ID: 1029788386

View in Genome Browser
Species Human (GRCh38)
Location 7:102816584-102816606
Sequence GTGCAAACACACAGCTACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029788386_1029788390 25 Left 1029788386 7:102816584-102816606 CCTATGTAGCTGTGTGTTTGCAC 0: 1
1: 0
2: 2
3: 13
4: 181
Right 1029788390 7:102816632-102816654 GATTCAGGGTGTACACGTGCAGG 0: 3
1: 44
2: 344
3: 1098
4: 1679
1029788386_1029788388 10 Left 1029788386 7:102816584-102816606 CCTATGTAGCTGTGTGTTTGCAC 0: 1
1: 0
2: 2
3: 13
4: 181
Right 1029788388 7:102816617-102816639 TTAAAAAAAAATTTAGATTCAGG No data
1029788386_1029788389 11 Left 1029788386 7:102816584-102816606 CCTATGTAGCTGTGTGTTTGCAC 0: 1
1: 0
2: 2
3: 13
4: 181
Right 1029788389 7:102816618-102816640 TAAAAAAAAATTTAGATTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029788386 Original CRISPR GTGCAAACACACAGCTACAT AGG (reversed) Intronic
906887819 1:49671124-49671146 GTACAAAAACACAGACACATAGG + Intronic
909024622 1:70468165-70468187 GTGCATGCACACAGGTGCATTGG - Intergenic
909611545 1:77556351-77556373 GTTCAAAAACAAAGCTATATTGG - Intronic
912205866 1:107508947-107508969 GTACAAACATACAGTTAGATAGG + Intergenic
915519597 1:156434131-156434153 GTGCACACACAGAGTTCCATAGG - Intergenic
920395733 1:205644596-205644618 GTGTAAACACAGAGCTAGAGTGG + Intergenic
921426101 1:215002735-215002757 GTGAAAACATGCAGCCACATTGG - Intergenic
923332761 1:232940716-232940738 GTGCATCCCCACAGCAACATTGG - Intergenic
1062794940 10:337778-337800 GTGCACACACACAGCTGCCTAGG - Intronic
1065986330 10:30956513-30956535 GTGCAAACCTACAGTCACATAGG - Intronic
1066445997 10:35484114-35484136 TGGCAAACACACATCTTCATTGG + Intronic
1067574552 10:47401078-47401100 TTGCAATCCCACAGCTCCATCGG - Intergenic
1069787725 10:70999621-70999643 GTGCACACACACAGAGACATAGG - Intergenic
1069787727 10:70999660-70999682 GTGCACACACACAGAGACAGAGG - Intergenic
1071097408 10:81993853-81993875 GTACAAAAACCCAGCTTCATGGG - Intronic
1073813499 10:107178243-107178265 GTACAAATATACAGCTACACAGG - Intergenic
1077165725 11:1136983-1137005 GTGAAAACACACCACAACATGGG + Intergenic
1077548810 11:3190181-3190203 GTGCAAAGACACAAATAAATAGG + Intergenic
1078263136 11:9730472-9730494 GTGCATACACACATATACCTTGG - Intronic
1079096970 11:17517309-17517331 GTGCAGACACCCAGCTTCAGGGG - Intronic
1079202896 11:18390603-18390625 GTGCAAAAATACAGTTAGATAGG - Intergenic
1080043923 11:27788643-27788665 GTGCATACACATACCTACAAGGG + Intergenic
1082741651 11:56917716-56917738 ATGCAAACACACATCTACTTAGG - Intergenic
1082910468 11:58367983-58368005 AAGCAAAAAAACAGCTACATGGG - Intergenic
1083046884 11:59744676-59744698 GTGCAAAAATACAGTTAGATAGG + Intronic
1087113800 11:94501273-94501295 GTGCCAACACATAGAAACATGGG + Intergenic
1088792535 11:113238674-113238696 GTGCAAGCACACAGCTAAACTGG - Intronic
1091290880 11:134439167-134439189 GTGAACAGACCCAGCTACATGGG - Intergenic
1092666978 12:10812377-10812399 GAGCAAACACAAACCTACTTAGG + Intergenic
