intergenic
1132517164 16:371239-371261 ACCAAGAGGAAGCTCCCAGAGGG + Exonic
1132602358 16:779375-779397 GCCCAGAGCCTGGCCCCACAGGG - Intronic
1132796857 16:1728795-1728817 GCACACAGCAGCCCCCCAGACGG + Intronic
1134266518 16:12697443-12697465 GCCCAGAACAAGCCTCCTGAAGG - Intronic
1137714560 16:50590720-50590742 GCCCAGACCATGCCCCCACATGG - Intronic
1138582862 16:57952952-57952974 CCCCAGGGCAGGCCCCCAGGAGG + Intronic
1138747935 16:59385324-59385346 GCTGAGAGAAAGCCCTCAGATGG + Intergenic
1141133884 16:81453351-81453373 GCCCAAGGGAAGCACCCAGATGG - Intronic
1141638472 16:85328227-85328249 CTCCACAGCAAGCCCCCAGACGG + Intergenic
1142247643 16:88977159-88977181 GCGCAGGGCAGGGCCCCAGATGG - Exonic
1143634847 17:8158691-8158713 ACCCAGTGCCAGCGCCCAGATGG - Intronic
1148070612 17:44906537-44906559 GCCCACAGCGTGCCCACAGATGG + Intronic
1149893333 17:60409471-60409493 CCCCAGAGCAAGCAATCAGAGGG + Intronic
1152285880 17:79413181-79413203 GCCCAGACCCAGCCTCAAGAGGG + Intronic
1152931873 17:83114101-83114123 GCCCAGAGAAAGGCACCACACGG + Intergenic
1152933765 17:83124289-83124311 GCCCCCAACAAGCCCCCAGATGG - Intergenic
1154305696 18:13229210-13229232 GCCCATGGCAAGCCCTCAGGAGG - Intronic
1156332138 18:36132280-36132302 GCCCAGGGCTAGCCCACAGATGG - Intronic
1156360132 18:36377666-36377688 TCCTACAGCAAGCACCCAGAGGG - Intronic
1157498283 18:48171689-48171711 GCCCAGAGCAGGCACACAGTAGG + Intronic
1161379206 19:3955841-3955863 GCCCAGAGGAAGGCCAGAGACGG + Intergenic
1161925106 19:7294046-7294068 GCCCAGAGGCAGCCCCGGGAAGG + Intergenic
1162155867 19:8677628-8677650 TCCCAGAGGAAGCCCTCAGAGGG - Intergenic
1163881864 19:19930601-19930623 GCCCAGACAAGGCCACCAGAGGG - Intronic
1163885230 19:19959386-19959408 GCCCAGACAAGGCCACCAGAGGG - Intergenic
1164574029 19:29395036-29395058 GCACACAGCAAGCCCTCAGCAGG + Intergenic
1164714435 19:30381200-30381222 GCACAAACCATGCCCCCAGAGGG + Intronic
1165462658 19:35953201-35953223 GCCCAGTGCAAGGACCCAGATGG - Intergenic
1166329199 19:42069099-42069121 GCGCAGAGCAGGCCCCTAGTGGG + Intronic
1167116517 19:47492149-47492171 GCTCAGGGCAAGCAGCCAGAGGG + Intronic
1167802257 19:51751826-51751848 ACCCAGAGCAAGACCACAGCTGG - Exonic
1167806085 19:51786734-51786756 TCCCAGAGCAAGGACCCAGCTGG - Intronic
925337642 2:3109473-3109495 CCCCATAGCAAGACCCCAGTGGG + Intergenic
925378809 2:3409076-3409098 GCCCAGGGCATGGCACCAGAGGG - Intronic
926227776 2:10980701-10980723 GCCCAGAGCAGGCCCCTGGCTGG - Intergenic
926632344 2:15147972-15147994 GCACAGAGCAAGGCACCAGGAGG - Intergenic
927492481 2:23529747-23529769 CCCCAGAGCCAGCCCGCAGGTGG - Intronic
927863883 2:26576675-26576697 ACTCAGAGCATGCCCCCAGGGGG - Intronic
927886397 2:26721282-26721304 GCCCAGAGAAGGTTCCCAGAAGG + Intronic
931247499 2:60503656-60503678 GCCCTCAGCAAACACCCAGATGG + Intronic
932401932 2:71486630-71486652 GCCCAGAGACAGTTCCCAGATGG - Intronic
933826056 2:86161919-86161941 GCCCAAAGAAAGCCACCAGGAGG + Intronic
934167293 2:89305873-89305895 GCCCAGAGCCTGCCACCAGGAGG + Intergenic
