ID: 1029766131

View in Genome Browser
Species Human (GRCh38)
Location 7:102627465-102627487
Sequence GTCCAGGAAGTGACCTCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 3, 1: 0, 2: 1, 3: 9, 4: 134}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029766131_1029766136 -5 Left 1029766131 7:102627465-102627487 CCCTGAGAGGTCACTTCCTGGAC 0: 3
1: 0
2: 1
3: 9
4: 134
Right 1029766136 7:102627483-102627505 TGGACAGCCCAGGCTGGAACCGG No data
1029766131_1029766144 17 Left 1029766131 7:102627465-102627487 CCCTGAGAGGTCACTTCCTGGAC 0: 3
1: 0
2: 1
3: 9
4: 134
Right 1029766144 7:102627505-102627527 GCCCACAGTGGGAAGAGAAGGGG No data
1029766131_1029766140 6 Left 1029766131 7:102627465-102627487 CCCTGAGAGGTCACTTCCTGGAC 0: 3
1: 0
2: 1
3: 9
4: 134
Right 1029766140 7:102627494-102627516 GGCTGGAACCGGCCCACAGTGGG No data
1029766131_1029766143 16 Left 1029766131 7:102627465-102627487 CCCTGAGAGGTCACTTCCTGGAC 0: 3
1: 0
2: 1
3: 9
4: 134
Right 1029766143 7:102627504-102627526 GGCCCACAGTGGGAAGAGAAGGG 0: 2
1: 1
2: 5
3: 45
4: 376
1029766131_1029766139 5 Left 1029766131 7:102627465-102627487 CCCTGAGAGGTCACTTCCTGGAC 0: 3
1: 0
2: 1
3: 9
4: 134
Right 1029766139 7:102627493-102627515 AGGCTGGAACCGGCCCACAGTGG 0: 2
1: 1
2: 0
3: 24
4: 173
1029766131_1029766147 28 Left 1029766131 7:102627465-102627487 CCCTGAGAGGTCACTTCCTGGAC 0: 3
1: 0
2: 1
3: 9
4: 134
Right 1029766147 7:102627516-102627538 GAAGAGAAGGGGTCTCCCACTGG No data
1029766131_1029766142 15 Left 1029766131 7:102627465-102627487 CCCTGAGAGGTCACTTCCTGGAC 0: 3
1: 0
2: 1
3: 9
4: 134
Right 1029766142 7:102627503-102627525 CGGCCCACAGTGGGAAGAGAAGG 0: 2
1: 1
2: 1
3: 21
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029766131 Original CRISPR GTCCAGGAAGTGACCTCTCA GGG (reversed) Intronic
900513650 1:3071422-3071444 GGCCTGGCAGTCACCTCTCATGG - Intronic
902636500 1:17738249-17738271 GTCCAAGAAGTCACCTCTGGTGG + Intergenic
904696467 1:32334526-32334548 GTCCAGGCAGTGACCTCACAAGG + Exonic
905871284 1:41405949-41405971 CTCCAAGAAGTCACCTCGCAAGG - Intergenic
909117454 1:71556088-71556110 GTCTAGTAAATGACATCTCATGG - Intronic
917334953 1:173916939-173916961 GTGCAGGAAGTCAGCACTCACGG - Intronic
919749253 1:201026314-201026336 GTCCAGTCAGAGAACTCTCAGGG - Intergenic
920263324 1:204704271-204704293 GTTCAGGAACTGAACTCTAAGGG - Intergenic
920691351 1:208148811-208148833 CTCCAGGAAGTACCCCCTCAGGG - Intronic
923689752 1:236180448-236180470 CACAGGGAAGTGACCTCTCAAGG - Intronic
1062813459 10:482346-482368 CTCCAGGAAGAGGCCTCCCATGG - Intronic
1066105721 10:32155069-32155091 GGTAAGGAAGTGACCTCCCATGG - Intergenic
1066327618 10:34379656-34379678 GTTCAGGCAATGACCTTTCAAGG + Intronic
1067685814 10:48465544-48465566 GTCCAGGAATTGACCCTGCAAGG - Intronic
1067827966 10:49593133-49593155 AACCAGGAAGTGACCACTCCTGG + Intergenic
1073327577 10:102651383-102651405 GCCCAGGGAGTGACCCCTCAGGG - Intronic
1073390974 10:103176127-103176149 GTCCAGGCAATGACCTCACAAGG - Intronic
1074695948 10:116050328-116050350 GTCCATGAAATGACCACTTAAGG + Intergenic
