ID: 1029797225

View in Genome Browser
Species Human (GRCh38)
Location 7:102908965-102908987
Sequence CTGTGTCCTCCTCTTCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 713
Summary {0: 1, 1: 10, 2: 47, 3: 163, 4: 492}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029797214_1029797225 19 Left 1029797214 7:102908923-102908945 CCCTGGGGCTCTACAATCAGCAG 0: 54
1: 179
2: 331
3: 392
4: 456
Right 1029797225 7:102908965-102908987 CTGTGTCCTCCTCTTCAGGGTGG 0: 1
1: 10
2: 47
3: 163
4: 492
1029797215_1029797225 18 Left 1029797215 7:102908924-102908946 CCTGGGGCTCTACAATCAGCAGG 0: 50
1: 188
2: 364
3: 484
4: 820
Right 1029797225 7:102908965-102908987 CTGTGTCCTCCTCTTCAGGGTGG 0: 1
1: 10
2: 47
3: 163
4: 492

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029797225 Original CRISPR CTGTGTCCTCCTCTTCAGGG TGG Intronic
900098013 1:948228-948250 CTCTCTCCTGCTCTTCAGGACGG - Exonic
900372019 1:2336404-2336426 CTGTGGCCTCCTCATCAGCTGGG - Intronic
900820413 1:4882474-4882496 CTCCATCCTCCTCTTCTGGGTGG + Intergenic
901396419 1:8985392-8985414 CACTGTGCTCCTATTCAGGGAGG + Intergenic
901777589 1:11570931-11570953 CTGTGACCTCCGGCTCAGGGTGG - Intergenic
901964966 1:12859114-12859136 CTATCTCCCACTCTTCAGGGAGG + Exonic
902276624 1:15344713-15344735 CTGTTTCCTCCTCTGCAAGGTGG + Intronic
902367824 1:15989153-15989175 CTGTGTGCACCTGTCCAGGGGGG - Intergenic
902788892 1:18751736-18751758 CTCTGTGCTCCTCTCCAAGGTGG + Intergenic
903231079 1:21922714-21922736 CTGTGGCCTCCTAGGCAGGGGGG - Intronic
903317776 1:22522013-22522035 CTGTTTCCTTCTCTCCAGGATGG + Intronic
903332666 1:22603978-22604000 CTGTGTATTCCTCTTCCAGGGGG - Intergenic
903493944 1:23751766-23751788 CTGTCTCCTCAACTTTAGGGAGG - Exonic
903699146 1:25233238-25233260 CTGAGTCCGCCTCTTGGGGGAGG - Intergenic
903732023 1:25503669-25503691 CCCTGTCCTCCTCTGCACGGAGG + Intergenic
903831577 1:26178380-26178402 CTGTGTCAACCTCTTCAGTCTGG - Intronic
904312716 1:29639734-29639756 CTGTGTCCCCATCTCCAGGGAGG - Intergenic
905446810 1:38032945-38032967 CTGTATCCTCCTCTGGTGGGAGG + Intergenic
906059338 1:42938232-42938254 CTCTGTCCTCCTCCTCCAGGAGG + Intronic
906352820 1:45078740-45078762 CTGTGTCCTTCTCTTCAGGATGG + Intronic
906942408 1:50266925-50266947 ATGTCCCCTCTTCTTCAGGGAGG + Intergenic
907158030 1:52352360-52352382 CTGTGGCTTCCTCTTGAGAGAGG - Exonic
909270405 1:73617057-73617079 CTGTGTCCTTCCCTTCAGGGAGG + Intergenic
909316333 1:74223943-74223965 TTGTGTCCTACTTTTCAGGATGG - Intronic
909615777 1:77606417-77606439 TTGTGTCCTTCCCTTCAGGGCGG - Intronic
910384544 1:86666488-86666510 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
