ID: 1029796098

View in Genome Browser
Species Human (GRCh38)
Location 7:102896082-102896104
Sequence CAGAGTGGCTGGAGTAGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 717
Summary {0: 1, 1: 2, 2: 27, 3: 127, 4: 560}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029796094_1029796098 10 Left 1029796094 7:102896049-102896071 CCTGCTTATGTTTTTGAAGAATA 0: 1
1: 1
2: 1
3: 37
4: 364
Right 1029796098 7:102896082-102896104 CAGAGTGGCTGGAGTAGAGTTGG 0: 1
1: 2
2: 27
3: 127
4: 560
1029796093_1029796098 23 Left 1029796093 7:102896036-102896058 CCTGCAGCATGAGCCTGCTTATG 0: 1
1: 0
2: 2
3: 13
4: 122
Right 1029796098 7:102896082-102896104 CAGAGTGGCTGGAGTAGAGTTGG 0: 1
1: 2
2: 27
3: 127
4: 560
1029796092_1029796098 24 Left 1029796092 7:102896035-102896057 CCCTGCAGCATGAGCCTGCTTAT 0: 1
1: 0
2: 1
3: 17
4: 129
Right 1029796098 7:102896082-102896104 CAGAGTGGCTGGAGTAGAGTTGG 0: 1
1: 2
2: 27
3: 127
4: 560

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029796098 Original CRISPR CAGAGTGGCTGGAGTAGAGT TGG Intronic
900502460 1:3013030-3013052 CGGAGTGGCTGGAATTGGGTGGG + Intergenic
900615972 1:3565812-3565834 GAGCGTGGCTGGAGCAGAGTTGG - Intronic
900686915 1:3954547-3954569 CAGAGGGGCGGGAGGAGAGGCGG - Intergenic
900721059 1:4176070-4176092 CAGGCTGCCTGGGGTAGAGTTGG - Intergenic
901324099 1:8356692-8356714 CAGAGTGGGTGGCGCAGAATGGG + Intronic
902212728 1:14915326-14915348 CAGAGTGCCTGGCATAGAGGTGG + Intronic
902490919 1:16779819-16779841 CACAGTGGCTGGCACAGAGTGGG + Intronic
902539711 1:17145540-17145562 CAGCGTGGCTGGAGAGAAGTGGG - Intergenic
902706190 1:18206650-18206672 CAATGTAGCTGGAGCAGAGTGGG + Intronic
902961170 1:19963713-19963735 CAGAGTGGCTGGAGTGAAGCGGG - Intergenic
903180010 1:21600486-21600508 CAAAGAGGCTGGAGTGGGGTGGG - Intronic
903293504 1:22329303-22329325 CTGAGTGGCTGGAGTAGAGTGGG - Intergenic
903320560 1:22540658-22540680 CAGGGTGGCTGGAGCAGAGTGGG + Intergenic
903371025 1:22836286-22836308 CCGAGAGCCTGGTGTAGAGTTGG - Intronic
903948970 1:26983006-26983028 CACAGTGGCTGGTGCATAGTAGG + Intergenic
904013470 1:27403582-27403604 GAGAGGGGCGGGAGCAGAGTTGG - Intergenic
904347111 1:29879693-29879715 CAGAGGGGCTGGTGCATAGTAGG + Intergenic
904824936 1:33268267-33268289 CAGAGTGGGTGGAGGGGACTTGG + Intronic
904910249 1:33929226-33929248 GAGGGTGGCCGGAGTAGAGGTGG - Intronic
905270486 1:36784234-36784256 GAAAGGGGCTGGAGGAGAGTAGG + Intergenic
905815168 1:40944420-40944442 CAGAGTAGCGGGGGTGGAGTGGG - Intergenic
906488308 1:46248093-46248115 CAGACTGGGCGGAGTGGAGTGGG - Exonic
906527436 1:46503089-46503111 CAGGGTGGCTGGAGCACAGATGG - Intergenic
907281548 1:53350293-53350315 CAGTGTGGCTGGAGCATGGTGGG - Intergenic
907526929 1:55059194-55059216 CAGAGTGGGTGGAGTGGAGCTGG + Intronic
907867416 1:58411683-58411705 CAGCATAGCTGGAGTAGAGAGGG + Intronic
908734009 1:67256972-67256994 AGGAGTGGCTGGAGTAAAGCTGG - Intronic
908820607 1:68082133-68082155 GAGAGTGGTGGGAGGAGAGTAGG + Intergenic
909033896 1:70574669-70574691 CTGAGGGGCTGGAGTAGAAAGGG - Intergenic
909180164 1:72413761-72413783 CATGGTGGCTGGACTATAGTGGG + Intergenic
909502644 1:76353175-76353197 CAGGGTGGCTGGAGAGGAGATGG - Intronic
909761844 1:79298155-79298177 CAGTGTGTCTAGAGTAGAGGTGG + Intergenic
910092479 1:83481372-83481394 CTGCGTGGCTGGAGCAGAGTAGG - Intergenic
911068405 1:93812572-93812594 CAGAGGAGCTGGGGTAGAGGAGG - Intronic
911807007 1:102222964-102222986 CAGTGTGGCTAGAGTAAAGCAGG + Intergenic
911869565 1:103078188-103078210 CAGCATGGCAGGAGAAGAGTGGG - Intronic
912164993 1:107032440-107032462 CAGAGTGGAAGCAGTAGAGATGG - Intergenic
912522462 1:110255152-110255174 CACAGAGCCTGGAGCAGAGTAGG + Intronic
912706864 1:111921083-111921105 CAGAGTGGCTGGCTAAGTGTAGG - Intronic
912949280 1:114109601-114109623 CACAGTGGCTGGCACAGAGTAGG + Intronic
914462552 1:147898426-147898448 CAGAGGGGCTGTGGTAGAGTGGG - Intergenic
915030627 1:152877785-152877807 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
915643046 1:157244904-157244926 CAAAGTGGTTGGATTAGAGATGG - Intergenic
915744994 1:158149186-158149208 CAGTGTGGATGGAGAAAAGTGGG + Intergenic
916397142 1:164403374-164403396 CAGAGTGCCTGGTGTAGAATTGG + Intergenic
916573695 1:166048970-166048992 CAGTGTGGCTGGAGTGGAATAGG - Intergenic
917029326 1:170671758-170671780 CAGGGTGGCAGGAGGGGAGTGGG + Intronic
917218441 1:172702265-172702287 CAGTTTGTCTGGAGTGGAGTGGG + Intergenic
917468610 1:175306896-175306918 CAGAGTGGCTGAAGCACAGATGG - Intergenic
917793416 1:178514317-178514339 CTGAGTGGCTGCCGTGGAGTGGG + Intronic
920768693 1:208858952-208858974 CAGTGTGGTTGGAGTAAAGTGGG + Intergenic
921051212 1:211513118-211513140 CAGAGTGTCTGGTATAAAGTAGG - Intergenic
921056688 1:211547976-211547998 CAGTGTGGCTGAAACAGAGTGGG - Intergenic
921304570 1:213782883-213782905 CAGACAGGCTGGAGTGAAGTTGG + Intergenic
922065801 1:222141297-222141319 CAGAATGGTTTGAGTAGGGTTGG - Intergenic
922205192 1:223440270-223440292 CAGGGAGGGTGGAGTAGAGATGG + Intergenic
922764919 1:228151715-228151737 CAGAGCTGCTGGGGCAGAGTGGG + Intronic
923054279 1:230413872-230413894 CATAGTGCCTGGTGCAGAGTAGG + Intronic
923326262 1:232882900-232882922 CAGAGTGGATGGTGTGGAGTGGG - Intergenic
923333352 1:232946177-232946199 CAGTGTGGCCGGAGCAGAGTAGG - Intergenic
923533805 1:234832565-234832587 CTGAGTGACTGGAGTGGAGCTGG - Intergenic
923891204 1:238216741-238216763 CAGTGGGGAAGGAGTAGAGTAGG + Intergenic
923958639 1:239051776-239051798 CAGTGTGGTTGGGGCAGAGTTGG + Intergenic
924441494 1:244089072-244089094 CACAGTGTCTGGCATAGAGTTGG + Intergenic
924825420 1:247533129-247533151 CAGAGTGGCAGGAGCAGGGGTGG - Intronic
1062942879 10:1438050-1438072 CAGAGTGGCTGAAGCAGGGTGGG + Intronic
1063088265 10:2839018-2839040 CAGAGGGGCTGGGGAAGAGCTGG - Intergenic
1064242331 10:13641813-13641835 AAGAGTGGGTTTAGTAGAGTGGG + Intronic
1064468916 10:15615190-15615212 CAGAGCTGCTGGAGCAGAATGGG - Intronic
1064813909 10:19234697-19234719 CATAGTGTCTGGAGTATAGTAGG - Intronic
1065172185 10:23042547-23042569 TTGAGTGGCTGCAGTAGAGATGG - Intergenic
1065204054 10:23341686-23341708 CAGTGTGGCTGGAGCAGAGAGGG - Intronic
1066595439 10:37044757-37044779 GAGAGTGGGTGCAGGAGAGTGGG - Intergenic
1066756462 10:38717178-38717200 AAGAGGGGCTGGAGTTGGGTGGG + Intergenic
1067146057 10:43694732-43694754 CAGAGGGGCTGGAGGAGGGGAGG + Intergenic
1067210584 10:44257691-44257713 GAGAGGGACTGGAGTAGAGCTGG + Intergenic
1067224198 10:44364694-44364716 CAGTGTGGCTGGAGCAGAGAGGG + Intergenic
