ID: 1029776634

View in Genome Browser
Species Human (GRCh38)
Location 7:102688174-102688196
Sequence AGGTGGGTAAGGAGGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029776634_1029776645 6 Left 1029776634 7:102688174-102688196 CCGGCCTCCCTCCTTACCCACCT No data
Right 1029776645 7:102688203-102688225 TGGGCGTCTTCGCGAAGCTGAGG No data
1029776634_1029776646 7 Left 1029776634 7:102688174-102688196 CCGGCCTCCCTCCTTACCCACCT No data
Right 1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG No data
1029776634_1029776648 21 Left 1029776634 7:102688174-102688196 CCGGCCTCCCTCCTTACCCACCT No data
Right 1029776648 7:102688218-102688240 AGCTGAGGGCCTCGGTAGTGAGG No data
1029776634_1029776647 13 Left 1029776634 7:102688174-102688196 CCGGCCTCCCTCCTTACCCACCT No data
Right 1029776647 7:102688210-102688232 CTTCGCGAAGCTGAGGGCCTCGG No data
1029776634_1029776649 22 Left 1029776634 7:102688174-102688196 CCGGCCTCCCTCCTTACCCACCT No data
Right 1029776649 7:102688219-102688241 GCTGAGGGCCTCGGTAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029776634 Original CRISPR AGGTGGGTAAGGAGGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr