ID: 1029759257

View in Genome Browser
Species Human (GRCh38)
Location 7:102592233-102592255
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 4, 1: 0, 2: 0, 3: 9, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029759257_1029759271 18 Left 1029759257 7:102592233-102592255 CCCACTTGCCGGCCTCTCAGAGC 0: 4
1: 0
2: 0
3: 9
4: 122
Right 1029759271 7:102592274-102592296 TCCTTACCCACCTTGGAGCTGGG 0: 4
1: 0
2: 0
3: 9
4: 161
1029759257_1029759270 17 Left 1029759257 7:102592233-102592255 CCCACTTGCCGGCCTCTCAGAGC 0: 4
1: 0
2: 0
3: 9
4: 122
Right 1029759270 7:102592273-102592295 CTCCTTACCCACCTTGGAGCTGG 0: 4
1: 0
2: 1
3: 14
4: 160
1029759257_1029759266 11 Left 1029759257 7:102592233-102592255 CCCACTTGCCGGCCTCTCAGAGC 0: 4
1: 0
2: 0
3: 9
4: 122
Right 1029759266 7:102592267-102592289 GCCTCCCTCCTTACCCACCTTGG 0: 4
1: 0
2: 0
3: 47
4: 406

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029759257 Original CRISPR GCTCTGAGAGGCCGGCAAGT GGG (reversed) Intronic
901754894 1:11435474-11435496 GCTCTCAGAGGCAGGCAAAGAGG - Intergenic
903646164 1:24897575-24897597 GCTCCTAGGGGCCGGCAAGGCGG + Intergenic
911077920 1:93897016-93897038 GCTCTGTGTGGCAGACAAGTGGG + Intronic
912775818 1:112505914-112505936 GCTCTGAGAGGGAAGGAAGTGGG - Intronic
913113879 1:115679423-115679445 GCTCTGAGGGGCTGTCAGGTGGG + Intronic
914421208 1:147529880-147529902 GCTATGGGAGGCCTGCCAGTGGG + Intergenic
914753344 1:150549992-150550014 GCTCTGAGGGCCCGGGAATTCGG + Intronic
915269491 1:154743420-154743442 GCTCAGAGAGGCCCCCAGGTTGG - Intronic
916294033 1:163197166-163197188 TCTCTCAGAGGCCAGCAAGGAGG - Intronic
917205429 1:172566062-172566084 GCTCTGACAGGCAGACCAGTAGG - Intronic
918024987 1:180734516-180734538 GATCTGAGAGGCCTGATAGTTGG + Intronic
920494137 1:206442174-206442196 GCTCTGAAGGGCCAGCAAGGGGG - Intronic
922418367 1:225442472-225442494 GCAGTGAGAGGCCAGCAGGTAGG - Intergenic
1063458443 10:6201399-6201421 GCTCTGAGAGGGCGGCGCGGGGG + Intronic
1066489845 10:35883832-35883854 GCTCTCAGAGGCTGGGAGGTGGG - Intergenic
1071208112 10:83307261-83307283 CCTCTGAGGGCCCTGCAAGTTGG - Intergenic
1076526652 10:131116432-131116454 GGCCTGAGAGGCCGGCAGGTGGG - Intronic
1079408826 11:20167582-20167604 GCTCTGAGAGGCTGGCCTTTAGG + Intergenic
1084215771 11:67646113-67646135 GGCATGAGAGGCAGGCAAGTGGG - Intronic
1084265323 11:68002716-68002738 GCTCTGGGAGGCCTCCAAGGAGG + Intronic
1085789613 11:79485789-79485811 CCTCTGAGAGGCTGGCCAGCCGG + Intergenic
1089153306 11:116381602-116381624 GCTATGAGAAGCTGGCAACTAGG - Intergenic
1090402746 11:126459261-126459283 GGTCTGAGAGGCAGGGAGGTGGG + Intronic