1095281532 12:40357029-40357051 GTACAAACATACAGTTAGATAGG - Intronic
1095824767 12:46519600-46519622 GTGTAAACTTACAGCTACCTGGG - Intergenic
1098391650 12:69975961-69975983 GTGCAAACACACACACATATTGG + Intergenic
1099007693 12:77253875-77253897 GTGCAAAATTACAGCTAGATAGG + Intergenic
1100711152 12:97258292-97258314 TTGCACACACACAAGTACATTGG + Intergenic
1102017670 12:109658446-109658468 GTGCACACACACACATACGTCGG + Intergenic
1102089766 12:110176096-110176118 GAGGAAACACACAGAGACATAGG - Intronic
1102733283 12:115133936-115133958 GTACAAAATCACAGCTAGATAGG + Intergenic
1104119257 12:125783345-125783367 GTGCACACACACATGTACAAGGG + Intergenic
1104194372 12:126518819-126518841 GTGCACACAAACACATACATAGG - Intergenic
1104820844 12:131676599-131676621 GTGCGTACACACAGGTATATGGG + Intergenic
1104935375 12:132361475-132361497 TTGCAAGCCCACAGCTACAGAGG + Intergenic
1106866068 13:33965462-33965484 GTACTTACACAAAGCTACATAGG - Intronic
1109254893 13:60067900-60067922 GTGCATGCACACACCTATATAGG - Intronic
1109788614 13:67217038-67217060 TTTCAAATACACAGCTACATAGG - Intronic
1115695221 14:35890578-35890600 GTATAAACACACAGTTAGATAGG - Intronic
1116749742 14:48868410-48868432 TTGCAAACCCACTGCTGCATCGG - Intergenic
1117057209 14:51925003-51925025 ATTCAAAATCACAGCTACATAGG + Intronic
1117864112 14:60127476-60127498 GTGAATGCACACAGCTACCTTGG - Intronic
1122039724 14:98976829-98976851 GTGTAAACCCACAGATACACAGG + Intergenic
1122687356 14:103515823-103515845 CTGCAGTCACACAGCTACTTGGG + Intergenic
1122923128 14:104888137-104888159 GTGCACACACACACGTGCATGGG + Intronic
1122955085 14:105066762-105066784 GTGCAAACACACGCCTCCACAGG + Intergenic
1126980422 15:54236623-54236645 GTGCAAACACAGACCAAAATAGG + Intronic
1129871974 15:78946256-78946278 GTGGAGACACACAGGGACATGGG - Intronic
1132244411 15:100283299-100283321 GTGCAAAGGCACAGCCACCTAGG - Intronic
1132883988 16:2174421-2174443 GGGCACACACATAGCTACACAGG - Intronic
1133472705 16:6091156-6091178 GTGCAAACCTACAGTTAGATAGG - Intronic
1133655989 16:7864547-7864569 GTGAGAACACACAGCTACATAGG + Intergenic
1133828519 16:9300681-9300703 TTTCAAGCACACAGCTATATAGG - Intergenic
1134029416 16:10979760-10979782 GTGCATACACACAGCAACCTTGG + Intronic
1134236588 16:12471035-12471057 GTGAAGGCGCACAGCTACATAGG - Intronic
1134862086 16:17569081-17569103 GTGCAGACACATAGGTCCATAGG - Intergenic
1134871982 16:17660337-17660359 GTGCACACACACACATACAGAGG + Intergenic
1135810402 16:25581561-25581583 GGGCTAATACACAGCTACTTTGG + Intergenic
1136252174 16:29012509-29012531 GGGAACACACACAGTTACATGGG - Intergenic
1141035205 16:80620290-80620312 CTGCAAACACACAGCTGCCCAGG + Intronic
1144655522 17:17032904-17032926 GTGCATACACACAGGGACACAGG - Intergenic
1145282271 17:21476828-21476850 GTGCTCACACCCAGCTACCTGGG + Intergenic
1146583155 17:34057983-34058005 GTGCACGCACACAAGTACATGGG - Intronic
1147800381 17:43081624-43081646 GGGCAAACAAACAGACACATAGG - Intronic