1075733602 10:124651037-124651059 GGGCAGGAAGTGGCCTCTGAAGG - Intronic
1076207616 10:128615719-128615741 GTCCAGCAACTAAACTCTCAAGG + Intergenic
1076370653 10:129950895-129950917 GTACAGGAAGTGAAAACTCAAGG - Intronic
1076463695 10:130664057-130664079 CTCCAGGAAGGGAGCTTTCATGG + Intergenic
1078412178 11:11133662-11133684 ATCCAGTCAGTGACCTTTCAAGG - Intergenic
1081236609 11:40654378-40654400 ATGCAAGAAGTGAGCTCTCATGG - Intronic
1082171101 11:49006884-49006906 GTCAAGGATGTGACTTCTGAAGG - Intergenic
1084424191 11:69075695-69075717 GCCCAGGCAGTGACCCCACACGG - Intronic
1084706582 11:70819457-70819479 GTCGAGGAAGAGACTTCCCAGGG - Intronic
1085482616 11:76835244-76835266 TTCCAGGCTGTGACCTCCCAAGG - Intergenic
1086289931 11:85296725-85296747 GTCCAGTAAGTGACAGCTGATGG + Intronic
1086694801 11:89830207-89830229 GTCAAGGATGTGACTTCTGAAGG + Intergenic
1086711347 11:90014290-90014312 GTCAAGGATGTGACTTCTGAAGG - Intergenic
1089179990 11:116576855-116576877 GTCCAGAGAGTGGCCTCTCCAGG - Intergenic
1102585814 12:113922195-113922217 GTCCAGGAAGTGGGCTCTACAGG - Intronic
1102653567 12:114461288-114461310 GTCCAGCAAGTGAGCTCTGTAGG - Intergenic
1104918767 12:132279736-132279758 ATCCAGGAAGTGACCGCACTGGG - Intronic
1105492144 13:20899164-20899186 TTCCTGGAACTAACCTCTCATGG + Intronic
1106552748 13:30786106-30786128 GTCCAGCAAGTGACCTTGTATGG - Intergenic
1107183347 13:37487665-37487687 GTCCAAGAAGTGACCACTTTGGG + Intergenic
1109211941 13:59545233-59545255 GTCCAGGAAGTGTTCTCTGCTGG - Intergenic
1109226264 13:59699690-59699712 GTCCATGCAGTGACCTCCTATGG + Intronic
1112651650 13:101405598-101405620 CTCCATGAGGTCACCTCTCACGG + Intronic
1113556673 13:111241264-111241286 GTCCAGGCTGTGAGGTCTCATGG + Intronic
1114200676 14:20517152-20517174 CTCCTGGAAGTGACGTCTCTGGG - Intergenic
1115645350 14:35365489-35365511 GTCCAGGCAGGGGCCCCTCAGGG - Intergenic
1119739326 14:77004027-77004049 GTCCAGAAAGTGACACGTCAAGG + Intergenic
1132468848 16:90490-90512 GGCCAGGACGTGCCTTCTCACGG - Intronic
1136406970 16:30053648-30053670 GTCCAGGAATGGACTTCCCACGG + Intronic
1138086361 16:54137266-54137288 GTATGGGAAGTGACCTCTAATGG - Intergenic
1138219494 16:55238826-55238848 ATCCAGGAATGGACTTCTCAAGG - Intergenic
1141177595 16:81730867-81730889 GTCCAGGGACTGCCCTCTCAGGG + Intergenic
1141184251 16:81775818-81775840 GGTCAGGAAGTGACCTCAAAGGG - Intronic
1141940512 16:87273095-87273117 GGCCAGGAAGTGGCTGCTCAGGG - Intronic
1145728332 17:27154080-27154102 GACTAGGAACTGGCCTCTCATGG + Intergenic
1145984186 17:29033438-29033460 GTGCAGGCTGTGACCTCCCAAGG - Intronic
1147255123 17:39176765-39176787 GTCCAGGAAAGGACCTCCCATGG - Intronic
1147362954 17:39943067-39943089 GTCCAGGATCTGCCCTCTCTTGG + Intronic
1147992997 17:44346301-44346323 GTCCAGGAGGTGGCCTCTTGGGG + Intronic
1150468615 17:65416728-65416750 GTCAAGCAAGTGACCACTAACGG + Intergenic
1151897786 17:76991913-76991935 GGCCAGGAAGGGACCCATCATGG + Intergenic
1152258772 17:79255399-79255421 TTCAAAGAAGTGACCTCACAGGG + Intronic