1090914229 11:131148894-131148916 GCTCTGAGAGGCAGGCACCTGGG - Intergenic
1094139154 12:27162842-27162864 ACTTTGGGAGGCCGGGAAGTTGG - Intergenic
1094822021 12:34233412-34233434 CCTCTGTGAGGCAGGGAAGTAGG + Intergenic
1100405150 12:94266398-94266420 CATCTGAGAGGCCGGAGAGTGGG + Intronic
1100890694 12:99122679-99122701 ACTCTGAAAGCCAGGCAAGTTGG - Intronic
1101957255 12:109222603-109222625 GCCCTCAGAGCCCGGCAGGTAGG + Exonic
1101996018 12:109525266-109525288 GCTCTGAGAAGCCTGTAAGGAGG + Intronic
1103926242 12:124424902-124424924 GCTCTGGGAGGCAGGAGAGTGGG - Intronic
1106088518 13:26564403-26564425 GCTGTGAGAGGACAGCCAGTGGG - Intronic
1115307462 14:31947160-31947182 GCTCTGAGAGGCATGGAAGGAGG - Intronic
1121469326 14:94139675-94139697 GCTCTCAGAGGCAGGTATGTGGG - Intergenic
1122620872 14:103057193-103057215 GCGGTGAGAGGCCGGCGCGTCGG - Exonic
1124256489 15:28146872-28146894 GCACTGAGAGGCCGGGAAAGAGG + Intronic
1124567741 15:30832221-30832243 GCACTGAGAGGCCGGGAAAGAGG - Intergenic
1124783097 15:32654848-32654870 CCTCTGAGACACCAGCAAGTGGG + Intronic
1130377810 15:83345585-83345607 ACTTTGAGAGGCCGGCACTTTGG + Intergenic
1132657974 16:1049201-1049223 GCTCTGTGAGGCCGGCAGAGTGG - Intergenic
1132720334 16:1312526-1312548 GCTCTGAGAGGCCCGCACTCAGG - Intronic
1136140898 16:28287974-28287996 CCTCTGAGAAGCAGGCAAGGTGG + Intergenic
1141700502 16:85640002-85640024 GCTCTGGGAGGCCGGCGCTTTGG + Intronic
1142077557 16:88128835-88128857 GATCTGACAGGCAGGCAGGTGGG + Intergenic
1142323195 16:89398106-89398128 GCTCTGGGAGGCTGACAAGAGGG + Intronic
1146515442 17:33485667-33485689 CCTCTGAGAGGCAGGCAAGAAGG - Intronic
1147038542 17:37699697-37699719 GCTCTGGGAGGAAGGGAAGTGGG + Intronic
1150106187 17:62464352-62464374 GCTCTGGGAGGCCAGGAAGGTGG + Intronic
1155446940 18:25922482-25922504 CCTCTGGGAGGCCGGCACGGTGG + Intergenic
1157297884 18:46459156-46459178 GGCCTGAAAGGCTGGCAAGTGGG + Exonic
1160216049 18:76932625-76932647 GCTCAGTGAGGCCGGCCAGCAGG - Intronic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1162554546 19:11378617-11378639 GCTCAGAGAGGCCTGCAGTTTGG + Intronic
1165027388 19:32971783-32971805 GCTCTGTGGGGCCGGGAATTAGG - Intronic
1166591407 19:44002792-44002814 ACTCTGAGTCGCGGGCAAGTTGG + Intergenic
1166916587 19:46199539-46199561 GCTCTCAGAGGCTGGGAAGCGGG - Intergenic
926684567 2:15689187-15689209 GCTCTGAGAGGGCAGAAAGCTGG - Intergenic
926784677 2:16508131-16508153 GCTCCCAGAGCCCTGCAAGTCGG + Intergenic
927256036 2:21042013-21042035 GCTATGGGAGGCAGGCAACTCGG - Intronic
929146180 2:38708787-38708809 CCTCTGTGAGGCAGGGAAGTGGG + Intronic