1067687479 10:48475899-48475921 CAGTGTGGCCAGAGCAGAGTGGG - Intronic
1067759404 10:49032289-49032311 CAGCATGGCTGGTGTAGAGCCGG + Intronic
1068003882 10:51370088-51370110 CAGAGTGGCTGGAGCATCATAGG + Intronic
1068430068 10:56919974-56919996 CAGAGTTGGTGGAGTAGAAATGG + Intergenic
1068929425 10:62573797-62573819 CAGAGTGGGTGGATTTGATTTGG + Intronic
1069361762 10:67650975-67650997 TAGAGTGGGTGGTGAAGAGTGGG - Intronic
1069507986 10:69018841-69018863 CAGTGTGGCTGGAGCAGATAAGG + Intergenic
1069605022 10:69733396-69733418 CAGTGTGGCTGGGGTGTAGTTGG + Intergenic
1069799419 10:71072885-71072907 CAGAGTGCCTGGAGCAAAGCCGG + Intergenic
1070731535 10:78831856-78831878 CACAGTGCCTGGCGAAGAGTAGG - Intergenic
1072493871 10:95935337-95935359 CAGAGAGGCTGGTGAAAAGTGGG - Intronic
1072987584 10:100155171-100155193 GAGAGTGGGTGGAGGAGAGAAGG - Intronic
1073680289 10:105696055-105696077 AAGAGTTGCTGGAGTAGGTTGGG + Intergenic
1073788449 10:106915558-106915580 CAATGTGACTAGAGTAGAGTGGG - Intronic
1075383384 10:122037208-122037230 CGGTGTGGCTGGAGAAAAGTGGG + Intronic
1075680160 10:124325768-124325790 CAGAGTGACGGGAGCAGTGTGGG - Intergenic
1075945263 10:126427552-126427574 CAGCGTGGCTGGAATAAAGCAGG + Intronic
1075990529 10:126834774-126834796 CAGAGATGCTGGGGCAGAGTGGG - Intergenic
1076447068 10:130523567-130523589 CAGCGTGGCTGGAATAAAGCCGG + Intergenic
1077537750 11:3132585-3132607 CAGTGTGGCTGGAGCAGAGTGGG - Intronic
1077594398 11:3519243-3519265 CAGAGTGGCTGAAATAGAGTAGG - Intergenic
1077603016 11:3586908-3586930 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1077883972 11:6372201-6372223 GACAGTGGCTGGAGCAGAGTGGG - Intergenic
1078251071 11:9617010-9617032 CAGTGTGACAGGAGTGGAGTGGG + Intergenic
1078846648 11:15124590-15124612 CAGAGAGGCTGGGGGAGGGTGGG + Intronic
1080319362 11:30988542-30988564 CTGGGAGGCTGGAGAAGAGTGGG - Intronic
1081427251 11:42938846-42938868 CAATGTGGCTAGAGCAGAGTTGG - Intergenic
1081622269 11:44625615-44625637 CACAGTGCCTGGCATAGAGTGGG - Intergenic
1081850382 11:46271588-46271610 TAGAGTGGCTGGCATACAGTAGG + Intergenic
1083001379 11:59294618-59294640 CAGGCTGGCTGGAGTGTAGTGGG + Intergenic
1083479415 11:62934056-62934078 CAGAGTGGCCAGAGTGGGGTGGG - Intergenic
1083655985 11:64229967-64229989 CAGAGCGGCGGGAGTAGGGCTGG - Exonic
1083855903 11:65392981-65393003 CAAGGTGGCAGGAGCAGAGTGGG + Intronic
1084250248 11:67892520-67892542 CAGAGTGGCTGAAATAGAGTAGG - Intergenic
1084258896 11:67961446-67961468 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1084434820 11:69132552-69132574 CAGGGAGGCTGGAATGGAGTTGG - Intergenic
1084453919 11:69256550-69256572 CAGAGAGGCTTAAGCAGAGTGGG - Intergenic
1084730699 11:71071720-71071742 CAGAGTGGCTGGAGGGGCCTGGG + Intronic
1084794709 11:71497352-71497374 CAGAGAGGCAGGAGCAGAGGTGG - Intronic
1084813851 11:71633732-71633754 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1084822543 11:71702826-71702848 CAGAGTGGCTGAAATAGAGTAGG + Intergenic
1085055657 11:73402086-73402108 GAGAGGGGCAGTAGTAGAGTGGG - Intronic
1085645595 11:78220300-78220322 CAAGGTGCCTGGAGTAGAGTTGG - Exonic
1086481810 11:87247858-87247880 GAGAGTGGGTGCAGTACAGTGGG - Intronic
1087286587 11:96270923-96270945 CAGTGTGGCTAGAGTAAAGCAGG + Intronic
1087658317 11:100954287-100954309 CGCAGTACCTGGAGTAGAGTAGG - Intronic
1087660851 11:100986394-100986416 CATTGTGACTGGAGTAGAGTAGG + Intronic
1087825035 11:102755367-102755389 CAATGTGGCTGGAGCAGAGTGGG + Intergenic
1088212640 11:107473557-107473579 CAGTGAGGCTGGAATAAAGTAGG - Intergenic
1088543455 11:110936978-110937000 GAGAGTGGCTGGAAGAGACTGGG + Intergenic
1089371040 11:117957838-117957860 CAGTGTGGCTGGAATAAAGCAGG - Intergenic
1089611658 11:119672725-119672747 GAAAATGGCTGGAGCAGAGTGGG - Intronic
1089652919 11:119926379-119926401 CAGGGTGGATGGAGTAGGGCTGG - Intergenic
1089676337 11:120092537-120092559 CAGTGTGGCTGGTGCAGAGAGGG + Intergenic
1091671652 12:2456516-2456538 CAGTGTGGCTGGAGCAGGGCAGG - Intronic
1091883503 12:3999209-3999231 CTGAGTGACTGGAGAAGAGAAGG + Intergenic
1092244670 12:6856898-6856920 GAGAGTGGCTGGAGGAGGGGAGG - Intronic
1092420571 12:8328032-8328054 CAGAGTGGCTGAAATAGAGTAGG - Intergenic
1092430222 12:8402454-8402476 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1093008038 12:14072240-14072262 CATAGTGCCTGGCATAGAGTAGG - Intergenic
1094084385 12:26573761-26573783 CAGTGTGGATGGAGCAGAGTTGG + Intronic
1094554288 12:31482996-31483018 CATTGTTGCTGGAGCAGAGTGGG - Intronic
1095577439 12:43757015-43757037 CAGAGTAGCTGGAGTATAGTGGG - Intronic
1096480063 12:51934216-51934238 CAGAGTGGCTGGAGGGGTGTGGG - Intergenic
1096504302 12:52082893-52082915 CAGAGTGGCAGCAGGAGAGCAGG - Intergenic
1096874196 12:54614513-54614535 CAGTGGGGCTGGAGAAGAGAAGG + Intergenic
1096878394 12:54647993-54648015 CAGAGTGGTTGGAGCAGAGTGGG + Intronic
1097156637 12:57016613-57016635 CAGGGTGGCTGGAGGGGAGGCGG + Intronic
1097285622 12:57874942-57874964 CAGTGTGGCTGGAGCAATGTAGG + Intergenic
1097338273 12:58409035-58409057 CACAGTGCCTGGTATAGAGTGGG - Intergenic
1097637214 12:62137653-62137675 CAGGGTGGTTGGAGTGGAGGTGG - Intronic
1098236718 12:68424689-68424711 CAGGGTGGCAGCAGTAGAGGAGG + Intergenic
1098867477 12:75779578-75779600 CACAGTGCCTGGAGTATAGAAGG - Intergenic
1098908862 12:76188950-76188972 CAGTGTAGCTGGAGAAAAGTAGG - Intergenic
1099203983 12:79707498-79707520 CACAGTGTCTGGAGTACAGCAGG + Intergenic
1099338516 12:81396497-81396519 CAGTGTGGCTGGGGTGGATTTGG + Intronic
1100904515 12:99282300-99282322 CAGTGTGGCTGGAGCAAAGTGGG + Intronic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1101646881 12:106639365-106639387 CAGAGTAGCAGGAGTGGAGTGGG - Exonic
1101748047 12:107559079-107559101 CAGAGTGGGTGGGGAAGAGAAGG + Intronic
1101926606 12:108977030-108977052 CACAGTGCCTGGCATAGAGTAGG - Intronic
1102233730 12:111281223-111281245 CCCAGTGGCTGGAGTGGAGTTGG - Intronic
1102459084 12:113089203-113089225 CAGGGTGGCTGGAGTGGAGTGGG + Intronic
1102687375 12:114735391-114735413 GAGAGTGGATGGAGTAGGGGCGG + Intergenic
1103445083 12:120989179-120989201 CAGAGTGCCTGGCGCAGAATAGG - Intronic
1103583483 12:121933932-121933954 CAGAGTGGCTGGGGGAGGGGAGG + Intronic
1103963156 12:124621973-124621995 CAGAGTGGCTGGACTGGGGGTGG - Intergenic
1104061997 12:125276554-125276576 CTGAATGGCTGGAGTGGAGTTGG + Intronic
1104427512 12:128690205-128690227 CAGAGTGAGTGGAGTTCAGTGGG + Intronic
1104678090 12:130729367-130729389 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