934199982 2:89876571-89876593 GCCCAGAGCCTGCCACCAGGAGG - Intergenic
934561558 2:95316133-95316155 GGCCATGGCAGGCCCCCAGAGGG - Intronic
935552658 2:104474789-104474811 GCCCAAACCAAGCCTCCAAATGG + Intergenic
935720766 2:105976998-105977020 CCCCACAGCAGGCCCCCAGCAGG - Intergenic
940904500 2:159157072-159157094 TCCCAGAGCAAGGCCAGAGAGGG + Intronic
940966088 2:159838754-159838776 ACCCAGAGCAAGCCAGGAGATGG - Intronic
1175819924 20:61903705-61903727 GCCGAGAGGCAGCCCCCAGGGGG + Intronic
1175959608 20:62628839-62628861 GCCCAGACCCAGCCCCCTGCAGG + Intergenic
1176070704 20:63224800-63224822 GCCCAGAGCAGGCCCCACCACGG - Intergenic
1178538353 21:33428883-33428905 GCACTGAGTCAGCCCCCAGAGGG + Intronic
1180639777 22:17288963-17288985 TCCTGGAGCAAGGCCCCAGATGG + Intergenic
1180800467 22:18629519-18629541 GCCCAGACTCAGCCCCCAGTGGG - Intergenic
1180851703 22:19025076-19025098 GCCCAGACTCAGCCCCCAGTGGG - Intergenic
1180985903 22:19903780-19903802 CCACAGAGCAAGCCCCCGGCAGG - Intronic
1181221252 22:21365743-21365765 GCCCAGACTCAGCCCCCAGTGGG + Intergenic
1181636272 22:24176295-24176317 GCCCAGCACCAGCCCCCAGGAGG + Intronic
1182039626 22:27226589-27226611 TCCCCGGTCAAGCCCCCAGAAGG - Intergenic
1182435748 22:30328606-30328628 CCCCAAGGCAAGCCCCAAGAGGG + Intergenic
1183732424 22:39626111-39626133 GCACAGAGCAAACCTCCAGCTGG - Intronic
1183747744 22:39701467-39701489 GGCCAGAGCAAGCCCTCATCAGG + Intergenic
1183984185 22:41560580-41560602 GCCAAGAGGAGCCCCCCAGAGGG - Intergenic
1184350744 22:43942185-43942207 GCCCAGGGCACACACCCAGATGG - Intronic
1184484275 22:44766660-44766682 CCCCAGAGAGAGCCCCCGGAAGG - Intronic
1184514557 22:44954025-44954047 GCTCAGAGCAGACCCCCAGTGGG + Intronic
951218516 3:20045893-20045915 GCCCATGGCAAGCCCTCAGAAGG + Intronic
954462267 3:50634055-50634077 CCCCAGAGCCAGCAGCCAGAAGG - Intronic
961216151 3:125162263-125162285 GCCCACAGCAAGCCCCGTGCTGG + Intronic
961621309 3:128227033-128227055 GCCCCAAGCAAGCAACCAGAGGG - Intronic
962335613 3:134527603-134527625 GCCCATAGCAACTCCCCACATGG - Intronic
965845618 3:172958153-172958175 ACCCAGAGCCAGCCCTCAGATGG + Intronic
968397742 4:259408-259430 GCCCAGAAAAGGCCACCAGAGGG + Intergenic
968450916 4:675553-675575 CCCCAGAGCAAGCCAGGAGAGGG - Intronic
968740985 4:2331703-2331725 GCTCAGAGCAAGTCCCCACAGGG + Intronic
968784365 4:2608684-2608706 GCCCAGAGGTAGCCCACTGAAGG + Intronic
969188611 4:5499009-5499031 GCCCAAAGCAAGCTCCAGGACGG + Exonic
969536368 4:7758386-7758408 GCCTGGAGCAAGCTCCCTGAGGG + Intergenic
978105901 4:104901577-104901599 GCCTGGAGGAAGCCCCCAGGTGG - Intergenic
978618036 4:110615024-110615046 GCGGGGAGAAAGCCCCCAGACGG + Intergenic
984836525 4:184027464-184027486 GCACAAAGCCAGCACCCAGATGG - Intergenic
984937770 4:184904271-184904293 GCCCAGAGCAACTCCTCAGGGGG + Intergenic
985002764 4:185502328-185502350 GCCCGCACAAAGCCCCCAGAGGG - Exonic
985480779 5:108974-108996 GCCCAGAGCGAGCCTCCTGGGGG + Intergenic
