ID: 1029771059

View in Genome Browser
Species Human (GRCh38)
Location 7:102654521-102654543
Sequence TTGTGCTTCTAGAAGAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85959
Summary {0: 8, 1: 0, 2: 152, 3: 5593, 4: 80206}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029771059_1029771065 1 Left 1029771059 7:102654521-102654543 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1029771065 7:102654545-102654567 AATGAGCTGGGCGTTCTGGTGGG No data
1029771059_1029771067 25 Left 1029771059 7:102654521-102654543 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1029771067 7:102654569-102654591 ACCTGTAATCCCAGCTACTTGGG 0: 15366
1: 98640
2: 233329
3: 337639
4: 469862
1029771059_1029771064 0 Left 1029771059 7:102654521-102654543 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1029771064 7:102654544-102654566 AAATGAGCTGGGCGTTCTGGTGG No data
1029771059_1029771069 28 Left 1029771059 7:102654521-102654543 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1029771069 7:102654572-102654594 TGTAATCCCAGCTACTTGGGAGG 0: 48952
1: 142577
2: 242332
3: 522592
4: 386712
1029771059_1029771063 -3 Left 1029771059 7:102654521-102654543 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1029771063 7:102654541-102654563 CAAAAATGAGCTGGGCGTTCTGG 0: 7
1: 9
2: 712
3: 22770
4: 95694
1029771059_1029771066 24 Left 1029771059 7:102654521-102654543 CCCTGTCTCTTCTAGAAGCACAA 0: 8
1: 0
2: 152
3: 5593
4: 80206
Right 1029771066 7:102654568-102654590 CACCTGTAATCCCAGCTACTTGG 0: 27298
1: 77225
2: 165100
3: 221696
4: 302720

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029771059 Original CRISPR TTGTGCTTCTAGAAGAGACA GGG (reversed) Intronic
Too many off-targets to display for this crispr