1104732706 12:131116833-131116855 CAGGGTGGCTGCACTAGAGCAGG + Intronic
1105277987 13:18947360-18947382 CAGAGTGGCTGGGGTGCAGGAGG - Intergenic
1105665582 13:22552339-22552361 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1106643026 13:31605906-31605928 CAGAGTGGCTGGAAGACATTTGG + Intergenic
1106644353 13:31616599-31616621 CAGGCAGGCTGGAGTAAAGTGGG - Intergenic
1107707641 13:43123164-43123186 TAGGGGGGCTGGAGCAGAGTGGG - Intergenic
1108725003 13:53171026-53171048 CATAGAGGCTGGAGTAGCTTTGG - Intergenic
1108782835 13:53857650-53857672 CAGTGTGGCTAGAGCAGATTGGG + Intergenic
1109443156 13:62400471-62400493 GGGAGTGGTTGGTGTAGAGTGGG - Intergenic
1110289165 13:73784591-73784613 CAGAGATGCTGGAGTGGAGGAGG - Intronic
1110413239 13:75225886-75225908 CAGAGTGGCTTTATTAGATTTGG - Intergenic
1110425035 13:75357481-75357503 CAGTGTGGCTGGAGTTGGGGAGG - Intronic
1110533672 13:76626706-76626728 CAGTGTGGCTAGAGTACAGAGGG - Intergenic
1112128925 13:96499739-96499761 CAGTGTGGCTGAAGCTGAGTGGG + Intronic
1112378708 13:98868142-98868164 CAGGGTGACTAGAATAGAGTAGG - Intronic
1112530046 13:100192376-100192398 CACAGTGCCTGACGTAGAGTTGG + Intronic
1113351687 13:109535735-109535757 GAGGGTGGCTGAAGCAGAGTGGG + Intergenic
1113398297 13:109969038-109969060 GAGAGGGGCTGGAAAAGAGTGGG + Intergenic
1114450322 14:22821283-22821305 CAGTGAAGCTGGAGTGGAGTGGG - Intronic
1114621813 14:24100694-24100716 CCAAGTGGCAGGAGGAGAGTTGG - Intronic
1115861559 14:37692102-37692124 CAGAATAGCTTGAGTAGAATTGG - Intronic
1116359552 14:43976175-43976197 AAAAGTGGCTGGATCAGAGTTGG - Intergenic
1116783613 14:49264798-49264820 CAGAGTGTCTGAAACAGAGTAGG - Intergenic
1117672144 14:58119066-58119088 CAGAATGGCTGGAGAAGAAAAGG + Intronic
1118048967 14:62005195-62005217 CTGTTTGGCTGGAGTAGAGCAGG + Intronic
1119532807 14:75374721-75374743 CAGCGTGGCTAGAATAAAGTAGG + Intergenic
1119664015 14:76471514-76471536 CAGGGAGGCTGGAGCAGAGTGGG - Intronic
1120515763 14:85468452-85468474 CAGAGTGACTGGAGCAAAGAAGG + Intergenic
1120703372 14:87723126-87723148 TGCAGTGGCTGGAGAAGAGTGGG + Intergenic
1120823618 14:88935452-88935474 CAGAGTGGCTGGAGAGGAGAAGG - Intergenic
1121032076 14:90666796-90666818 CACAGTGAGAGGAGTAGAGTGGG + Intronic
1121075403 14:91063971-91063993 GAGAGTGGGTGCAGTAGAGATGG + Intronic
1121240596 14:92427337-92427359 CAGTGTGGCCAGAGTAGAGTGGG + Intronic
1121288456 14:92755097-92755119 CATTGTGGCTGGAGTGGAGCAGG - Intergenic
1121383581 14:93495912-93495934 CAGACTTGATGGATTAGAGTGGG - Intronic
1121576067 14:94989249-94989271 CAGAGTGGCTGGTATACAGTAGG - Intergenic
1122005156 14:98697392-98697414 CAGAGAGGCAGGAGTGGAGGTGG + Intergenic
1124318274 15:28691857-28691879 CACTGAGGCTGGAGTACAGTGGG - Intergenic
1124565166 15:30805600-30805622 CACTGAGGCTGGAGTACAGTGGG + Intergenic
1124682050 15:31740246-31740268 CTGAGTGCCTGGAGCAGAGGTGG + Intronic
1124805538 15:32878226-32878248 CCGTGTGGCTGGAGTTTAGTGGG + Intronic
1124920075 15:34017188-34017210 CAGAGTGGGTGGATTTGAGACGG - Intronic
1125168435 15:36738537-36738559 CAGAATGGCTGTTGCAGAGTGGG - Intronic
1125259374 15:37804873-37804895 CAGAATGGGTAAAGTAGAGTTGG + Intergenic
1125343180 15:38694443-38694465 CTGGTGGGCTGGAGTAGAGTAGG + Intergenic
1125392527 15:39209787-39209809 AAGAGGGCCTGGTGTAGAGTAGG + Intergenic
1125503938 15:40256011-40256033 CCCAGAGCCTGGAGTAGAGTAGG + Intronic
1125540158 15:40465650-40465672 TAGAATGGTTGGAGCAGAGTTGG + Intronic
1126313253 15:47340152-47340174 CTGCGTGGATGGAGCAGAGTAGG + Intronic
1126665983 15:51076996-51077018 AAGAATGGCGGGAGTAGAATGGG - Intronic
1128285641 15:66434851-66434873 CCGGGTGGCTGGAGTGAAGTGGG + Intronic
1128337745 15:66798334-66798356 CACAGTGGCTGGACTTGGGTGGG - Intergenic
1128506489 15:68276814-68276836 CAGTGTGGCTGCAGCAGAGTGGG - Intergenic
1128525004 15:68406356-68406378 CAGTATGGCTGGAGGAGAGGAGG - Intronic
1128799523 15:70488840-70488862 CAGAGGGGATGGACTAGACTAGG + Intergenic
1128831304 15:70771881-70771903 CAGTGTGGCTGGAGCATAGTGGG + Intergenic
1129033899 15:72638450-72638472 TGGAGTGGCTGGAGTTGTGTGGG + Intergenic
1129215983 15:74098766-74098788 TGGAGTGGCTGGAGTTGTGTGGG - Intergenic
1129408809 15:75337686-75337708 TGGAGTGGCTGGAGTTGTGTGGG + Intronic
1129498026 15:76005645-76005667 CTCACTGGCTGGAGTACAGTAGG - Intronic
1129503687 15:76063410-76063432 CAGTGTGGATGGAGCAGAATAGG - Intronic
1129733122 15:77943101-77943123 CGGAGTGGCTGGACTTGTGTGGG - Intergenic
1131513048 15:93060163-93060185 CTCAGTGGCTGGAGTAGAAATGG - Intronic
1132265913 15:100470515-100470537 CAGAGTGACTGTAGTGGAGTGGG + Intronic
1133359287 16:5161086-5161108 CAGAGTGGCTGAAATAGAGTAGG - Intergenic
1133365965 16:5210419-5210441 CAGTCTGGCTGGAGGACAGTGGG - Intergenic
1133747977 16:8701907-8701929 CAGTGTGGCTGGAGCAGAGCAGG + Intronic
1133772938 16:8878248-8878270 CAATGTGGCTGGAGTAGGGAGGG + Intergenic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1134138309 16:11695364-11695386 TAGAGTGAGTGGAATAGAGTTGG - Intronic
1135471514 16:22735772-22735794 CACAGTGCCTGGTGTACAGTAGG + Intergenic
1135961924 16:27002132-27002154 CAGTGTGGCTGGAAGAGAATAGG + Intergenic
1137369259 16:47889516-47889538 CCGAGTGCTTGGAGTATAGTAGG + Intergenic
1137501507 16:49014985-49015007 CAGTGTGGCCGGAGCAGAGTGGG + Intergenic
1137537964 16:49341883-49341905 CTGTGTGGCTGGAGTTCAGTGGG + Intergenic
1138197210 16:55060501-55060523 CCATGTGGCTGGAGCAGAGTGGG - Intergenic
1139087065 16:63599687-63599709 CACAGTGGCTGGGGTAGGGTAGG - Intergenic
1139278456 16:65749525-65749547 CAGGGCAGCTGGAGTCGAGTTGG + Intergenic
1140455945 16:75105607-75105629 CAGTGTGGCTGGTGCAGAGGAGG + Intronic
1141715105 16:85722525-85722547 CAGAGTGGCTGGACCTGAGCTGG - Intronic
1141916182 16:87098820-87098842 CAGAGTGGCTGGAGTTGGGCCGG + Intronic
1142208667 16:88796615-88796637 CACAGTGCCTGGAGCATAGTAGG + Intergenic
1143580419 17:7822344-7822366 CTGCGTGGCTGGAGTGGAGTGGG - Intronic
1143686172 17:8517823-8517845 CAGTGTGGCTGGAGCAGGATGGG - Intronic
1144330842 17:14222802-14222824 CACTGTGGCTGGAGCAGTGTGGG - Intergenic
1144537487 17:16105012-16105034 CAGTGTGGTTGGAGCAGAGGGGG + Intronic
1144743575 17:17598171-17598193 CAGTGTGGCTGGAGTACAGAGGG - Intergenic
1144743861 17:17600125-17600147 CACTGTTGCTTGAGTAGAGTTGG + Intergenic
1144831113 17:18131686-18131708 CACCGTGGCTGGAGGAGGGTCGG - Intronic
1145414506 17:22703789-22703811 CAGTGCGGCTGGGGTTGAGTTGG + Intergenic
1146017684 17:29246996-29247018 TAGGGTGGCTGGAGAAGAGTGGG + Intronic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1147448407 17:40488895-40488917 CAGAGGGGCTGGAGCAGTGCTGG + Exonic