1149109893 17:53015996-53016018 ATGCACACACACATATACATAGG - Intergenic
1149200496 17:54180567-54180589 GTGCACACACACATCCACACAGG + Intergenic
1152890546 17:82879260-82879282 GGGCACACACTCAGCTACAGAGG - Intronic
1152906592 17:82973930-82973952 GTGGGAACACACAGGTACACGGG - Intronic
1153473769 18:5474444-5474466 GTGCACACACAAGGCTACAGTGG - Intronic
1156657015 18:39300407-39300429 GTGCACACACAAACATACATGGG - Intergenic
1158775665 18:60575527-60575549 GTTCAAACACACAATTACAGTGG + Intergenic
1164900007 19:31910325-31910347 GTGTAAACACAGAGCTTCAGTGG - Intergenic
1167975182 19:53220815-53220837 GTACTTACACAAAGCTACATGGG - Intergenic
925298914 2:2796178-2796200 CTCCAGACACACAGCTGCATGGG - Intergenic
925311116 2:2882496-2882518 ATGCAAAGACACAGTGACATAGG - Intergenic
925415616 2:3668243-3668265 GAGCAAACACACAGCTGTGTGGG + Intronic
925554289 2:5112792-5112814 TTGTATAAACACAGCTACATTGG + Intergenic
926594171 2:14772020-14772042 GTGCAAACATACTTCTATATGGG - Intergenic
927407846 2:22792261-22792283 GTCTAAACAGACAGCTTCATTGG - Intergenic
927734435 2:25506180-25506202 GTACAAACACAGAGTTAGATGGG + Intronic
927923251 2:26990257-26990279 GTGGAAATACACAGCTTCCTTGG - Intronic
930246319 2:48986721-48986743 TTGCAAACCCAAAGCTACAAGGG - Intronic
931684697 2:64783603-64783625 GTGACAAAACACAACTACATGGG + Intergenic
931941401 2:67255474-67255496 CTGCAACCACACAGCTTAATAGG + Intergenic
933174655 2:79161439-79161461 GTACAAACATACAGCTAGATAGG + Intergenic
933558301 2:83859510-83859532 ATGCAAACACACACACACATAGG - Intergenic
939969144 2:148640832-148640854 TTGAAAACACACAGCTCCAGAGG - Intergenic
942377968 2:175356308-175356330 GTGCAAACTCACTTCTACAATGG + Intergenic
943138296 2:183943940-183943962 GTACAAACATACAGTTAGATGGG + Intergenic
943584617 2:189723307-189723329 GTGCATACAAGCAGCTAAATGGG - Intronic
945643741 2:212463142-212463164 ATGCAAAATCACAGCTAAATAGG + Intronic
948187994 2:236036261-236036283 GTGCACACACAAAGCAACTTAGG - Intronic
948419070 2:237843128-237843150 ATACAAAATCACAGCTACATAGG - Intergenic
1172649068 20:36490418-36490440 GTCAAACCACACAGCTAAATTGG - Intronic
1173534924 20:43802267-43802289 GTCCACAGACACAACTACATGGG - Intergenic
1175720584 20:61284405-61284427 GTGCAAACACAGAGATTCACTGG + Intronic
1178536689 21:33415823-33415845 GTGCACACACACACACACATTGG - Intronic
1180499613 22:15920498-15920520 ATGCAAACAAAGAGCCACATGGG - Intergenic
1181971404 22:26693000-26693022 GAGCAAAAACAGAGCTACAAGGG + Intergenic
1182078558 22:27512295-27512317 GTACACACACACATCTGCATGGG + Intergenic
1182749104 22:32627493-32627515 ATGCAGACACACATCTACCTGGG + Intronic
949197864 3:1335237-1335259 CTGTACACACACTGCTACATTGG + Intronic
955236737 3:57146073-57146095 GTGCACACACACACATACAAAGG + Intronic
956723024 3:72134935-72134957 GTGCACACACACACATACACAGG + Intergenic
956970216 3:74514866-74514888 GAGAAAACACACAGCAACTTAGG + Intronic
957283378 3:78183423-78183445 GAGCACACACACAGCTGCTTAGG - Intergenic
957482120 3:80811774-80811796 TTGCAAATACACAGCTATATAGG - Intergenic