986741604 5:10710202-10710224 GCCAAAAGCAGGCCCTCAGAAGG - Intronic
990283373 5:54275454-54275476 TTCCAGATCATGCCCCCAGAAGG + Intronic
995060549 5:107808140-107808162 GCCCAGTGCCTGACCCCAGAAGG + Intergenic
996134089 5:119817582-119817604 GTCCAGAGCAAGAGTCCAGAGGG - Intergenic
996824101 5:127661781-127661803 GACCAGAGCAAGATGCCAGATGG - Intergenic
997260255 5:132460217-132460239 GCCCAGAGCAATTTCCAAGATGG - Intronic
998139100 5:139689970-139689992 GCCCAGACCTGGCCCCCAGGAGG - Intergenic
999405914 5:151306517-151306539 ACCCAGAGCAAGCACACAAAAGG + Intergenic
1000322521 5:160146111-160146133 GCCCAGAGAGAGCCCCAAAAAGG - Intergenic
1001642547 5:173254883-173254905 CCCCACAGCAAGCCTCCAGAGGG - Intergenic
1001971373 5:175957464-175957486 GCCCAGAGCAGGCTCCTAGGAGG - Intronic
1002246069 5:177886313-177886335 GCCCAGAGCAGGCTCCTAGGAGG + Intergenic
1002272001 5:178078674-178078696 GCCGTGATCAAGCCCCCAGCGGG + Intergenic
1002316758 5:178348843-178348865 GCCCAGGCCAACCCCCCAGCAGG + Intronic
1002495187 5:179606956-179606978 GCCCTGAGAAAGCCCTCTGAGGG + Intronic
1002564058 5:180100151-180100173 GACCACAGCAAGGCCCCAGAAGG - Intergenic
1002777411 6:340974-340996 GCCAAGAGCCAGTGCCCAGATGG - Intronic
1003459997 6:6320489-6320511 GCCCAGAGCAAGCCGCTTGCTGG + Intronic
1004503585 6:16229785-16229807 TCCCAGACCAAGACCCCAGGGGG - Intergenic
1004578430 6:16922922-16922944 TCCCAGTGCAAGCACCCAGATGG - Intergenic
1005821567 6:29603607-29603629 CCCCTGGGCAGGCCCCCAGAGGG + Exonic
1006922337 6:37635045-37635067 GCACAGAGGAAGCACCCAGGTGG + Exonic
1009824064 6:68844090-68844112 GCCCAGACCAATGTCCCAGAGGG - Intronic
1013589443 6:111607963-111607985 GCCCAGACAGAGCCACCAGAAGG + Intergenic
1015663787 6:135604221-135604243 GCTCAGAGGAAACCCTCAGAGGG - Intergenic
1015997856 6:139013481-139013503 GCCCTGAGCAAGTCCACAGGTGG + Intergenic
1018641928 6:165911806-165911828 GCACAGAGCCAGCACCCAAAAGG + Intronic
1018738138 6:166705221-166705243 GCCAAGAGCAAGGCGCCAGCTGG + Intronic
1019475861 7:1243969-1243991 CCCCAGGGCACCCCCCCAGAGGG + Intergenic
1019577498 7:1744518-1744540 GCCAGGCGCCAGCCCCCAGAGGG - Exonic
1019624031 7:2006769-2006791 GCGCAGAGGAGGCTCCCAGATGG + Intronic
1023727231 7:43156286-43156308 GGACAGAGCAGGCCCCCAGTAGG + Intronic
1023826988 7:44016309-44016331 GCCCAGAGCAAGCCCCCAGAAGG + Intergenic
1027333274 7:77122035-77122057 GCCCAGCGCCAGCCCACAGTCGG + Intergenic
1029738140 7:102476056-102476078 GCCCAGAGCAAGCCCCCAGAAGG + Intronic
1029755273 7:102569710-102569732 GCCCAGAGCAAGCCCCCAGAAGG + Intronic
1029773221 7:102668790-102668812 GCCCAGAGCAAGCCCCCAGAAGG + Intronic
1029782516 7:102749267-102749289 GCCCAGCGCCAGCCCACAGTCGG - Exonic
1031974456 7:128085003-128085025 GGCCAGAGCAAGGCCCCAGATGG - Intronic
1032253496 7:130278213-130278235 GCCCTGAGCCAGCCACTAGAGGG + Intronic
1033599888 7:142881752-142881774 GCCCAGAGGCAGCCCTGAGAAGG - Intronic
1034533521 7:151712452-151712474 GGCCAGAGCAAGGCCCCTGCAGG - Intronic
