ID: 1029776626

View in Genome Browser
Species Human (GRCh38)
Location 7:102688143-102688165
Sequence GCTCTGAGAGGCCGGCAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029776626_1029776640 18 Left 1029776626 7:102688143-102688165 CCCACTTGCCGGCCTCTCAGAGC No data
Right 1029776640 7:102688184-102688206 TCCTTACCCACCTTGGAGCTGGG No data
1029776626_1029776635 11 Left 1029776626 7:102688143-102688165 CCCACTTGCCGGCCTCTCAGAGC No data
Right 1029776635 7:102688177-102688199 GCCTCCCTCCTTACCCACCTTGG No data
1029776626_1029776639 17 Left 1029776626 7:102688143-102688165 CCCACTTGCCGGCCTCTCAGAGC No data
Right 1029776639 7:102688183-102688205 CTCCTTACCCACCTTGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029776626 Original CRISPR GCTCTGAGAGGCCGGCAAGT GGG (reversed) Intergenic
No off target data available for this crispr