ID: 1029781173

View in Genome Browser
Species Human (GRCh38)
Location 7:102735355-102735377
Sequence ATTTGTTAAGGGCTGTTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029781170_1029781173 23 Left 1029781170 7:102735309-102735331 CCTTTGTAGACAGAGAGCAGACA No data
Right 1029781173 7:102735355-102735377 ATTTGTTAAGGGCTGTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029781173 Original CRISPR ATTTGTTAAGGGCTGTTTTA TGG Intergenic
No off target data available for this crispr