ID: 1029761676

View in Genome Browser
Species Human (GRCh38)
Location 7:102604518-102604540
Sequence GCCCGGCCACGTGTGTGAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029761672_1029761676 -10 Left 1029761672 7:102604505-102604527 CCGAGGTCCCAGAGCCCGGCCAC 0: 2
1: 1
2: 4
3: 37
4: 273
Right 1029761676 7:102604518-102604540 GCCCGGCCACGTGTGTGAGCGGG No data
1029761668_1029761676 6 Left 1029761668 7:102604489-102604511 CCTGGGAGAAGTGGCCCCGAGGT 0: 2
1: 1
2: 1
3: 11
4: 97
Right 1029761676 7:102604518-102604540 GCCCGGCCACGTGTGTGAGCGGG No data
1029761670_1029761676 -8 Left 1029761670 7:102604503-102604525 CCCCGAGGTCCCAGAGCCCGGCC No data
Right 1029761676 7:102604518-102604540 GCCCGGCCACGTGTGTGAGCGGG No data
1029761671_1029761676 -9 Left 1029761671 7:102604504-102604526 CCCGAGGTCCCAGAGCCCGGCCA No data
Right 1029761676 7:102604518-102604540 GCCCGGCCACGTGTGTGAGCGGG No data
1029761663_1029761676 25 Left 1029761663 7:102604470-102604492 CCGTGGGTGACGATGGGTGCCTG 0: 3
1: 0
2: 2
3: 30
4: 853
Right 1029761676 7:102604518-102604540 GCCCGGCCACGTGTGTGAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029761676 Original CRISPR GCCCGGCCACGTGTGTGAGC GGG Intronic