931198345 2:60074021-60074043 GCACTCTGAGGACGGCAAGTTGG + Intergenic
931885054 2:66608119-66608141 GCTTTGAAAGGCCTACAAGTTGG + Intergenic
931996830 2:67846579-67846601 GTTCTCAGAGGCCGGCAGTTTGG - Intergenic
932029824 2:68172090-68172112 GACCTGAGAGGCTGGCATGTTGG + Intronic
946398557 2:219456095-219456117 GGTCTGTGAGGAGGGCAAGTTGG + Intronic
1169868471 20:10225981-10226003 GCTCTGAAAATCCTGCAAGTTGG + Intronic
1172152276 20:32798834-32798856 ACGCTGAGAAGCCGGCAAGGAGG - Intronic
1173125981 20:40336409-40336431 GCTCTGAGAGAGCAGAAAGTGGG + Intergenic
1176872525 21:14095258-14095280 CCTCTGTGAGGCAGGGAAGTGGG + Intergenic
1181267805 22:21641451-21641473 ACTCTGAGAAGGCGGCAAGAAGG + Intergenic
1183167150 22:36156526-36156548 GCTCTGGGAGGCAGGGAAGCAGG - Intronic
1185234546 22:49704510-49704532 GCTGTGAGGGTCCGGCATGTGGG + Intergenic
955161159 3:56467103-56467125 GCTGTGAGAGGCAGACAAGCGGG - Intronic
955660585 3:61294874-61294896 GCTCTGAGACACCAGCAAGCAGG - Intergenic
963965121 3:151359630-151359652 GCTCTGAGAGGCAGAAAGGTGGG - Intronic
967762479 3:193241280-193241302 GCTCTGAGACGCCCGCACGCCGG - Exonic
969130202 4:4985400-4985422 GCTCTGGGAGGTGGGCTAGTTGG + Intergenic
970425167 4:15939047-15939069 GCTCTGAGAGGCTGGTAAAGAGG + Intergenic
971097907 4:23428860-23428882 GATGTGAGAGGCCAGCATGTTGG - Intergenic
975802949 4:78081500-78081522 GCTCTGAGAGGCTGGATAGGGGG - Intronic
976534678 4:86197523-86197545 GTTCTGAGTGGCTGGCAAGATGG - Intronic
980791334 4:137623336-137623358 GCTCTGAGCGGCTGGCAGCTTGG + Intergenic
984573853 4:181424806-181424828 GCTCTGACAGGCCTGCATGCAGG - Intergenic
986663732 5:10082133-10082155 GCTCTGAGAGGTAGGAAAGAAGG + Intergenic
990309995 5:54528854-54528876 GTTCTGAGAGGCAGCCAAGACGG - Intronic
990667719 5:58092683-58092705 GCCCTGACTGGCCAGCAAGTAGG + Intergenic
991589294 5:68232458-68232480 GCTCTGAGGGGCCTGTGAGTAGG + Intronic
999293043 5:150440121-150440143 GCTCTGAGAGGGCAGGGAGTGGG + Intergenic
999782065 5:154857876-154857898 GCTCGGTGAGGCCGGGAGGTAGG + Intronic
1000110731 5:158105839-158105861 GCTATGTGATGCTGGCAAGTGGG + Intergenic
1001211655 5:169815477-169815499 GCTCTGAGAGGCAGTGAAGAAGG - Intronic
1002109715 5:176900320-176900342 GCTGTGAAAGGCAGGGAAGTGGG + Intergenic
1002416392 5:179122972-179122994 GCTCAGAGAGACAGGCATGTGGG - Intronic
1002460962 5:179373657-179373679 GCTCTGCCAGGCCGCCAAGATGG + Intergenic
1002777513 6:341613-341635 GCTCTGAGCGGCCGCCTTGTTGG + Intronic
1006520944 6:34570807-34570829 GTTCTGAGAGGCTGGCAGGCTGG + Intergenic
1013271609 6:108550684-108550706 ACTCTGAGAGACCACCAAGTAGG + Intergenic
1018706804 6:166469524-166469546 GCTCGGAGAGGCCGGGGAGTGGG + Intronic