957667142 3:83247514-83247536 GTGCAAAGACACACATACAAAGG - Intergenic
959388072 3:105737805-105737827 ATGCAAACACACAGACACACAGG + Intronic
959930115 3:111971391-111971413 TTGCAAAGACACATTTACATGGG - Intronic
962754073 3:138455125-138455147 CTGCAGACCCACAGCTGCATGGG - Intronic
969184003 4:5462150-5462172 GTACAGACACACAGACACATGGG - Intronic
969210547 4:5683878-5683900 GGGAACACACACAGCTACACGGG + Intronic
970926872 4:21462202-21462224 GTGAAAACACACAAATACATGGG - Intronic
973316841 4:48769491-48769513 GTGAAAACATACAGCCACTTTGG + Intronic
975654093 4:76623740-76623762 GTGCAAATCCAAAGCTAAATAGG - Intronic
977115050 4:93013690-93013712 GTGCAAATACAGATTTACATAGG - Intronic
978292004 4:107152731-107152753 GTGTACACACACAGCCAAATAGG + Intronic
979717920 4:123863973-123863995 TTGGAAACTCACAGCTACAAGGG + Intergenic
980712023 4:136581420-136581442 GTCCAAACACACATCTGCATAGG - Intergenic
981271390 4:142850338-142850360 ATGCACACACACAGTTACAATGG + Intergenic
981896418 4:149806429-149806451 GTACAAAAATACAGTTACATAGG - Intergenic
984508052 4:180644417-180644439 TTGCAAAAATGCAGCTACATAGG + Intergenic
985860136 5:2464358-2464380 GTGCAAACCCACATGTTCATTGG + Intergenic
987159965 5:15132194-15132216 GTGCAAACACACACAGACACTGG - Intergenic
987620429 5:20333185-20333207 GGGCACACACACAGGTATATGGG + Intronic
992129608 5:73678627-73678649 GTGTAAATACATAACTACATGGG + Intronic
993001771 5:82388081-82388103 CTGAAAATACATAGCTACATCGG + Intergenic
996232707 5:121086449-121086471 GTACAAAAACACAGTTAGATAGG - Intergenic
997871390 5:137508361-137508383 GTGCAAACACACACACACAATGG + Intronic
998966649 5:147548478-147548500 GTGCAACATCACTGCTACATGGG + Intergenic
999150868 5:149424979-149425001 GTGCATCCACAAAGCTCCATGGG - Intergenic
1000186987 5:158868716-158868738 GTGCAAACACCCAGAGACAGGGG - Intronic
1001858083 5:175030170-175030192 GTGCAAAAAGACAGTTACATAGG - Intergenic
1005054243 6:21715000-21715022 GTGCAAAGTCACAGATACAGTGG + Intergenic
1005439365 6:25849133-25849155 CTGAAACCACACAGCTGCATAGG - Intronic
1005913790 6:30333995-30334017 GTGCAAACACACACACACAAAGG + Intronic
1007484645 6:42172609-42172631 GTGCAGGCACACAGGTGCATGGG - Intronic
1007697736 6:43744396-43744418 GTGCACACACACAGCCAACTGGG - Intergenic
1007995706 6:46305654-46305676 GTCCAACCAATCAGCTACATGGG + Intronic
1012024681 6:93973540-93973562 GTGCAGACACACAGAGACACAGG + Intergenic
1015953289 6:138575265-138575287 GTGCATACACACAGCAGCAAAGG + Intronic
1016347981 6:143136576-143136598 ATGCACACACACATCTAAATAGG - Intronic
1017501749 6:155032175-155032197 GAGAAAACACACAGGAACATTGG - Intronic
1018574255 6:165242824-165242846 CTGAAAACCCAGAGCTACATGGG + Intergenic
1018797956 6:167201909-167201931 GAGCAAAGACACAGACACATGGG + Intergenic
1018842077 6:167524518-167524540 GTGCCGGCCCACAGCTACATGGG + Intergenic
1020744506 7:12065043-12065065 GTTCAAACATCCAGCTTCATTGG - Intergenic
1021187250 7:17578490-17578512 CTCAAACCACACAGCTACATGGG + Intergenic
