ID: 1029776646

View in Genome Browser
Species Human (GRCh38)
Location 7:102688204-102688226
Sequence GGGCGTCTTCGCGAAGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029776632_1029776646 15 Left 1029776632 7:102688166-102688188 CCCACTTGCCGGCCTCCCTCCTT No data
Right 1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG No data
1029776628_1029776646 30 Left 1029776628 7:102688151-102688173 CCGGCCTCTCAGAGCCCCACTTG No data
Right 1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG No data
1029776633_1029776646 14 Left 1029776633 7:102688167-102688189 CCACTTGCCGGCCTCCCTCCTTA No data
Right 1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG No data
1029776637_1029776646 0 Left 1029776637 7:102688181-102688203 CCCTCCTTACCCACCTTGGAGCT No data
Right 1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG No data
1029776634_1029776646 7 Left 1029776634 7:102688174-102688196 CCGGCCTCCCTCCTTACCCACCT No data
Right 1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG No data
1029776642_1029776646 -9 Left 1029776642 7:102688190-102688212 CCCACCTTGGAGCTGGGCGTCTT No data
Right 1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG No data
1029776631_1029776646 16 Left 1029776631 7:102688165-102688187 CCCCACTTGCCGGCCTCCCTCCT No data
Right 1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG No data
1029776641_1029776646 -4 Left 1029776641 7:102688185-102688207 CCTTACCCACCTTGGAGCTGGGC No data
Right 1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG No data
1029776638_1029776646 -1 Left 1029776638 7:102688182-102688204 CCTCCTTACCCACCTTGGAGCTG No data
Right 1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG No data
1029776636_1029776646 3 Left 1029776636 7:102688178-102688200 CCTCCCTCCTTACCCACCTTGGA No data
Right 1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG No data
1029776643_1029776646 -10 Left 1029776643 7:102688191-102688213 CCACCTTGGAGCTGGGCGTCTTC No data
Right 1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG No data
1029776629_1029776646 26 Left 1029776629 7:102688155-102688177 CCTCTCAGAGCCCCACTTGCCGG No data
Right 1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029776646 Original CRISPR GGGCGTCTTCGCGAAGCTGA GGG Intergenic
No off target data available for this crispr