ID: 1029794338

View in Genome Browser
Species Human (GRCh38)
Location 7:102877989-102878011
Sequence GAACACCCCTTGGGAAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029794333_1029794338 13 Left 1029794333 7:102877953-102877975 CCTCTGACAAGAGGGGAGTCAAG 0: 1
1: 0
2: 1
3: 9
4: 114
Right 1029794338 7:102877989-102878011 GAACACCCCTTGGGAAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029794338 Original CRISPR GAACACCCCTTGGGAAATGC TGG Intronic
No off target data available for this crispr