1153129685 18:1840839-1840861 GGCCAAGAAGTCACCTCACAAGG - Intergenic
1154354560 18:13615115-13615137 GGGTAGGAAGTGACCTCGCAGGG + Intronic
1155600763 18:27544131-27544153 GTCCAGTAAGTGACCTATTGTGG - Intergenic
1155879710 18:31129908-31129930 GTCCAGGGACTGAGCTCTGAAGG + Exonic
1156310282 18:35915962-35915984 GTCTAGGAAGTGACCTGTACAGG - Intergenic
1160471941 18:79144217-79144239 GTCCTGGAACTACCCTCTCATGG - Intronic
1160895114 19:1398865-1398887 CTCCAGGAAGTGACCTTGGATGG - Exonic
1161073774 19:2275289-2275311 GTCCCGGCATTGGCCTCTCATGG + Exonic
1166874194 19:45887126-45887148 TTCCAGGTAGTGAGCGCTCAAGG - Intergenic
1168411541 19:56143264-56143286 GTCCAGAAAGTGAGCTCTCTGGG - Intronic
925752859 2:7105335-7105357 GGCCAGGAAGGGACATCTCCAGG + Intergenic
925898124 2:8488703-8488725 GTGCAGGGAGGGACCCCTCAGGG + Intergenic
933797892 2:85935966-85935988 TCCCAGGAAGTTACCTCTCTTGG - Intergenic
934658682 2:96131760-96131782 GTCCAGCACGAGACCTTTCAGGG - Intronic
937568899 2:123333234-123333256 GTCCTGGAAGCTTCCTCTCAGGG - Intergenic
938791073 2:134676650-134676672 TCCTTGGAAGTGACCTCTCACGG + Intronic
942964462 2:181874578-181874600 TTACACGAAGTGACTTCTCATGG - Intergenic
1169061081 20:2660777-2660799 ACCCAGGAAGTGACTTCACATGG + Exonic
1169193472 20:3671663-3671685 GGCCAGGAAGTGACTTGTCGGGG - Exonic
1170812140 20:19682375-19682397 GGGCAGGGAGTGCCCTCTCAAGG - Intronic
1172198873 20:33111538-33111560 GGCCAGGGAGGGACCTGTCATGG - Exonic
1172512830 20:35512502-35512524 GCCCAGGAAGCGACATCTCAAGG - Exonic
1173415031 20:42847523-42847545 GCCCAGGAAGTAAGCACTCAAGG + Intronic
1179159070 21:38876886-38876908 GCCCAGGAAGTGCCCTCCAAAGG - Intergenic
1179610257 21:42545656-42545678 GTCCAGGAAGAGCCATATCAGGG + Intronic
1180224066 21:46379140-46379162 ATCCAGGAAATGATCTCTCAAGG - Intronic
1180788783 22:18562391-18562413 GTCCAGGCAGCAACCTCTCCTGG + Intergenic
1181232954 22:21432930-21432952 GTCCAGGCAGCAACCTCTCCTGG - Intronic
1181245697 22:21501929-21501951 GTCCAGGCAGCAACCTCTCCTGG + Intergenic
1182821898 22:33223670-33223692 ATCCAGTAGGTGACCTCTGAGGG - Intronic
1183579841 22:38717442-38717464 CTCCAGGAGGCCACCTCTCAGGG - Intronic
1183666037 22:39246215-39246237 GTCCAGCAAGTGGCCACTCCAGG - Intergenic
1184976505 22:48066127-48066149 GTCCAGGAAGCATCTTCTCATGG - Intergenic
949203098 3:1404475-1404497 CAGCAGGAACTGACCTCTCAAGG - Intergenic
950496656 3:13337971-13337993 TTTCAGGAAGGGACCCCTCAAGG + Intronic
960045642 3:113194915-113194937 GTCCAGGAAGGGAGCCCTCCAGG + Intergenic
961041845 3:123683350-123683372 GGGGAGGAAGTGCCCTCTCATGG + Intronic
961403972 3:126666138-126666160 TTTCTGGAAGGGACCTCTCAAGG - Intergenic
961651752 3:128420439-128420461 GTCCAGGCTGTGCCCTCTCCTGG - Intergenic
963743674 3:149104586-149104608 GACCAGGAAATGAGTTCTCAAGG + Intergenic
969295201 4:6265953-6265975 CTCCAGGAAGTGATCTCTTTGGG + Intergenic
971355525 4:25891378-25891400 CTGGAGGAAGTGACCTCTCTGGG - Intronic
974173867 4:58300513-58300535 GTTCAGGAGGTGGTCTCTCATGG - Intergenic
974679802 4:65146603-65146625 ATGCAGGAAGTGAGCTCTCATGG + Intergenic
976928156 4:90528127-90528149 GTCCAAGGAGTGACCTTTAAAGG + Intronic
976952530 4:90850488-90850510 GTGCAGGAAGTGGGCTCCCATGG - Intronic
979393911 4:120162718-120162740 GGACAGGAAGTGTCCTCCCATGG - Intergenic
981789052 4:148515396-148515418 GTACAAGAAGTGACCTCAGATGG + Intergenic
986518670 5:8590840-8590862 CTGCATGAAGAGACCTCTCAGGG - Intergenic
991673980 5:69074676-69074698 GTCCAGGATCTGCCCTCTCTTGG + Intergenic
991974434 5:72172211-72172233 GGCCAGGAAGGGACTTCTTAAGG - Intronic
1000045637 5:157519838-157519860 GACCAAGAAGCGACCTCGCAGGG - Exonic
1001936617 5:175710036-175710058 CTCAAGGAAGTGACATTTCAGGG - Intergenic
1002999626 6:2318987-2319009 GTCCAGGATGTCATCTTTCAAGG + Intergenic
1007297867 6:40841220-40841242 GCCCAGGATGTGGCCTCTCTTGG + Intergenic
1007771130 6:44193127-44193149 GTCAAGGAAGAGAACACTCAGGG + Intergenic
1008520878 6:52361865-52361887 TTCCAAGAATTCACCTCTCAGGG - Intronic
1009370959 6:62902864-62902886 CTCCAGAAAGTGACTTCTAAAGG + Intergenic
1010662176 6:78583889-78583911 CTCTAGGAGGTGACCTCACATGG + Intergenic
1013294970 6:108750961-108750983 GTCCAGGCAATGACTGCTCAAGG - Intergenic
1016166929 6:140957579-140957601 GTGAAGGAAGTGACATCACATGG - Intergenic
1017709596 6:157155412-157155434 GTCCACGAAGGGCTCTCTCAGGG - Intronic
1017802147 6:157906915-157906937 GTCCAGGATGAGAACACTCAAGG - Intronic
1018861157 6:167711796-167711818 GTTCAGTAAGTGAATTCTCATGG - Intergenic
1023819909 7:43974925-43974947 GTCCAGGAAGTGACCTCTCAGGG - Intergenic
1024092618 7:45957725-45957747 GCCCAGGAAGTGGTCTCTCTTGG + Intergenic
1024700789 7:51902023-51902045 GTCCAGAATGCGGCCTCTCACGG - Intergenic
1029748184 7:102528378-102528400 GTCCAGGAAGTGACCTCTCAGGG - Intergenic
1029766131 7:102627465-102627487 GTCCAGGAAGTGACCTCTCAGGG - Intronic
1035655387 8:1301307-1301329 GCCCAGGCAGAGGCCTCTCATGG - Intergenic
1036486202 8:9181488-9181510 GTCCGGGAACTGGCCTCACAGGG + Intergenic
1037324213 8:17672559-17672581 GTCCAGGAAGAACACTCTCAAGG - Intronic
1038020549 8:23548967-23548989 GTCCTGGCAGTGACCACTGAAGG - Intronic
1039856286 8:41417140-41417162 GTCAAGGAAGTACCCTGTCATGG + Intergenic
1044757564 8:95480913-95480935 GTCCAGGAAATGGCACCTCAGGG + Intergenic
1045306805 8:100964715-100964737 TTCCAGGAAGTGTCCTCAGAGGG + Intergenic
1047947558 8:129897131-129897153 GACCAGGAAGGGACCATTCACGG + Intronic
1049724603 8:144139840-144139862 GCCCAGGAAGAGTCTTCTCATGG - Exonic
1051327408 9:15988313-15988335 GACCAGGAAGTGAGTCCTCAAGG + Intronic
1056910671 9:90697350-90697372 GTCCAGGCTGTGACCTCTCCAGG + Intergenic
1060820767 9:126660407-126660429 GCCCAAGAAGTGACTTCTAAGGG + Intronic
1061028171 9:128063924-128063946 TTCCAGAAAGTGACCTCCCTTGG - Intronic
1061456360 9:130700873-130700895 GTCCAGGCAGTGTTCTCTGACGG + Exonic
1186481998 X:9903089-9903111 GTACACCAAGTCACCTCTCAGGG - Intronic
1189633853 X:42983930-42983952 GTTCAGAGAGTGACCTCTCTAGG - Intergenic
1190338960 X:49281345-49281367 GTGGCAGAAGTGACCTCTCAGGG + Intronic
1198925734 X:141792485-141792507 TTCCTGGAAGTGAAATCTCAGGG + Intergenic