910470341 1:87546526-87546548 TTTTGTCCTTCTCTTTAGGGAGG + Intergenic
910515303 1:88053993-88054015 TTGTGTCCATCCCTTCAGGGTGG + Intergenic
910596197 1:88983441-88983463 ATGTGTCCTCCTCGTGAAGGAGG + Exonic
911239306 1:95448467-95448489 TTGTGTGCTTCCCTTCAGGGTGG + Intergenic
911496574 1:98638291-98638313 CTGTGTCTTTCAATTCAGGGTGG - Intergenic
911536497 1:99106363-99106385 CTGTGTCCCTCCTTTCAGGGTGG - Intergenic
911725824 1:101239842-101239864 CTGTGACATCCTCTTCAGAGCGG + Exonic
912117039 1:106419404-106419426 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
912127400 1:106555743-106555765 CTGTTTCCTTCCCTTCAGGATGG - Intergenic
912633186 1:111267097-111267119 CTGTGTTCTTCCCTTCAGGGTGG + Intergenic
912764390 1:112395977-112395999 CTGGGTCCTGGGCTTCAGGGTGG - Intergenic
912871663 1:113312019-113312041 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
913176742 1:116279697-116279719 CTGTTTCCTCCTCTTAAAGTGGG + Intergenic
913706998 1:121434936-121434958 TCGTGTCCTTCCCTTCAGGGTGG - Intergenic
915856916 1:159397829-159397851 CTGTGTCCTTTGCTTTAGGGTGG - Intergenic
915916147 1:159942080-159942102 TTGTTGCCTCCTCTTCAGAGGGG - Intronic
916314876 1:163438073-163438095 CTGTATCCTCCCCTGCTGGGAGG + Intergenic
916360646 1:163963350-163963372 TTGTGTCTTTCCCTTCAGGGTGG - Intergenic
916610633 1:166388058-166388080 CTGGGTTCTTCTCTTCAGGAAGG + Intergenic
917003279 1:170385009-170385031 CTGTGTTTTTCCCTTCAGGGTGG + Intergenic
917226335 1:172788045-172788067 CTGTGTCCTTCTCTTCAGAGTGG + Intergenic
917373005 1:174316720-174316742 CTGTGTCCTTCCCTTTAGGGTGG + Intronic
917536000 1:175875127-175875149 CTTTTGCCTCCTCTTCACGGAGG + Intergenic
918018664 1:180663710-180663732 TTGTGTTCTTCTCTTAAGGGTGG + Intronic
919003209 1:191860911-191860933 CTGTGTCCTTCCCTTCAAGGTGG - Intergenic
921296075 1:213705187-213705209 CTGTGTCCTTTCCTTCAAGGTGG + Intergenic
923886535 1:238164135-238164157 CTGTGTCCTTCTTTTTAGGGTGG + Intergenic
1063101137 10:2951071-2951093 TGGTGTCCTGCTCTTCAGGCAGG + Intergenic
1063672644 10:8111854-8111876 CACTGACCTCCTCTTCAGGTTGG + Intergenic
1063814363 10:9755927-9755949 CTTTCTCCCCTTCTTCAGGGTGG + Intergenic
1064019993 10:11801306-11801328 ATGTATCCTCCTCTTGTGGGTGG + Intergenic
1064228427 10:13507663-13507685 CTGTGGCCTCACCTTCAGGCTGG - Intronic
1065249713 10:23798228-23798250 CTGTGTCTTCCTCTTGAGCTTGG - Intronic
1065699485 10:28411008-28411030 CTGTGTCCTCTTCCACAAGGTGG + Intergenic
1065771829 10:29085105-29085127 CTGCCTCCACCTCTTCAGGTAGG - Intergenic
1066303205 10:34115093-34115115 CTGTGTCCCCCTCATCCTGGTGG - Intronic
1067032528 10:42887975-42887997 TTGTGTCCTTCCCTTCAGGATGG + Intergenic