1035045607 7:155963526-155963548 GCACAGAGCAAGACCACAGCTGG - Intronic
1035745040 8:1955804-1955826 CCCCTGGGCAAGCCCCCAGAAGG - Intronic
1036558670 8:9883498-9883520 GCTCAGAGGAAACCCCCACAAGG + Intergenic
1036969170 8:13334695-13334717 GCCAAGATCAAACACCCAGAAGG - Intronic
1037593084 8:20329714-20329736 GCCATGAGCAAGTCCCCAAAAGG + Intergenic
1038828338 8:31032339-31032361 GCAAAGAGCAAGGCTCCAGAAGG - Exonic
1038941931 8:32314744-32314766 ACCAAGAGGAAGCCCCCAGATGG + Intronic
1040530318 8:48261340-48261362 GCTCACAGCAAGCCAGCAGATGG + Intergenic
1048517077 8:135120865-135120887 GCACAGAGGAAGCCTCCATATGG - Intergenic
1049046876 8:140159354-140159376 GCACAGAGCAGGCCCTCAGGAGG + Intronic
1049094580 8:140540845-140540867 GCCCTCGGGAAGCCCCCAGATGG + Intronic
1049150165 8:141029908-141029930 GCTCAGATCAAGGCCGCAGATGG - Intergenic
1049220235 8:141425650-141425672 GCCCAGAGCCAGCCCCAGGGGGG + Intronic
1049381509 8:142318681-142318703 GCAGAGAGCAAGGGCCCAGAAGG + Intronic
1049546778 8:143235763-143235785 TCCCAGAGCAAGTGACCAGAGGG + Intergenic
1049826262 8:144670699-144670721 GCTCAGGGCAAGCCTCCAGGAGG - Intergenic
1051199222 9:14598114-14598136 GCCCAGAGCAAGCTGCCTGGAGG + Intergenic
1051457795 9:17280695-17280717 CCCTAGAGCAAGCCATCAGATGG + Intronic
1051749471 9:20326210-20326232 GCTCAGAGCATACCCACAGAAGG - Intergenic
1056688705 9:88787689-88787711 GTCCAGAGCTTGCCCTCAGAGGG + Intergenic
1056983632 9:91340993-91341015 TCCCAGAGAAAGCCCTGAGAAGG + Intronic
1057138029 9:92708318-92708340 GCCCAAAGCAAGCAGCAAGAAGG - Intergenic
1057554910 9:96080304-96080326 GCTCAGAGCAAGCCACCTTAAGG - Intergenic
1057694187 9:97311856-97311878 AGCCAGAGCAAGCTCCCTGAGGG + Intronic
1058748513 9:108015885-108015907 GAGCAGAGGAAGCCACCAGAAGG - Intergenic
1059514598 9:114881280-114881302 TCCCAGAGCAGGCATCCAGAGGG + Intergenic
1060899524 9:127245260-127245282 GCACAGCGCAAGCACCCCGAGGG + Intronic
1061989381 9:134150132-134150154 TCCCAGAGGAAGACCACAGAGGG + Intronic
1062002728 9:134224987-134225009 GCCCAGGGGAAGCCCCTGGATGG + Intergenic
1062312690 9:135947735-135947757 CCCCACAGCAATCCCCCACACGG + Intronic
1187195312 X:17077937-17077959 GCCCAGAGCAGCCCACCTGAAGG - Intronic
1190261701 X:48801791-48801813 GCCCAGATCCCGCCTCCAGAGGG - Intronic
1191671149 X:63750156-63750178 GCCCAGAGCAAGCACTCTGCAGG + Intronic
1192261281 X:69506983-69507005 GTCCAGAGCAACCCCGCCGAGGG - Intronic
1192826916 X:74706860-74706882 GCCCAGAGCAACCACTAAGAGGG - Intergenic
1194945415 X:100060808-100060830 TCACAGAGCAAGACCCCAAAAGG + Intergenic
1197406958 X:126065272-126065294 GCCCAGAGCAAGCACACACCTGG - Intergenic
1200054295 X:153450712-153450734 GCCCCCAGCAAGAGCCCAGAAGG + Intronic
1200690714 Y:6305061-6305083 GCCCAGTGCATGCGCCCTGAGGG - Intergenic
1200831122 Y:7689535-7689557 GCCCGGCGCATGCCCCCTGAGGG - Intergenic
1201044558 Y:9869655-9869677 GCCCAGTGCATGCGCCCTGAGGG + Intergenic
1201463872 Y:14258124-14258146 CCCCAAAGCAAGCCTTCAGAAGG + Intergenic