ID: 1029759265

View in Genome Browser
Species Human (GRCh38)
Location 7:102592264-102592286
Sequence AGGTGGGTAAGGAGGGAGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3071
Summary {0: 4, 1: 0, 2: 6, 3: 191, 4: 2870}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029759265_1029759280 22 Left 1029759265 7:102592264-102592286 CCGGCCTCCCTCCTTACCCACCT 0: 4
1: 0
2: 6
3: 191
4: 2870
Right 1029759280 7:102592309-102592331 GCTGAGGGCCTCGGTAGTGAGGG 0: 4
1: 0
2: 0
3: 7
4: 146
1029759265_1029759277 7 Left 1029759265 7:102592264-102592286 CCGGCCTCCCTCCTTACCCACCT 0: 4
1: 0
2: 6
3: 191
4: 2870
Right 1029759277 7:102592294-102592316 GGGCGTCTTCGCGAAGCTGAGGG 0: 4
1: 0
2: 0
3: 0
4: 36
1029759265_1029759278 13 Left 1029759265 7:102592264-102592286 CCGGCCTCCCTCCTTACCCACCT 0: 4
1: 0
2: 6
3: 191
4: 2870
Right 1029759278 7:102592300-102592322 CTTCGCGAAGCTGAGGGCCTCGG 0: 4
1: 0
2: 0
3: 5
4: 117
1029759265_1029759279 21 Left 1029759265 7:102592264-102592286 CCGGCCTCCCTCCTTACCCACCT 0: 4
1: 0
2: 6
3: 191
4: 2870
Right 1029759279 7:102592308-102592330 AGCTGAGGGCCTCGGTAGTGAGG 0: 4
1: 0
2: 0
3: 10
4: 119
1029759265_1029759276 6 Left 1029759265 7:102592264-102592286 CCGGCCTCCCTCCTTACCCACCT 0: 4
1: 0
2: 6
3: 191
4: 2870
Right 1029759276 7:102592293-102592315 TGGGCGTCTTCGCGAAGCTGAGG 0: 4
1: 0
2: 0
3: 5
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029759265 Original CRISPR AGGTGGGTAAGGAGGGAGGC CGG (reversed) Exonic
Too many off-targets to display for this crispr