1067146809 10:43700305-43700327 CTGTGTCCTTCTATGGAGGGTGG + Intergenic
1067761248 10:49048736-49048758 CTCTGTGCTCATCTCCAGGGAGG + Intronic
1068217352 10:53999777-53999799 CTGTGTCTTTCCCTTCAGGGTGG - Intronic
1068411309 10:56659791-56659813 CTTTGTCCTTCTCTTCAGGGTGG + Intergenic
1068478695 10:57562381-57562403 CTGTGTCCTTCCCTTCAGGATGG + Intergenic
1068867702 10:61912219-61912241 CTGTGTATTCTTCTTAAGGGAGG + Intronic
1069223019 10:65907160-65907182 CTGTGTCTCCCTCTACAAGGAGG - Intergenic
1070283954 10:75070367-75070389 CTGTGTGCTCCACTCTAGGGAGG - Intergenic
1071215197 10:83393216-83393238 CTTTGTCTTTCTCTTCAGGGTGG + Intergenic
1071896654 10:90075573-90075595 TTATGTCCTTCCCTTCAGGGTGG + Intergenic
1073058781 10:100720185-100720207 CTGTGTCCTCTTCTGCAGTGAGG - Intergenic
1073179334 10:101574482-101574504 CTGTGTCCTCGTGTCCATGGAGG - Intronic
1073661095 10:105477142-105477164 CAGTGTCTTCCTCTTAAGTGGGG - Intergenic
1073678910 10:105680389-105680411 CTGTGTCCTTTCCTTCAGGGTGG - Intergenic
1073823315 10:107290989-107291011 CTGTGTCCTTCTCTTCAGGAGGG + Intergenic
1074038121 10:109761506-109761528 TTGTGTCCTTCCCTTCAGGGAGG + Intergenic
1074097094 10:110323528-110323550 CTGTGGCCTTCCCTTCAGAGTGG - Intergenic
1074368295 10:112877881-112877903 GTATGTCCTCCTCTTCAAAGAGG - Intergenic
1076679754 10:132165626-132165648 CTGTGGGCTCCTCCTCAGGCCGG - Intronic
1077473786 11:2776968-2776990 CTGTGTCCTTCTCTCCAGGCTGG + Exonic
1077740497 11:4840253-4840275 CTGTGTCCTTTCCTTCAGGAAGG - Intronic
1077958929 11:7051971-7051993 CTTTCTCCTCTTCTTGAGGGAGG - Intronic
1078449988 11:11433626-11433648 CTGTGTGTTCCTCTTCATGTGGG - Intronic
1079183588 11:18215579-18215601 CTGTGTCCTTCCCTTCAGGGTGG - Intronic
1079309594 11:19353055-19353077 CTGAAAACTCCTCTTCAGGGGGG + Intronic
1079686946 11:23370895-23370917 CTGTATTCTTCTCTTCAGTGTGG - Intergenic
1079961335 11:26927860-26927882 CTGTGTTCTTCCCTTCAGGGTGG + Intergenic
1080128661 11:28767168-28767190 TTGTGTCCTTCCCTTCAGTGTGG - Intergenic
1081307551 11:41532015-41532037 CCCTGTCATCCTCTTCAGTGTGG - Intergenic
1082122670 11:48396268-48396290 CTGTGTCCTTCTTTTCAGGGTGG + Intergenic
1082251965 11:49992404-49992426 CTGTGTCCTTCTTTTCAGGGTGG - Intergenic
1082556374 11:54567544-54567566 CTGTGTCCTTCTTTTCAGGGTGG + Intergenic
1083163266 11:60868517-60868539 CTGTTTCCTCATCTGCAAGGTGG + Intronic
1083404316 11:62446190-62446212 CTGTGACCTCATCTGCAGAGGGG - Intronic
1083505744 11:63156114-63156136 CTGTATCCTTCTCCTGAGGGTGG + Intronic
1083512695 11:63226711-63226733 TTGTGTCCTTCCTTTCAGGGTGG + Intronic
1083656008 11:64230122-64230144 CTGTGTCCCCCTCTGCAAGCAGG + Intronic
1084964321 11:72736528-72736550 CTGAGTCCTCATCCTCAGGAAGG + Intronic
1084982265 11:72836182-72836204 CTGTGTCCTGGTCCTCAGTGTGG + Intronic
1085008109 11:73114001-73114023 CTCTGTCCTTCCCTTTAGGGTGG + Intronic
1085012157 11:73148568-73148590 CAGTGTCTGTCTCTTCAGGGAGG - Intergenic
1085178532 11:74511699-74511721 TTGTGTCCTCCCCTTCAGGGTGG - Intronic
1085350094 11:75792686-75792708 CTGTCTGCTCCTCTTCCAGGTGG - Intronic
1085981573 11:81732697-81732719 CTGTGTTCTTCCCTTCAGGATGG + Intergenic
1086068839 11:82776434-82776456 CTGTGTTCTTCCCTTCAGGGTGG - Intergenic
1086071601 11:82805706-82805728 ATGTGTCCTCCCCGTGAGGGAGG - Intergenic
1086992164 11:93315259-93315281 TTCTGTCCTCCTCTTCAGTCTGG + Intergenic
1087049351 11:93869758-93869780 CTGTGGCCTGCTCTCCAGGGTGG + Intergenic
1087201400 11:95347661-95347683 CTGTATCTTTCTCTTCAGGTTGG - Intergenic
1087598310 11:100282652-100282674 CAGTGTCCTTCCTTTCAGGGTGG + Intronic
1087720898 11:101664675-101664697 TTGTGTCCTTCCCTTCAGGGTGG + Intronic
1087877022 11:103370399-103370421 CTGTGTCCTTCCCTTCAGGTTGG - Intronic
1088181906 11:107121965-107121987 TTGTGCCCTTCCCTTCAGGGTGG - Intergenic
1088210852 11:107454085-107454107 CTGCGTCTTTCCCTTCAGGGTGG - Intronic
1088411436 11:109539148-109539170 TTGTGTCCTTCCTTTCAGGGTGG + Intergenic
1088570014 11:111213657-111213679 CTATGTCCTTCCCTTCAGGGTGG - Intergenic
1089620821 11:119721242-119721264 CTGTGTCCTCCTCTTCAGGCAGG + Intronic
1090318212 11:125816785-125816807 CTGTGTTTTTCCCTTCAGGGTGG + Intergenic
1091785971 12:3243660-3243682 CCCTGGCTTCCTCTTCAGGGAGG + Intronic
1092477006 12:8828172-8828194 TTGTGTCCTCCCCTTCAGGGTGG + Intronic
1093123947 12:15306522-15306544 CTGTGTCCTTCCCTTCAGTGTGG + Intronic
1093617291 12:21241594-21241616 CTGTGTCCTTCCTTTCAGGGTGG - Intergenic
1094658116 12:32440738-32440760 CTGTGCCATTCCCTTCAGGGCGG + Intronic
1095133726 12:38572522-38572544 CTGTGTCCTTCCCTTTAGTGTGG - Intergenic
1095874293 12:47063718-47063740 CTGTGTCCCTCTCTTCAGAGAGG + Intergenic
1095967653 12:47879613-47879635 AGGTCTCCTCCTCTTGAGGGTGG + Intronic
1095982231 12:47980185-47980207 CTGTGGCAGCCTCTTCAGGCTGG - Intronic
1096079212 12:48822737-48822759 TTGTGTCCTCCTCTTCACCCTGG + Intronic
1097150816 12:56978685-56978707 CTGTGCCCTTCCCTTCAGGATGG + Intergenic
1097425966 12:59445477-59445499 TTGTGTCCTTCCATTCAGGGTGG + Intergenic
1097473162 12:60021215-60021237 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1097824199 12:64157931-64157953 CTTTCTCTTCCTCTTCATGGTGG - Exonic
1098207834 12:68132167-68132189 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1098491952 12:71092588-71092610 CTGTGTCCTCCACTTCAGGGTGG + Intronic
1100360716 12:93877397-93877419 CTGTGACCTTCCCTTCAGGGTGG + Intronic