1147584126 17:41643252-41643274 CTGTGTGGCTGGGGTGGAGTGGG + Intergenic
1147667235 17:42156436-42156458 CAGAGGGGATGGGGCAGAGTGGG + Intergenic
1147906017 17:43823548-43823570 CAGAGTGCCTGGCACAGAGTAGG + Intronic
1149004534 17:51791415-51791437 CAGAGTGCCTGGTGCACAGTGGG + Intronic
1149309357 17:55378996-55379018 CAGAGGAGCTGGAGTAAATTTGG + Intergenic
1150292217 17:63988469-63988491 CAGAGTGGCCTGAGTGGAGTTGG - Intergenic
1150365597 17:64581336-64581358 GAGTGTGGCTGAAGCAGAGTGGG - Intronic
1151192843 17:72411266-72411288 AAGAGTGGCTGGGGTAGACCTGG + Intergenic
1151260061 17:72909143-72909165 CACCGAGGCTGGAGTAAAGTGGG + Intronic
1151295120 17:73179626-73179648 CAGGGTGGATGGAGCAGAGCCGG + Intergenic
1151487554 17:74410744-74410766 CAGGGTGGCTGGGGTAGAGTGGG + Intergenic
1151941912 17:77297999-77298021 CAGAGGGGCTGCAGTAGAGCAGG + Intronic
1152037674 17:77883401-77883423 CGGAGGTCCTGGAGTAGAGTGGG - Intergenic
1152277038 17:79363911-79363933 CAGGGTGGCTGGAGTGGAGTGGG - Intronic
1153280708 18:3411738-3411760 CAGCGTGGCTGGGGCGGAGTAGG - Intronic
1153622606 18:6993506-6993528 CAGAGGGGCTGGAATAGTTTGGG - Intronic
1153827904 18:8893662-8893684 CTGTGTGGCTGGAGGAGAGGAGG + Intergenic
1154935939 18:21056792-21056814 CAGTGTGGCTGGAGAGGATTAGG - Intronic
1154971744 18:21416651-21416673 CAGCCAGGCTGGAGTACAGTGGG - Intronic
1155674102 18:28408702-28408724 TGGTGTGGCTGGAGTAGACTAGG - Intergenic
1155939833 18:31792134-31792156 CAGAGTGGAAGCATTAGAGTGGG - Intergenic
1155996060 18:32332635-32332657 CAGGGAGGCTGAAGGAGAGTGGG - Intronic
1156463758 18:37335986-37336008 ATGAATGGCTGGAATAGAGTTGG - Intronic
1156773524 18:40759294-40759316 AAGACTGGCTGGAGGAGGGTAGG - Intergenic
1157307576 18:46528356-46528378 CAGACTGGGAGGAGTAGAGGCGG + Intronic
1157723658 18:49945714-49945736 GAGAGTGGCAGGAGCAGAATGGG + Intronic
1157845465 18:51000125-51000147 CAGAGTGGCTGGAACAAAGCTGG + Intronic
1158253439 18:55516782-55516804 GAGTGTGGCTGGTGTAGAGTGGG + Intronic
1158662451 18:59400917-59400939 CCCAGTGGCTGGAGCAGAGCTGG + Intergenic
1158889331 18:61858561-61858583 TGGAGGGGCTGCAGTAGAGTTGG - Intronic
1158961685 18:62592995-62593017 TAGAGTGGCTGGATTATAGTAGG - Intergenic
1159065008 18:63559928-63559950 CATTGTGGGTGGAATAGAGTGGG + Intronic
1159590628 18:70331710-70331732 CAGATTGGATGGAGAAGTGTTGG + Intergenic
1159904365 18:74076827-74076849 CAGTGTGGCTGGAGCACAGATGG - Intronic
1161606811 19:5219645-5219667 GAGAGTGGCTGGAGCAGAGAAGG - Intronic
1161638813 19:5406803-5406825 CAGTGTGGCTGGAGCAGAATGGG - Intergenic
1162087845 19:8259362-8259384 CTGTGTGGCTGGAGCAGAGTGGG + Intronic
1162378394 19:10318059-10318081 CAGAGTGGATGGAGGACAATAGG + Intronic
1162487634 19:10971232-10971254 CAGTGTGGCTGGAGCAGGGAAGG - Intronic
1163068353 19:14816406-14816428 CAGTGTGGCTAGAATAGAGCAGG + Intronic
1163663092 19:18589963-18589985 CAGAGTGGGTGGAGCATTGTTGG - Intronic
1164695640 19:30241594-30241616 CAGTGTGGCTGGAGTAAAAAAGG + Intronic
1164759124 19:30715063-30715085 CAGAGTGGCGAGAGGAGAGTTGG + Intergenic
1165387220 19:35517630-35517652 CATTGTGGCTGGAGCAGTGTTGG + Intergenic
1165891235 19:39113502-39113524 CAGTGTGGCTGCAGCAGAGTGGG - Intergenic
1165984467 19:39755925-39755947 CACTGTGTCTGGAGTAGAGGGGG - Intergenic
1165995338 19:39839941-39839963 CAGGGTGGCTGGAGGACACTTGG + Intronic
1166211098 19:41306927-41306949 CTGAGGGGCTGGAGCAGGGTTGG - Exonic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
1166268138 19:41697353-41697375 CAGAGTGGCTGGAGCAGAGAGGG - Intronic
1166280359 19:41788480-41788502 CAAAGTGGCAGGAGTGGAGGGGG - Intergenic
1166328896 19:42067543-42067565 GAGAGAGGCAGGAGTGGAGTGGG + Intronic
1166552079 19:43672505-43672527 CAGTGTGGCTGGAACAGATTAGG + Intergenic
1166729375 19:45050121-45050143 CTGTGTGCCTGGAGCAGAGTAGG + Intronic
1167708578 19:51096859-51096881 CAGTGTGGCGGGAACAGAGTGGG - Intergenic
1168032114 19:53688795-53688817 CACCCAGGCTGGAGTAGAGTGGG + Intergenic
1168073562 19:53965980-53966002 CAGCGTGGCCGGGGCAGAGTGGG + Intronic
1168309706 19:55454343-55454365 CACAGTGGCTGGCACAGAGTGGG + Intronic
926004881 2:9365933-9365955 CAGACTGGATGGAGGAGAGGAGG - Intronic
926328774 2:11807954-11807976 CAGAGTCGCTGGATTAGAGCAGG - Intronic
926351737 2:12001696-12001718 TAGAGTGAATGGAGAAGAGTAGG + Intergenic
926381437 2:12294497-12294519 CAGAGTGACCGGAGGTGAGTGGG + Intergenic
926739571 2:16100172-16100194 GAGAGAGGCTGCAGAAGAGTTGG + Intergenic
926892552 2:17650533-17650555 CAGAGTGGCTGGTGCAGGGGTGG - Intronic
926964660 2:18396634-18396656 CAGAATGGCTGGAGGAGCGGAGG + Intergenic
927388233 2:22561490-22561512 CACAGTGCCTGGTGCAGAGTAGG - Intergenic
928225879 2:29447653-29447675 GAGAGTGGCTGGGGGAGAGGTGG + Intronic
929545765 2:42854520-42854542 CTGGGTGGCTGGAGTAGGCTAGG + Intergenic
930511411 2:52349913-52349935 CAGTGTGGCTGCAACAGAGTGGG - Intergenic
930889035 2:56361666-56361688 CAATGTGGCTGGAACAGAGTGGG + Intronic
931109305 2:59092739-59092761 GAGAGTGGGTGCAGTACAGTGGG - Intergenic
931966779 2:67543989-67544011 CTGAGTGGCTGGAATAGTGGGGG + Intergenic
931975291 2:67637578-67637600 GAAAGTGGCTAGAGGAGAGTAGG - Intergenic
932176172 2:69604784-69604806 CAGAGAGGCTGGGGTGCAGTTGG - Intronic
932263182 2:70344045-70344067 CAGAGTGGCTGCAGCTGAGATGG + Intergenic
932397781 2:71459986-71460008 CAGTGGGGCTGGAGTAGCCTGGG + Intronic
932561491 2:72875178-72875200 CAGTGTGGCTGGAATAAAGCAGG - Intergenic
933699454 2:85244148-85244170 CAGAGTGGCTGGAGCAGAGTGGG + Intronic
935760581 2:106316888-106316910 CAGGGTGCCTGGAATATAGTAGG + Intergenic
935793454 2:106615522-106615544 CAGAGTGGCAGGAGTGGATTTGG + Intergenic
935800300 2:106689137-106689159 CTGTGTGGCTGGATTAGTGTGGG + Intergenic
936064466 2:109319969-109319991 CAGAGTGGGTGATGGAGAGTGGG + Intronic
936471385 2:112801822-112801844 AGGAGTGGTTGGAGAAGAGTTGG - Intergenic
936985364 2:118307169-118307191 TAGAGTGTCTGGAACAGAGTGGG + Intergenic
937018500 2:118629242-118629264 CAGAGTGACTGGTATAGAGGAGG - Intergenic
937321912 2:120966177-120966199 CAGAGTGGCTACAGTTGAGATGG - Intronic
937348548 2:121143707-121143729 CAGTGAGGCTGGAGCAGAGAGGG + Intergenic
937349878 2:121153988-121154010 CAGAGAGGGTGGAGGAGAGGCGG - Intergenic
937466169 2:122134967-122134989 CATAGTGGCTGGAGCTGAGTGGG + Intergenic
938262804 2:129907313-129907335 CACAGTGGCTGGAGATGAGAGGG + Intergenic
938798842 2:134741296-134741318 CAGGGTGGCTGGAGTATGGTGGG + Intergenic
