ID: 1029786081

View in Genome Browser
Species Human (GRCh38)
Location 7:102792800-102792822
Sequence TAGCTTGTCTAAAGGACAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029786078_1029786081 -3 Left 1029786078 7:102792780-102792802 CCAAGTCAGAAAAGAGTTCTTAG 0: 2
1: 0
2: 1
3: 16
4: 222
Right 1029786081 7:102792800-102792822 TAGCTTGTCTAAAGGACAGAGGG No data
1029786077_1029786081 0 Left 1029786077 7:102792777-102792799 CCACCAAGTCAGAAAAGAGTTCT 0: 2
1: 0
2: 0
3: 22
4: 166
Right 1029786081 7:102792800-102792822 TAGCTTGTCTAAAGGACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029786081 Original CRISPR TAGCTTGTCTAAAGGACAGA GGG Intronic
No off target data available for this crispr