1100909098 12:99338095-99338117 TTGTGTACTTCCCTTCAGGGAGG + Intronic
1100923883 12:99521949-99521971 CTGTGTCCTTCCCTTTAGGGCGG + Intronic
1101226750 12:102694963-102694985 CTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1101829471 12:108246187-108246209 CTGTCTGCTCCTCACCAGGGAGG - Intronic
1102318034 12:111905547-111905569 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1102949911 12:117024478-117024500 CTGTTTCCTCCTCTGCAGAGCGG - Intronic
1103328530 12:120137766-120137788 CTGTGTCATCCTCTACGGAGAGG + Exonic
1103403429 12:120658796-120658818 CTGTGTGAGCCTCTTCAGGACGG + Intronic
1103736026 12:123061370-123061392 CTGTTTCCTCATCTGCAGAGTGG - Intronic
1103923893 12:124413265-124413287 CTGTGTCCACCTCTGCAGCGTGG + Intronic
1104679048 12:130736740-130736762 CTAAGTCCTCCTCCTCAGGGAGG + Intergenic
1104862411 12:131930385-131930407 CTGAGTCCTCATCTTTAGGATGG + Intronic
1105205782 13:18222244-18222266 CTGTGTTCTCCTCTCCAGGAAGG + Intergenic
1105336309 13:19473275-19473297 CTGTGTCCTTCCCTTCAGGATGG + Intronic
1105411329 13:20174123-20174145 CTCTGCCCTCCTCTCCAGTGTGG - Intergenic
1106074861 13:26449152-26449174 TTGTGTCCTTCCCTTCAGGATGG - Intergenic
1106349903 13:28920623-28920645 TTGTGTCCCTTTCTTCAGGGTGG + Intronic
1106963986 13:35037912-35037934 CTGTGTCCTTCTCTTCAGGGTGG + Intronic
1107524127 13:41213603-41213625 TTGTGTCCGTCTCTTCAGGATGG + Intergenic
1108575062 13:51783298-51783320 CTGTGTCCTCAGCTTGAGGTGGG - Intronic
1108631607 13:52289180-52289202 CTGTGTCCTTCCCTTCACGATGG + Intergenic
1108655088 13:52523415-52523437 CTGTGTCCTTCCCTTCACGATGG - Intergenic
1108922617 13:55694051-55694073 CTGTGTCCTTCCCTTCATGGTGG - Intergenic
1108973319 13:56403419-56403441 CTATGTCCTTCCCTTCAGGGTGG - Intergenic
1109522668 13:63533647-63533669 CTGTGTCTTTCTCTTCAGCGTGG + Intergenic
1111042652 13:82770340-82770362 CTGGGTCCTTTTCTTCAAGGCGG + Intergenic
1112493159 13:99884959-99884981 TTGTGTCCTTCTATTCAGGTAGG + Intronic
1112778518 13:102871294-102871316 CTGTGGCCTCCTCTTGAGCAGGG - Intronic
1112940534 13:104855668-104855690 TTGTGTCCTTCACTTTAGGGTGG - Intergenic
1113461145 13:110483020-110483042 CTGTGTCCTCCTGTGCCTGGTGG - Intronic
1114072585 14:19126571-19126593 CTGTGTCCTTCTCTTCAGGGTGG + Intergenic
1114089671 14:19273401-19273423 CTGTGTCCTTCTCTTCAGGGTGG - Intergenic
1114237626 14:20836225-20836247 CTGTGGCCTGCTCTCCGGGGTGG + Intergenic
1114741499 14:25102942-25102964 AGGTGCCCTCCCCTTCAGGGAGG + Intergenic
1114982018 14:28177017-28177039 CTGTGAGCTCATCTTCAGAGGGG - Intergenic
1115645408 14:35365726-35365748 CAGTGGCCTCCCCCTCAGGGTGG - Intergenic
1115821078 14:37212645-37212667 CTATGTCCTTCCCTTCAGGGTGG - Intronic
1116021553 14:39468449-39468471 TTGTGTCCTTTCCTTCAGGGCGG + Intergenic
1116057955 14:39886450-39886472 CTGTGCCCTTCCCTTTAGGGTGG - Intergenic
1116504763 14:45664970-45664992 CTGTGTGCTTCCTTTCAGGGTGG + Intergenic
1116754031 14:48923121-48923143 CTGTGTCATCATCTTAACGGTGG + Intergenic
1116771636 14:49132768-49132790 CTGTCTCCTCATTTTCAGGCTGG - Intergenic
1117159296 14:52973229-52973251 CTGTGTCCTTCCCTTTATGGTGG + Intergenic
1118241082 14:64059742-64059764 TTGTGTCCTTCCCTTAAGGGTGG + Intronic
1119783483 14:77295329-77295351 CTGTATCCTCCTCTTTAAGTTGG - Intronic
1120426258 14:84351529-84351551 CTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1121088506 14:91164908-91164930 CTGTGTCCTTCCCTGCAGGGTGG + Intronic
1121088666 14:91166312-91166334 CTGTGTCCTTCCCTGCAGGGTGG + Intronic
1121314134 14:92951119-92951141 ATGTGTGCTGCTCTTCTGGGGGG - Intronic
1121759684 14:96434659-96434681 CTGTTTCCTTCCCTTCAGGGTGG + Intronic
1122500056 14:102191416-102191438 CTATTTCCTCCTCTTCTGGGGGG - Intronic
1123016326 14:105377316-105377338 CTGCCTCCTCCTCCTCAGGGAGG - Intronic
1123125257 14:105941492-105941514 CTGTGTCCTCCTGTTGATGGTGG + Intergenic
1123992527 15:25694177-25694199 CTGTCTGCTCCTCTCCAGGGAGG - Intronic
1124081305 15:26500871-26500893 CTGTGTCCTTCCCTTCAGAGTGG + Intergenic
1124144507 15:27111632-27111654 CTGTGTGCTGTTCTTCAGAGAGG + Intronic
1124236456 15:27993305-27993327 CTGTTTCCTCCTCTGCAAAGTGG - Intronic
1125044409 15:35230087-35230109 CTGTGTCCTTTTCTTCAGGGTGG + Intronic
1125272371 15:37953141-37953163 TTGTGTCCTTCCCTTCAGGGTGG - Intronic
1125297976 15:38223155-38223177 CTCTGTCCTCCTTTTCACAGAGG + Intergenic
1125475303 15:40044217-40044239 CTACGTCCTCCTCGTCAAGGTGG + Intergenic
1125601372 15:40917629-40917651 CTTTTTTCTCCTCTTGAGGGGGG + Intergenic
1125681959 15:41536557-41536579 CTGGGTCCTCATCCTCAGGCAGG + Exonic
1126015749 15:44348588-44348610 TTGTGTCCTTCCTTTCAGGGTGG - Intronic
1126216335 15:46158440-46158462 TTGTGTCCTACCCTTCAGGAAGG - Intergenic
1126517543 15:49553495-49553517 CTGTGTCCTTCCCTTCAGGGTGG + Intronic
1127012522 15:54645275-54645297 CTGTGTCCTTATTTTCAGGATGG - Intergenic
1127140359 15:55969674-55969696 CTGGGTCCTTTCCTTCAGGGTGG - Intronic
1127173563 15:56328860-56328882 GTCTGTCCTTCTCTTCAGGGTGG - Intronic
1128113797 15:65093227-65093249 CTGTCTCCTCTTCCTCAGGCAGG - Exonic
1128624838 15:69189758-69189780 GTGTGTCCTCCTCTTCTGAAGGG - Intronic
1128900970 15:71422756-71422778 TTGTGTCCTTCCCTTTAGGGTGG + Intronic
1129109334 15:73328610-73328632 CCGTTTCCTCATCTGCAGGGCGG - Intronic
1129501146 15:76038687-76038709 TTGTGTCCTTCCCTTCAGGGCGG - Intronic
1129642483 15:77394205-77394227 TTGTGTCTTTCCCTTCAGGGTGG - Intronic
1131323438 15:91420356-91420378 CTGTGTCTTTCCCTTCAGGGTGG + Intergenic
1131393430 15:92067923-92067945 CTGTGTCCTCTTCTGCGGGAAGG + Intronic
1132116057 15:99137302-99137324 CTGTGGCCTCCACTGCAGGCAGG - Exonic
1132833311 16:1940372-1940394 CTGCCTCCTCCTCTGCAGAGTGG - Intronic
1133340546 16:5033151-5033173 CTGTTTCCTCCTCTGCAGAATGG - Intronic
1134806122 16:17126888-17126910 CTGTGTCTCCCTCTTCACTGTGG - Intronic
1135993324 16:27230544-27230566 CTGTTTCCTCATCTGCAGGATGG - Intronic
1136590953 16:31217265-31217287 CTGTTTCCTCCTCTGCAGATTGG - Exonic
1137743644 16:50804726-50804748 CTGTGAAGGCCTCTTCAGGGAGG - Intergenic
1140159654 16:72475346-72475368 CTGTCTCTTCTACTTCAGGGTGG - Intergenic
1140479955 16:75257076-75257098 CTCTGTCCTCGTCCTCAGAGAGG + Intronic
1140959243 16:79896568-79896590 CTGTGTCCTGCTCTTTAAGTGGG - Intergenic
1141718277 16:85739722-85739744 CTGTAGCCTCCACTTCAAGGAGG - Intronic
1141807204 16:86349612-86349634 CAGTGGCCTCCTCATCAGAGGGG + Intergenic
1143413721 17:6729347-6729369 CTGGGTCTCACTCTTCAGGGCGG - Intergenic
1144576623 17:16433755-16433777 CTGTGCCCTGCACTGCAGGGGGG - Intronic
1146133113 17:30295277-30295299 CTCTGTCCTCATCATCAGGGTGG + Intergenic
1146216684 17:30982111-30982133 TTGTGTCCTTCCCTTCATGGTGG + Intronic
1146750001 17:35369539-35369561 CTGTGTTCTTTTCTTCAGAGTGG - Intronic
1147337934 17:39738343-39738365 CTGGGACCACGTCTTCAGGGAGG - Intronic
1147456742 17:40542599-40542621 CTGGGTACCCCTCTGCAGGGGGG + Intergenic
1149157284 17:53647321-53647343 CTGTGTCTTTCCCTTCAGGGTGG + Intergenic
1149184311 17:53979308-53979330 TTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1149906322 17:60529377-60529399 GTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1150208122 17:63424579-63424601 CTCTGTCCTCCATTTCAGGGTGG - Exonic
1150471706 17:65442994-65443016 CGGTTTCCTCCTCTGCAGAGTGG + Intergenic
1150550446 17:66204684-66204706 TTGTGTCCCTCCCTTCAGGGTGG - Intergenic
1150871107 17:68911513-68911535 CTGTGTCCTTCCCTTTATGGTGG - Intronic
1151575173 17:74949548-74949570 CAGTGCCCTCCCCTTCAGTGAGG - Exonic
1152067629 17:78120521-78120543 CTGAGTCTTCCTCTGAAGGGTGG + Intronic
1152230010 17:79109726-79109748 CTGTGTGCCCCTCTCCAGGCTGG - Intronic
1152785424 17:82245567-82245589 CTGTGTCCTGCTCAGCTGGGTGG - Intronic
1203160445 17_GL000205v2_random:44261-44283 CTGTCTCCTCCTGTTCTGTGTGG - Intergenic
1153251386 18:3125836-3125858 ATGTGTTCTCCTCTACATGGGGG - Intronic
1153537612 18:6119063-6119085 CTGAGTCCACCTCTGCTGGGTGG + Intronic
1154491211 18:14923582-14923604 TTCTGTCCTTCCCTTCAGGGTGG - Intergenic