939474842 2:142674055-142674077 CAGATTGTCTGGAGTAGATGTGG - Intergenic
939769213 2:146293737-146293759 CAGAGTGGGCAGAGTAGAGTGGG + Intergenic
941052118 2:160746840-160746862 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
941264386 2:163341754-163341776 AAGAGTGGTTGGAGCAAAGTTGG + Intergenic
941294197 2:163715507-163715529 CAGAGCGGCTGGAGTGAAGCAGG - Intronic
941422528 2:165300671-165300693 CTGAGTGGCTGGAGCAGAGTGGG + Intronic
941790003 2:169541860-169541882 CAGTGTGGCAGGAGTAGATGAGG - Intronic
942188121 2:173444108-173444130 AAGAGTGGGTGGAGCAGAGATGG - Intergenic
942206992 2:173629097-173629119 CAGTGTGGCTGGATATGAGTGGG + Intergenic
942308903 2:174635433-174635455 TAGAGAGGCTGGAGGAGAGCTGG + Intronic
943183418 2:184574315-184574337 CAGAGTGGCTAGAATAAAGCAGG - Intergenic
943731776 2:191309619-191309641 CAGCGTGGCTGGGGAAGAGAGGG - Intronic
944136636 2:196406680-196406702 CAGAGTGGCTGGAGCATGGCGGG - Intronic
944230909 2:197391411-197391433 CACAGTGGCTGGCATACAGTGGG + Exonic
944406004 2:199384426-199384448 CTACCTGGCTGGAGTAGAGTGGG - Intronic
944486996 2:200217426-200217448 CTGTGTGCCTGGAGTAGAGGTGG - Intergenic
944973987 2:205026297-205026319 CAGGGTGGCTGCAGTGTAGTGGG + Intronic
945712483 2:213316162-213316184 CAGAGTGGCTGGAGTAATCAAGG - Intronic
945912184 2:215661931-215661953 AAGATTGGCTGAAGTAGAGAAGG - Intergenic
946513104 2:220381703-220381725 CAGAGTAGTTGGAGTAGCATTGG + Intergenic
946643454 2:221808472-221808494 CGGAGTGGGTAGAGTAGAGAAGG + Intergenic
947275101 2:228381894-228381916 CAGTGTGGCTAGAGCAGAGTGGG + Intergenic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
1168832393 20:853733-853755 CAGCATGGCTGCAGCAGAGTAGG - Intronic
1168857432 20:1018584-1018606 CAGTGGGGCTGGAAAAGAGTGGG - Intergenic
1168962796 20:1880463-1880485 CAGTGTGGCTGAAGCAGAGTGGG + Intergenic
1169005526 20:2204144-2204166 CAGTGTGGCTGGAATGAAGTGGG - Intergenic
1169088835 20:2844836-2844858 CAGTGTGGCTGGAGTGCTGTAGG + Intronic
1169162814 20:3396712-3396734 CGGTATGGCTGGAGCAGAGTAGG + Intronic
1169275336 20:4229970-4229992 CAATGTGGCTGGAACAGAGTAGG - Intronic
1170199407 20:13726344-13726366 CAGTGTGGCTGGAGCATTGTCGG - Intronic
1170590281 20:17766137-17766159 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1172391459 20:34568058-34568080 CAGAGTGCCTGGTGAATAGTAGG + Intronic
1173008094 20:39156597-39156619 CAGAGTGGCTGGAGTTGAACAGG + Intergenic
1173229168 20:41180798-41180820 CAGAGTGGCTGGAGGAAAAGTGG - Exonic
1173747088 20:45445971-45445993 CAGTGTGGCTGGGGCTGAGTGGG + Intergenic
1173802023 20:45899853-45899875 CAGAATGGTTGGAATAGATTCGG + Exonic
1173970524 20:47148802-47148824 CAGAGTGAGTGCAGTAGAGTGGG - Intronic
1174156339 20:48517908-48517930 TGGAGTGGTTGGAGTAGATTTGG - Intergenic
1174159729 20:48542249-48542271 CAGAGTGCCTGGTGCATAGTAGG - Intergenic
1174288394 20:49488846-49488868 CAGTGTGGCTGAAATAGAGCAGG + Intergenic
1174299260 20:49569570-49569592 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
1174308524 20:49632236-49632258 CAGCGTGGCTGGAGTAGAGGGGG - Intergenic
1174392297 20:50225194-50225216 CCATGTGGCTGGAGTAGAATGGG + Intergenic
1174403845 20:50291292-50291314 CAGAGTGGCTGGTGGGGAGGTGG + Intergenic
1174514839 20:51083705-51083727 CAGTGTGGCTGGCAGAGAGTGGG + Intergenic
1174727249 20:52876078-52876100 CAGTGTGGTTGGAGTAGGGATGG + Intergenic
1174770788 20:53298182-53298204 CAGAGTACCTGGCGTATAGTGGG - Intronic
1175572136 20:60031674-60031696 CAGAGAGGCTGGGAGAGAGTTGG + Intronic
1175985810 20:62763725-62763747 CAGAGTGGCTGGAGAGGAGAAGG + Intergenic
1177538294 21:22458430-22458452 CAGAGTGGCTAGAATAAAGCAGG + Intergenic
1178097805 21:29234551-29234573 AGGGGTGGCTGGAGAAGAGTTGG - Intronic
1180721592 22:17913196-17913218 CAGAGTGGCAGGAGCAGATGAGG - Intronic
1180780819 22:18518458-18518480 GAGAGTGAATGGAGTAGGGTGGG + Intergenic
1180813532 22:18775765-18775787 GAGAGTGAATGGAGTAGGGTGGG + Intergenic
1180908054 22:19429781-19429803 AAGAGAGGCTGGAGAAGGGTAGG + Intronic
1181199716 22:21210095-21210117 GAGAGTGAATGGAGTAGGGTGGG + Intronic
1181733214 22:24862626-24862648 CACAGTGGCTGGCACAGAGTAGG - Intronic
1181842654 22:25677248-25677270 CAGAGTAGCTGGAGCATAGCTGG - Intronic
1181967350 22:26666508-26666530 CAGTGTGGCAGGAGCAGAGCTGG + Intergenic
1182053018 22:27327714-27327736 CAGTGGAGCTGGAGTAGGGTGGG + Intergenic
1182087394 22:27570738-27570760 CAGCGTGGCTGGAGTGGAGTGGG - Intergenic
1182219814 22:28749245-28749267 CATTGTGGCTGGAGTGGAGAAGG - Intronic
1182269986 22:29147371-29147393 CAGAGTGCCTGGCGCAGAGTGGG - Intronic
1182369175 22:29799009-29799031 CAGAGTGGCTGGCATTGAGGTGG - Intronic
1183165528 22:36144539-36144561 CAGAGAGGCTGGAATGGAGTTGG - Intronic
1183171931 22:36194707-36194729 CAGAGAGGCTGGAATGGAGTTGG - Intronic
1183706801 22:39479296-39479318 CAGGCAGGCTGGAGTACAGTGGG - Intronic
1183752120 22:39727368-39727390 CACAGGGGCTGGCATAGAGTGGG - Intergenic
1183757681 22:39785278-39785300 CAGAGTGGCTGATGTGGAATGGG - Intronic
1183757824 22:39786441-39786463 CAGAGTGGCTGACGTGGAATGGG + Intronic
1183840540 22:40496895-40496917 AGGAGTGGCTGGAGTAGACAAGG + Intronic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1185011875 22:48319105-48319127 CTGAATGGCTGGAGTGGAGGTGG - Intergenic
1185336437 22:50272694-50272716 CAGAGTGGTGGGAGGAGAGGTGG - Intergenic
1203227119 22_KI270731v1_random:84824-84846 GAGAGTGAATGGAGTAGGGTGGG - Intergenic
1203263632 22_KI270734v1_random:1447-1469 GAGAGTGAATGGAGTAGGGTGGG + Intergenic
949357814 3:3200457-3200479 ATGAATGGCTGGAGTAGAGAAGG + Intergenic
949600904 3:5596807-5596829 CAGAGTGGGTGCAGGACAGTGGG - Intergenic
949700243 3:6747926-6747948 CAAAGTGGTTTCAGTAGAGTGGG - Intergenic
950129637 3:10533360-10533382 CAGAGTAGCTGGAACATAGTAGG - Intronic
950129852 3:10534491-10534513 CAGAGTAGCTGGAATGTAGTAGG - Intronic
950284760 3:11735906-11735928 CAGCGTGGCTGCAGTGGGGTTGG + Intergenic
951396245 3:22171033-22171055 CTGAGTGGCAAGATTAGAGTTGG + Intronic
951465907 3:23000321-23000343 CAGAGTGGCAGCAAGAGAGTTGG - Intergenic
952811355 3:37406702-37406724 CAGAATGGTTTGAGTAGAATTGG + Intronic
953154198 3:40354030-40354052 CAGGGTGGGAGGAGTAGAGGTGG - Intergenic
953399761 3:42602465-42602487 CAGTGTGGCTGGAGTAGAAGAGG + Intronic
953447622 3:42981018-42981040 CAGAGTGCCTGGAGGAGAGATGG + Intronic
953576973 3:44120734-44120756 CAGTGGGGCTGGGGCAGAGTGGG - Intergenic
954109149 3:48424574-48424596 CAGAGAGCCTGGAGAAGAGCTGG + Exonic
954222374 3:49162635-49162657 CAGAGTGGGTGGGGTACGGTGGG - Exonic
955503825 3:59611381-59611403 CAGTGTGGCTGGAACACAGTGGG + Intergenic
955829596 3:62986932-62986954 CAGTGGGGCTGGGGCAGAGTGGG - Intergenic
955961579 3:64346317-64346339 CGGTGTGGCTGGAGCACAGTGGG + Intronic
956108373 3:65845492-65845514 CACAGTGTCTGGAACAGAGTAGG + Intronic
956682096 3:71790439-71790461 CAGTGTGGCAGGAGCAGAGCTGG - Intergenic
957064533 3:75510608-75510630 CAGAGTGGCTGAAATAGAGTAGG - Intergenic
957073850 3:75585966-75585988 TAGTCTGGCTGGAGGAGAGTGGG + Intergenic
957151888 3:76497066-76497088 CATTGTGGCTGGAGTGCAGTGGG - Intronic
958177166 3:90011323-90011345 GAGAGTGGCTGGTGTACAGCTGG - Intergenic
958190339 3:90176245-90176267 CTAAGTGGCTGGAGTATAGCTGG - Intergenic
958809626 3:98845741-98845763 CAGAGTAGCTGAAGTAGATTGGG - Intronic
959464803 3:106672026-106672048 CAGAGTGGTTTGAGAAGAATTGG - Intergenic
959824066 3:110771832-110771854 CAGTGTGGCTGCAGCAGAGCTGG - Intergenic
960430546 3:117563310-117563332 CAGTCTGGCTGGAGTGCAGTAGG + Intergenic
960444896 3:117735855-117735877 CAGTGTGACTGGACTAGAATGGG - Intergenic
960676314 3:120198802-120198824 CTGTGTGGCTGGAGTGGAGTGGG - Intronic
960834941 3:121896518-121896540 GAGGGTGGGTGGAGGAGAGTAGG - Intronic
961280237 3:125760754-125760776 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
961288821 3:125828792-125828814 CAGAGTGGCTGAAATAGAGTAGG + Intergenic
961874169 3:130008793-130008815 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
961898249 3:130187234-130187256 CAGAGTGGCTGAAATAGAGTAGG - Intergenic
961993147 3:131213736-131213758 CAGATTGGCAGGACTGGAGTAGG - Intronic
962449493 3:135500792-135500814 CAGTGTGGCTAGAGTACAGCAGG + Intergenic
962514555 3:136138255-136138277 CACAGTGCCTGGCATAGAGTAGG - Intronic
963948876 3:151176953-151176975 CACGGTGCCTGGTGTAGAGTAGG - Intronic
964550108 3:157876177-157876199 CAGAGTAGCTGGACTGGAGTGGG - Intergenic
964626155 3:158762044-158762066 CAGAGTGGCAGGAGCAGGATGGG + Intronic
964682867 3:159361712-159361734 CACAGTGGGAGGAGAAGAGTTGG + Intronic
964764140 3:160162256-160162278 CATAGAGGCTGGGGAAGAGTGGG + Intergenic
966594129 3:181711407-181711429 CAGAGGGGCTGGAGTTGGGGGGG + Intergenic
966891429 3:184410147-184410169 CACTGTGGCTGGAGTGCAGTGGG - Intronic
967264011 3:187674186-187674208 CAGAGTGGTTAAAGTAGAGAGGG + Intergenic
967706031 3:192652036-192652058 CAGAGTGTCTGGCATAGAGTAGG - Intronic
967815663 3:193796168-193796190 CAGCGTGGCTGGAGTAAAGAGGG - Intergenic
967852997 3:194096099-194096121 CACAGTGACTGGAATATAGTAGG - Intergenic
967877223 3:194275695-194275717 CAGAGTGGCAGGGGTGGGGTGGG + Intergenic
967912316 3:194552516-194552538 CAGAGTGGCCGCAGCAGAGTGGG - Intergenic
967943846 3:194786905-194786927 CAGAGGGGCGGCAGTAGAGAGGG + Intergenic
968554048 4:1238393-1238415 CACAGTGGGTGGCGTGGAGTGGG - Intronic
968862637 4:3184809-3184831 CAGACTGGCTGGAGAGGAGGAGG + Intronic
969008434 4:4040699-4040721 CATAGTGGCTGAAATAGAGTAGG - Intergenic
969017434 4:4113276-4113298 CAGCCTGGCTGGAGGAGAGTGGG + Intergenic
969736512 4:8995029-8995051 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
969745245 4:9065681-9065703 CATAGTGGCTGAAATAGAGTAGG + Intergenic
969795703 4:9526592-9526614 AAGTCTGGCTGGAGGAGAGTGGG - Intergenic
969804535 4:9596694-9596716 CAGAGTGTCCGAAATAGAGTAGG + Intergenic
969982566 4:11173225-11173247 CAGTGTGGCTGGAATAAAGCAGG + Intergenic
970159103 4:13171332-13171354 CAGTGTGGCTGGTGCAGAGAGGG - Intergenic
970301539 4:14686227-14686249 CAGTATGGCAGGAGTAGAGCAGG + Intergenic
970653263 4:18201340-18201362 GATAGTGCCTGGAATAGAGTAGG + Intergenic
972292822 4:37705778-37705800 CTGAGTGACTGGAATAGAGAAGG - Intergenic
972317050 4:37936495-37936517 CAGAGTGCCTGGAATAGTCTAGG + Intronic
972396132 4:38661367-38661389 CAGCGTTGCTGGAAAAGAGTAGG + Intergenic
972561698 4:40234494-40234516 CAGAGTTGCTGGACCAGAGGAGG + Intronic
972810038 4:42573772-42573794 CAGAGTGAGTGGGGAAGAGTGGG + Intronic
973832616 4:54776916-54776938 GAGTGTGGCTGGAATAGAGTGGG + Intergenic
975302777 4:72810745-72810767 CAGGGTGGTTTGAGTAGGGTAGG - Intergenic
975845193 4:78517698-78517720 CAGTGTGCCTGGTGTAGAATAGG + Intronic
976528242 4:86118381-86118403 CAGTGTGGCTGGAGAATTGTTGG - Intronic
976763613 4:88576417-88576439 CAGCATGGCTGGAGCAGAGTGGG - Intronic
977203960 4:94148991-94149013 CAGAGTGGCAAGAATAGAGCAGG + Intergenic
977449055 4:97171218-97171240 CAGTGTGGCTAGAATAAAGTAGG - Intergenic
977679642 4:99784960-99784982 TAGTGTGGCTGGAGCAGAGCAGG - Intergenic
978175110 4:105720656-105720678 CAGAGTCCATGGAGTTGAGTGGG + Intronic
978871925 4:113589111-113589133 CAGTGTGGCTGGGGCTGAGTGGG + Intronic
979443009 4:120774657-120774679 CAGTGTGGCTGGGGTTGTGTTGG - Intronic
980204903 4:129705094-129705116 GAGAGTGTCTGGAGCATAGTAGG + Intergenic
980853334 4:138410472-138410494 CAGAGTGACTGGAGCAGTGTGGG - Intergenic
981144124 4:141305089-141305111 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
983420806 4:167513597-167513619 CAGAGTGCCTGGCACAGAGTAGG + Intergenic
983453693 4:167936543-167936565 CAGATTGGCTGGAGTCTGGTTGG + Intergenic
984285290 4:177721135-177721157 CATAATGGCTGGTGTATAGTAGG + Intergenic
985910896 5:2881322-2881344 GAGAGTGGAGGGAGGAGAGTGGG + Intergenic
986287715 5:6372328-6372350 CCGAGGGGCTGGAGGAGAGGCGG - Exonic
986475137 5:8121960-8121982 CATAGTGCTTGGAGTAGAATAGG + Intergenic
988083167 5:26438628-26438650 CAGAATAGTTGGAGTAGAATTGG - Intergenic
988227547 5:28431511-28431533 CAGAGTGAATGGTGTAGAATGGG + Intergenic
988236607 5:28553580-28553602 CAGAATAGCTGAAGTAGAATTGG + Intergenic
988607979 5:32697543-32697565 CAGAGTAGTTTGAGTAGAATTGG + Intronic
988650837 5:33148893-33148915 CAGAATAACTGGAGTATAGTAGG + Intergenic
990365414 5:55065697-55065719 CACAGTGGGTGGAGGGGAGTAGG - Intergenic
990399455 5:55423464-55423486 CAGTGTGGCTGGAGCAGAATGGG + Intronic
990670399 5:58123139-58123161 CAGGGCAGCTGCAGTAGAGTTGG - Intergenic
990801826 5:59612870-59612892 CAGAGTGACTGGACCAGAGGAGG + Intronic
991260507 5:64662626-64662648 CAGAGTGCCTACAGCAGAGTGGG - Intergenic
991442298 5:66663661-66663683 CACTGTAGCTGGAATAGAGTGGG + Intronic
991682745 5:69154752-69154774 CAGTGTGGCTAGAGTATAGAGGG - Intergenic
991982833 5:72251198-72251220 CAGAGGGGATGGAATACAGTAGG + Intronic
992681088 5:79153812-79153834 CAACATGGCTGGAGTAGAGAGGG + Intronic
992879969 5:81098055-81098077 CAGCATGGCAGGAGTGGAGTTGG + Intronic
993393952 5:87358754-87358776 AAGAGTGGCAGGAGGATAGTAGG - Intronic
993816995 5:92561017-92561039 CAGAGGGGCTGCAGTAAACTTGG + Intergenic
993830392 5:92749910-92749932 GAGAGTGGCTATAGTAGAGAAGG - Intergenic
995848494 5:116520090-116520112 CACAGGGGCTGGAACAGAGTGGG - Intronic
996036051 5:118759914-118759936 CAGTGTGGCTAGAGTAAAGCAGG - Intergenic
997198005 5:131992444-131992466 CAGAGTGGCTGCACCGGAGTAGG - Intronic
997453396 5:134001222-134001244 CAGCCTGGCAGGAGTGGAGTTGG - Intronic
998250994 5:140552315-140552337 CATATTGTCTGGCGTAGAGTGGG - Intronic
998391491 5:141789735-141789757 CAGAGTGGCTGGTGTGGACTTGG - Intergenic
998915864 5:147010846-147010868 CAGGGTGGCAGCTGTAGAGTAGG - Intronic
998921336 5:147071506-147071528 CAGTGTGTCTGAAGTTGAGTAGG - Intronic
999143419 5:149377666-149377688 GGGTGTGGCTGGAGAAGAGTGGG + Intronic
999251655 5:150185951-150185973 CAGAGTGTGTGGAGTTCAGTGGG - Intergenic
999538883 5:152549977-152549999 CAGTGTGGCTGGAGTAAAATGGG - Intergenic
999970836 5:156860760-156860782 GATGGTGGCTGGAGGAGAGTCGG - Intergenic
1000089663 5:157919358-157919380 CAGAGTGTCTAGTGTATAGTAGG + Intergenic
1000326662 5:160177527-160177549 CAGTGTGGCTGGATCAGAGGAGG - Intergenic
1000380114 5:160621344-160621366 CAGTGTGTAGGGAGTAGAGTTGG + Intronic
1001248590 5:170125593-170125615 CAAAGTGCTTGGAGAAGAGTAGG + Intergenic
1001403381 5:171459767-171459789 CAGAACGGCTGGAACAGAGTGGG + Intergenic
1001975245 5:175993497-175993519 CAGTGTGGCTTGAGTGGAGTGGG - Intronic
1002242186 5:177850273-177850295 CAGTGTGGCTTGAGTGGAGTGGG + Intergenic
1002457990 5:179356551-179356573 CAGAGGGGCTGGAGAAGCGGAGG - Intergenic
1002872526 6:1179669-1179691 CAGTGTGGCTGGAGCAGGGGAGG - Intergenic
1003257256 6:4485308-4485330 CACTGTGGCTGGGGCAGAGTGGG - Intergenic
1003530154 6:6930360-6930382 CAGTCTGGCTGGGGCAGAGTAGG + Intergenic
1003708472 6:8562107-8562129 CCATGTGGCTGGAGTAGAGGAGG - Intergenic
1004817633 6:19329880-19329902 CAGTGTGGCTGAAGTAGAGTGGG + Intergenic
1004999417 6:21225528-21225550 CAGAGTGCCTGGAATACAGAAGG - Intronic
1005123041 6:22412308-22412330 CACAGAGGCTGGTGTAAAGTTGG - Intergenic
1005294582 6:24412941-24412963 CAGAGTGGGAGGAGGAGAGAGGG + Intronic
1006448710 6:34093608-34093630 CTGTGTGGCTGGAGCAGAGCAGG + Intronic
1006578039 6:35060174-35060196 GGGAGTGGCTGGAGTCGATTGGG + Exonic
1006756710 6:36422599-36422621 CACAGTGCCTGGAATATAGTAGG + Intronic
1006811117 6:36821237-36821259 CCGTGTGACTGGAGTGGAGTGGG + Intronic
1007452885 6:41953599-41953621 CAGAGAGGCTGGAGTGGTGAAGG - Intronic
1007762395 6:44140693-44140715 CACAGTGGCTGGCATGGAGTAGG - Intronic
1007821724 6:44565289-44565311 CAGGGTGGAGGGAGTAGACTTGG - Intergenic
1010790327 6:80056515-80056537 CACAGTGACTGGAGTATACTTGG + Intergenic
1010850296 6:80767452-80767474 CACAGTGTCTGGAGGACAGTAGG - Intergenic
1012553210 6:100483027-100483049 AAGAGTGGCTGGAGTAGGCATGG + Intergenic
1013469577 6:110449925-110449947 CAGTGTGGCAGAAGTAGAGAAGG - Intronic
1013473349 6:110485730-110485752 CAGTGTGGCTGGAGTGGAGCAGG - Intergenic
1014007870 6:116442202-116442224 CAGTGTGGCTAGAGCAGAGTGGG + Intergenic
1014389306 6:120841275-120841297 CAGAGTGGCTAGAATAAAGCAGG + Intergenic
1014857530 6:126420237-126420259 CAGAGTGGCTGGATGTGAGATGG + Intergenic
1015540111 6:134305317-134305339 CAGGCTGGCTGGAGTGCAGTGGG - Intronic
1015609769 6:135004156-135004178 CATAGTGCCTGGTGTATAGTAGG - Intronic
1016056361 6:139581709-139581731 CCCAGTGGCTGGAACAGAGTAGG - Intergenic
1016873781 6:148844557-148844579 CTGAGTGGCTGGAGCAGACAGGG - Intronic
1016920625 6:149289591-149289613 CCCAGTGGCTGGAGTGGACTGGG - Intronic
1017889608 6:158627673-158627695 CAGCGTGGCTGGAGATGAGCAGG + Intronic
1018441719 6:163820061-163820083 CAGTGTGGCTGGAATAGCGGAGG - Intergenic
1018940959 6:168308633-168308655 CAGGGTGGCTGGAGTACAGACGG - Exonic
1019485289 7:1286354-1286376 CAACGTGGCCGGAGTGGAGTGGG + Intergenic
1019848144 7:3527521-3527543 CAGAGTGCCTGGATGATAGTTGG + Intronic
1019922431 7:4171607-4171629 TAGAGAGGCTGGAGCAGAGCCGG + Intronic
1020328901 7:6998491-6998513 CATAGTGGCTGAAATAGAGTAGG - Intergenic
1020988269 7:15163419-15163441 CATATTGGATGGAGAAGAGTTGG - Intergenic
1021632968 7:22664911-22664933 CAGAGGGGCAGGAGTTGAGGGGG + Intergenic
1022201658 7:28123106-28123128 CAGTGTGGCTAGAGGAGAGAGGG - Intronic
1022757655 7:33310845-33310867 CACAGTGGCTGGCATAGAGAAGG - Intronic
1023170342 7:37385340-37385362 CAGTGTGGCTGGAGGGGAGGGGG - Intronic
1024225815 7:47326186-47326208 CAGAGTGCCTGGTGTATAGTAGG - Intronic
1027226329 7:76246151-76246173 CACAGTGCCTGGCTTAGAGTAGG - Intronic
1027309341 7:76937867-76937889 CTGCGTGGCTGGAGCAGAGTAGG - Intergenic
1027624084 7:80526956-80526978 CTGGGTGTCTGGGGTAGAGTGGG + Intronic
1027828299 7:83145204-83145226 CAGAGTGGCCTGCTTAGAGTAGG + Intronic
1029015490 7:97311625-97311647 CAGAGTGGCTAGAGAAGGGTAGG + Intergenic
1029017062 7:97325832-97325854 GAGAGCGGATGGAGTAGGGTGGG + Intergenic
1029075926 7:97934106-97934128 CAGTCTGACTGGAGGAGAGTGGG + Intergenic
1029482800 7:100823366-100823388 CAGTGTGGCTGGAGCACAGTGGG + Intronic
1029796098 7:102896082-102896104 CAGAGTGGCTGGAGTAGAGTTGG + Intronic
1029959554 7:104675298-104675320 CAGAGAGGCTGGAGCAGAGTGGG + Intronic
1030318501 7:108140691-108140713 CAATGTGGCTAGAGCAGAGTGGG + Intergenic
1031895623 7:127345597-127345619 CAGTGTGGCTGCATTCGAGTGGG + Intergenic
1032411603 7:131697571-131697593 CAGTGTGGCTGAAGTGGAGTAGG + Intergenic
1032626310 7:133595078-133595100 CAGTGTGGATGGAGGAGTGTAGG + Intronic
1033540339 7:142350169-142350191 CAACATGGCTGGAGTAGAGAAGG - Intergenic
1034931269 7:155165826-155165848 CACAGTGGCTGGAGTCGAGGGGG + Intergenic
1035101788 7:156403686-156403708 TTGATTGGCTGGAGGAGAGTGGG - Intergenic
1035353578 7:158264001-158264023 GAGAGTGGCAGGGGTAGAGTTGG - Intronic
1036084653 8:5600253-5600275 CACAATGGCTGGAATGGAGTAGG - Intergenic
1036241594 8:7086233-7086255 CAGTCTGGCTGAAGGAGAGTGGG - Intergenic
1036249722 8:7151381-7151403 CATAGCGGCTGAAATAGAGTAGG - Intergenic
1036260244 8:7233884-7233906 TAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1036306373 8:7605639-7605661 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1036312281 8:7692440-7692462 TAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1036357219 8:8053624-8053646 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1036367731 8:8135666-8135688 CATAGTGGCTGAAATAGAGTAGG + Intergenic
1036702314 8:11020929-11020951 CATAGTGGCTGGCACAGAGTAGG + Intronic
1036831141 8:12020844-12020866 CAGCCTGGCTGGAGGAGAGTGGG + Intergenic
1036883150 8:12529995-12530017 CATAGTGGCTGAAATAGAGTAGG - Intergenic
1036901350 8:12671629-12671651 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1037162867 8:15793937-15793959 CAGTGTGGCTAGAGCAAAGTGGG + Intergenic
1037620348 8:20558160-20558182 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
1037631531 8:20661070-20661092 GAGAGTGGCAGCAGAAGAGTTGG - Intergenic
1037676563 8:21056117-21056139 CAGAGTGGCTGGCACATAGTAGG + Intergenic
1037951894 8:23023996-23024018 CAGAGAGGATGAGGTAGAGTGGG + Intronic
1038053570 8:23836611-23836633 CATAGTGGGAGGGGTAGAGTAGG + Intergenic
1038893316 8:31752295-31752317 CAGAGTGACTGGAGCTAAGTGGG + Intronic
1038906498 8:31909892-31909914 AAGAGTGGCTAGAGTGGATTAGG - Intronic
1039567334 8:38560718-38560740 AAGAGTAGCTGGAGCAGAATGGG - Intergenic
1039749691 8:40465910-40465932 AACAGTGGCTGGAATATAGTAGG - Intergenic
1039828706 8:41195693-41195715 CAGAGTGCCTGGCATACAGTAGG - Intergenic
1041527419 8:58822856-58822878 CACAGTGGCTGTGGCAGAGTAGG - Intronic
1041618325 8:59934433-59934455 CAGTGTGGCAGGAGCATAGTTGG + Intergenic
1041876780 8:62697283-62697305 CAGCATGGCTGGAACAGAGTAGG - Intronic
1042193395 8:66210863-66210885 CAGAGTGCCTGGAGGAGATTTGG - Intergenic
1042339202 8:67661311-67661333 CATTGTGGCTGGAGTAGAGTAGG + Intronic
1042705709 8:71664134-71664156 CAGTGTGGCTGGAGGAGGGTGGG - Intergenic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1043614023 8:82103355-82103377 CAGTGTGGCTAGAATAAAGTGGG + Intergenic
1043843208 8:85133720-85133742 CAGAGTGGCTGTGTTAGAGGTGG - Intronic
1044141320 8:88657101-88657123 AAGAGTGGGTGAAGAAGAGTTGG + Intergenic
1044804105 8:95987360-95987382 CAAGGTGGCTGGAGTGGAATGGG + Intergenic
1044876515 8:96673067-96673089 TAGAGTGACTGGAGCAGAGAAGG + Intronic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1045249628 8:100472686-100472708 CAGGGTGGATGGAGTTGAGTGGG - Intergenic
1045938503 8:107711025-107711047 CAGAGCAGTTGGAGAAGAGTTGG - Intergenic
1046557067 8:115788084-115788106 CAAAGTGGCTGGTGTAAAGTAGG + Intronic
1046832056 8:118757268-118757290 CAGAGTTGATGGAGTAGAAATGG + Intergenic
1047198837 8:122746469-122746491 CAGAGTGGGAGTCGTAGAGTGGG - Intergenic
1047213280 8:122856973-122856995 CAGGGTGGCTGGAGCCGAGAAGG - Intronic
1047534771 8:125709465-125709487 CAGAGTGCCTGGAGCATAGCAGG - Intergenic
1047536675 8:125726469-125726491 GAGAGTGGCTGGAGGTGAGATGG + Intergenic
1048812487 8:138301604-138301626 CAGAGGGCCTGGGGCAGAGTAGG - Intronic
1049196013 8:141316044-141316066 CAGAGTGCCTGGAGCAGAGCAGG - Intergenic
1049582767 8:143420389-143420411 CAGAGGGGCTGGACTGGAGTCGG - Intronic
1050495012 9:6231349-6231371 TAGTGTGGCTGGAGCAGAGCGGG - Intronic
1050636278 9:7616373-7616395 CAGCGTGGCTAGAATAAAGTGGG - Intergenic
1050944017 9:11495259-11495281 CAGAGTGGCTAGAACAAAGTAGG - Intergenic
1051033114 9:12707545-12707567 AACTGTGGCTGGAGTAGAGTGGG + Intronic
1052758180 9:32563380-32563402 CAGGATGGCTGGAGTACAGTGGG + Intronic
1052827484 9:33187549-33187571 CAGTGTGGCTGGCGCAGAGGAGG - Intergenic
1053121891 9:35553699-35553721 AAGTGTGGCTGGAGCACAGTGGG + Intronic
1053417843 9:37957952-37957974 CAGAGTGACTGGAAGGGAGTTGG + Intronic
1054934370 9:70671016-70671038 CACAGTGCCTGGCATAGAGTCGG - Intronic
1055249585 9:74286988-74287010 CAATGTGGCTGGAGCAGGGTGGG - Intergenic
1056210534 9:84360936-84360958 CACAGTGCCTGGAATATAGTAGG + Intergenic
1056655290 9:88503769-88503791 CAGAGTGCCAGGAGAAGGGTAGG + Intergenic
1057275314 9:93673199-93673221 CAGAGTGGCTGGGGTGCAGGAGG + Intronic
1057834788 9:98435650-98435672 CAGTGTGGCTGGAATAAAGTGGG - Intronic
1057987625 9:99733222-99733244 CAGAGTAGCGGGAGGAGAGTGGG + Intergenic
1057987751 9:99734436-99734458 CAGAGTAGCAGGAGGAGAGTGGG + Intergenic
1059400757 9:114069635-114069657 CAGCGTGCCTGGGGCAGAGTGGG + Intronic
1059591981 9:115671773-115671795 CAGAGTGACAGCAGTAGAGATGG + Intergenic
1059616141 9:115953128-115953150 AAGAGTGACTGGAGAAGTGTTGG - Intergenic
1059877407 9:118650359-118650381 CTGTGTGGCTGGAGTATAATGGG + Intergenic
1060085168 9:120692682-120692704 CTGAGTGGCTCGAGTAGGGGAGG - Intronic
1060463666 9:123883000-123883022 CATTGTGGCTGGAGTTCAGTGGG - Intronic
1060960364 9:127676474-127676496 CAGAGTGGCTGGAGGGGAATCGG + Intronic
1061006644 9:127931813-127931835 CAGAGTGGCTGGAGTGAAGAGGG + Intergenic
1061327663 9:129874060-129874082 CAGAGTGGCGGGAGGAGAGCTGG + Intronic
1061796939 9:133091062-133091084 CAGAGTTGTTGGGGCAGAGTCGG + Intergenic
1062057034 9:134474126-134474148 CAGGGTGACTGCAGCAGAGTGGG + Intergenic
1203399470 Un_KI270519v1:72861-72883 GAGAGTGGGTGCAGTATAGTGGG + Intergenic
1187565253 X:20443286-20443308 CAGAGTGACTGGGGTACAGGGGG + Intergenic
1189244671 X:39554336-39554358 TAGTGTGGCTGGAGCAGAGCGGG + Intergenic
1189351270 X:40277563-40277585 TAGAGTGGCTGGCACAGAGTGGG + Intergenic
1189425642 X:40897462-40897484 TAGAGTGGGTGGAGAAGGGTGGG - Intergenic
1189653641 X:43217658-43217680 CTGTGTTGCTGGATTAGAGTTGG - Intergenic
1190402033 X:50046732-50046754 GAGGGTGGCTTGAGTAGTGTAGG + Intronic
1191123971 X:56934746-56934768 GACAGTGGCTGCAGGAGAGTGGG + Intergenic
1192236588 X:69300048-69300070 CAGAGTGCCTGGCATATAGTAGG + Intergenic
1193127934 X:77889410-77889432 CAGGCTGGCTGGAGTGCAGTGGG + Intronic
1193914504 X:87349430-87349452 CAGAGTGGCTAGAATAATGTAGG - Intergenic
1193940644 X:87677549-87677571 CAGAGTGGCTAGAATAAAGTGGG - Intergenic
1194895630 X:99435893-99435915 CAGAGCGGCTGGAGTAAAACAGG + Intergenic
1194925915 X:99823326-99823348 CATAGTGGCTGGCATATAGTGGG - Intergenic
1195699202 X:107689626-107689648 AAGAGGGGCTAGAGTTGAGTAGG + Intergenic
1195715418 X:107813480-107813502 CAGAGAGACTGGCGAAGAGTTGG + Intergenic
1195920489 X:109978452-109978474 CAGAGTGACTGGAGCAGCTTGGG + Intergenic
1195941207 X:110169394-110169416 CAGTGAGGCTGGAGGAGAGTGGG - Intronic
1196704992 X:118709825-118709847 CTGAGTGACTGGAGTGGAGTGGG - Intergenic
1197181623 X:123542982-123543004 CAGAGTGGTAGCAGTAGAGGTGG + Intergenic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1197979242 X:132198331-132198353 CAGAGTGGTAGGAGCAGATTGGG - Intergenic
1198270989 X:135055872-135055894 CAGAGTGGTTAGAGAAGAGTTGG + Intergenic
1198575298 X:138004175-138004197 CAGTGTGGCTGGAGCATAGAGGG + Intergenic
1198637911 X:138720094-138720116 AATAGTGCCCGGAGTAGAGTTGG - Intronic
1199709247 X:150456857-150456879 AAGAGTGGGTGCAGCAGAGTAGG + Intronic
1201101350 Y:10677668-10677690 CACACTGGCTGGAGTGCAGTGGG + Intergenic
1201519567 Y:14858505-14858527 CAGCCAGGCTGGAGTAGAGTAGG - Intergenic