1021370194 7:19835280-19835302 ATGTAAACACAGAGCTTCATGGG - Intergenic
1025227932 7:57180009-57180031 GTGCCAGCACACAGCAACAGCGG + Intergenic
1025640402 7:63361977-63361999 AAACAAACAAACAGCTACATGGG - Intergenic
1025642297 7:63386116-63386138 AAACAAACAAACAGCTACATGGG + Intergenic
1027810958 7:82897480-82897502 GTGTATACACACACATACATAGG + Intronic
1029788386 7:102816584-102816606 GTGCAAACACACAGCTACATAGG - Intronic
1029790316 7:102836627-102836649 TTGCCAACACACAGCAAAATTGG - Intronic
1030657517 7:112184271-112184293 CTGCACACACACAGCCACACAGG + Intronic
1030742680 7:113128471-113128493 GTGGCAAGCCACAGCTACATGGG + Intergenic
1035741633 8:1932236-1932258 GTGCATACACACATGTGCATGGG - Intronic
1036510567 8:9396393-9396415 ATGCACACACACACATACATAGG + Intergenic
1039244677 8:35595842-35595864 GTGCAAACACAGAAGTAGATGGG - Intronic
1039859528 8:41445007-41445029 ATGCAAACACACATATGCATAGG + Intergenic
1041746845 8:61216509-61216531 GTTCAAACGCACAGACACATTGG - Intronic
1043035846 8:75197629-75197651 ATGAAAACATACAGCTATATAGG + Intergenic
1046587358 8:116163905-116163927 GTGCACACACACATATACATAGG + Intergenic
1049161009 8:141097611-141097633 GTACAAACATACAGTTAGATAGG - Intergenic
1049507061 8:143008463-143008485 GTGCAAACACACAGGTACACTGG + Intergenic
1051262016 9:15273738-15273760 TACCAAACACACAGCTTCATTGG - Intronic
1054162042 9:61680453-61680475 ATGCCAACACACAGCCACAGAGG + Intergenic
1058296659 9:103316190-103316212 GTGAACACACACAGATACCTGGG + Intergenic
1058729034 9:107832299-107832321 CTGCAAACTCACAGCCTCATGGG - Intergenic
1059074205 9:111174074-111174096 ATTGATACACACAGCTACATGGG + Intergenic
1059367121 9:113794938-113794960 GTGCATTCACACAGCTAGAAAGG + Intergenic
1060767685 9:126307266-126307288 GTGCAATCACACAGTCACAGGGG - Intergenic
1061846215 9:133389792-133389814 GTGCACACGCACAGCTGCATGGG + Intronic
1186367655 X:8912172-8912194 TTGAAAACACACAACGACATTGG + Intergenic
1189147386 X:38668992-38669014 GTACAAAGTCACAGCTAGATAGG + Intronic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1190637337 X:52448945-52448967 TTATAAACACACAGCTACCTAGG + Intergenic
1190648696 X:52547315-52547337 TTATAAACACACAGCTACCTAGG - Intergenic
1190679719 X:52814856-52814878 TTATAAACACACAGCTACCTAGG - Intronic
1192312936 X:70031569-70031591 GTTAAAAAAAACAGCTACATGGG + Intronic
1192396154 X:70783180-70783202 CTCAAAACACACAACTACATGGG + Intronic
1194234377 X:91364132-91364154 GTACAAACATACAGTTAGATAGG - Intergenic
1194752692 X:97702421-97702443 ATTCGAACACACAGCTACAGTGG + Intergenic
1194832228 X:98637748-98637770 GAGAAAACACAGAGATACATGGG + Intergenic
1195616314 X:106915167-106915189 ATTGATACACACAGCTACATGGG - Intronic
1196934624 X:120717288-120717310 GTGCAAACCCAAAGCAACAGGGG - Intergenic
1198183551 X:134233174-134233196 GTGAAGACACACAGACACATAGG + Intergenic
1201323671 Y:12730597-12730619 GTGCACACTCCCAGCTACTTGGG - Intronic
1201685731 Y:16700203-16700225 ATGCAAAATTACAGCTACATAGG - Intergenic