1018978378 6:168582758-168582780 GCTCTGAGTTCCCGGCAGGTCGG - Intronic
1019436314 7:1024069-1024091 ACTTTGGGAGGCCGGCAAGGAGG - Intronic
1021946310 7:25731216-25731238 GCTTTGAGAGGCCTTCTAGTAGG - Intergenic
1023830933 7:44038755-44038777 GCTCTGAGAGGCCGGCAAGTGGG - Intergenic
1023854909 7:44176872-44176894 CCTCTCAGAGGTGGGCAAGTTGG - Intronic
1027159443 7:75791566-75791588 ACTTTGAGAGGCCGAGAAGTGGG - Intergenic
1028985675 7:97006573-97006595 GCTGGGAGAGGCCGGCAGGCAGG - Intronic
1029741267 7:102493064-102493086 GCTCTGAGAGGCCGGCAAGTGGG - Intronic
1029759257 7:102592233-102592255 GCTCTGAGAGGCCGGCAAGTGGG - Intronic
1029776626 7:102688143-102688165 GCTCTGAGAGGCCGGCAAGTGGG - Intergenic
1034309130 7:150071613-150071635 CCTCTGAGAGTCCGGCACGGTGG - Intergenic
1034797725 7:154029023-154029045 CCTCTGAGAGTCCGGCACGGTGG + Intronic
1035686059 8:1524217-1524239 CATCTGAGAGGCCGGCAGGGAGG + Intronic
1035870491 8:3132136-3132158 GCTCTGCGAGGCCACCCAGTGGG + Intronic
1039792353 8:40885963-40885985 GCTCTGAGAGGCTGGGAACTGGG + Intronic
1041954576 8:63543263-63543285 GCTCTGAGAGGTCCCCAAGTTGG - Intergenic
1045415930 8:101967634-101967656 GTTCTGAGACGCCTGCTAGTTGG - Intronic
1047055859 8:121164529-121164551 GCTGTGAGAGACCTGCAAGCAGG + Intergenic
1049230347 8:141478517-141478539 GCTCTGAGAGGCCGGTGGGGCGG + Intergenic
1050770766 9:9196857-9196879 GCTGTGAGAGCCAGGCCAGTTGG - Intronic
1053492666 9:38521774-38521796 GCTCTGGGAAGCAGGCAAGTGGG + Intergenic
1053537805 9:38943286-38943308 ACTCTGAAAGGGAGGCAAGTAGG - Intergenic
1054628329 9:67420639-67420661 ACTCTGAAAGGGAGGCAAGTAGG + Intergenic
1057672901 9:97110709-97110731 GCTCTGGGAAGCAGGCAAGCGGG + Intergenic
1061028940 9:128068195-128068217 GCTCGGAGACGCCGGCAAGCTGG - Exonic
1061485834 9:130920072-130920094 GCCCTGAAAGGCAGGCAAGAGGG + Intronic
1061930980 9:133833029-133833051 GCTCTGGGAGTCTGGCCAGTGGG + Intronic
1062149153 9:135008605-135008627 GCGCTGAGGGGCCGGGATGTAGG + Intergenic
1188230920 X:27661474-27661496 GCTCTGAGAGGTCTTCAAGGTGG - Intronic
1189383979 X:40521686-40521708 CCACTGAGAGGCCAGGAAGTTGG - Intergenic
1190951966 X:55154771-55154793 CCTCTGAGAGGCTGTCAAGTAGG + Intronic
1192577669 X:72255763-72255785 ACTCTGAGAGGCAGGGAAGGAGG + Intronic
1195701850 X:107711663-107711685 GATTTGAGAGGCCAGCAAGCAGG + Intergenic
1199474102 X:148227263-148227285 GGCCAGAGAGGCCTGCAAGTTGG - Intergenic
1200133037 X:153861922-153861944 GCTGGAAGAGGCCGGCCAGTGGG + Exonic
1201767792 Y:17588891-17588913 CCTCTGTGAGGCTGGGAAGTGGG + Intergenic
1201833761 Y:18317094-18317116 CCTCTGTGAGGCTGGGAAGTGGG - Intergenic