ID: 1029776984

View in Genome Browser
Species Human (GRCh38)
Location 7:102689652-102689674
Sequence CGTCCGCGTGGCGCTCCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029776979_1029776984 7 Left 1029776979 7:102689622-102689644 CCAACAGGAGCAGGGTGCGGCTG No data
Right 1029776984 7:102689652-102689674 CGTCCGCGTGGCGCTCCCGCAGG No data
1029776974_1029776984 18 Left 1029776974 7:102689611-102689633 CCGCACCTTAGCCAACAGGAGCA No data
Right 1029776984 7:102689652-102689674 CGTCCGCGTGGCGCTCCCGCAGG No data
1029776977_1029776984 13 Left 1029776977 7:102689616-102689638 CCTTAGCCAACAGGAGCAGGGTG No data
Right 1029776984 7:102689652-102689674 CGTCCGCGTGGCGCTCCCGCAGG No data
1029776973_1029776984 19 Left 1029776973 7:102689610-102689632 CCCGCACCTTAGCCAACAGGAGC No data
Right 1029776984 7:102689652-102689674 CGTCCGCGTGGCGCTCCCGCAGG No data
1029776971_1029776984 27 Left 1029776971 7:102689602-102689624 CCGCAAGGCCCGCACCTTAGCCA No data
Right 1029776984 7:102689652-102689674 CGTCCGCGTGGCGCTCCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029776984 Original CRISPR CGTCCGCGTGGCGCTCCCGC AGG Intergenic
No off target data available for this crispr