1155057831 18:22200634-22200656 CTGTGTCCCCCTCTTCTGCCAGG + Exonic
1155597373 18:27503069-27503091 TTGTGTTCTTCCCTTCAGGGTGG - Intergenic
1156094329 18:33510834-33510856 TTGTGTCCTTCCTTTCAGGGTGG - Intergenic
1157847509 18:51017570-51017592 CTCCCTCCTCCTTTTCAGGGAGG - Intronic
1158948930 18:62474276-62474298 TTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1159260284 18:66004808-66004830 TTGTGTTCTTCTCTTCAGGGCGG - Intergenic
1160221397 18:76980467-76980489 CTCTCTCTTCCTTTTCAGGGAGG - Intronic
1161030950 19:2057546-2057568 CCGTGGCTTCCTCTTCCGGGAGG + Intergenic
1161129409 19:2579318-2579340 CTGTGTCCTGCAGCTCAGGGTGG + Intronic
1161808036 19:6456365-6456387 CTGTGCCCTCTTCCCCAGGGGGG - Intronic
1162666799 19:12220410-12220432 CTGGGTCCTTCCCTTCAAGGCGG + Intergenic
1162692940 19:12449028-12449050 TTGTTTCCTTCCCTTCAGGGTGG + Intronic
1163722683 19:18905754-18905776 GGGTGTCCTCCTCTGCTGGGCGG - Intronic
1164449424 19:28347698-28347720 CAATGTCTTCCTCTTCAGTGTGG - Intergenic
1165075085 19:33276061-33276083 CTGGGTCCCCCTGATCAGGGTGG + Intergenic
1165748958 19:38248450-38248472 CTGGATGCTCCTCCTCAGGGGGG + Intronic
1166206922 19:41276163-41276185 CTGCGACCTCCACTTCAAGGTGG + Exonic
1166757351 19:45201541-45201563 TTGTGTCCTTCCCTTCAGGATGG + Intronic
1166785109 19:45362911-45362933 CAGTGTCCTCATTTGCAGGGTGG + Intronic
1167037186 19:47001456-47001478 CTGTGCCCGCCTCTGCCGGGAGG + Exonic
1168416834 19:56174613-56174635 CTGTCTCCTCCTCTCCACCGTGG - Intergenic
1168521460 19:57054144-57054166 CTCTGTCTTCCACTTAAGGGAGG + Intergenic
926818761 2:16828880-16828902 CTGTGTCCTACTTTTCAGTGTGG - Intergenic
927309710 2:21616989-21617011 CTGTGTCCTTCACTTCAGGGTGG + Intergenic
927594652 2:24385980-24386002 CTGTGTCCTTCCCTTCAGGACGG + Intergenic
927922903 2:26987188-26987210 CTTTTTCATCCTCTTCAAGGAGG - Intronic
928321969 2:30291052-30291074 CTGAGTGCTCCTCTTCTCGGGGG + Intronic
928472302 2:31586332-31586354 CTGTGCCCTTCCCTTCAGGGTGG - Intergenic
928715458 2:34055465-34055487 TTGTGTCCTTCCCTTTAGGGTGG + Intergenic
928783659 2:34854982-34855004 CTATGTCCTTCCCTTCATGGTGG - Intergenic
928802984 2:35116257-35116279 CTGTGTCCTTTTCTTTAGGGTGG - Intergenic
928851934 2:35758988-35759010 CTGTGTCCTTCTTTTTAGAGTGG + Intergenic
928862390 2:35874701-35874723 CTATATCCTTCCCTTCAGGGTGG + Intergenic
929281646 2:40086992-40087014 TTGTGTCCTTCCCTTCATGGTGG + Intergenic
930159300 2:48137955-48137977 CTATGTCCTTCCCTTCAGGGTGG - Intergenic
930288777 2:49467560-49467582 TTGTGTCCTTCGCTTCAGGGTGG + Intergenic
930981178 2:57528216-57528238 CTGAGTCCTTCCCTTCAGAGAGG + Intergenic
931103184 2:59025381-59025403 CAGTTTCCTCCTCTTTTGGGTGG + Intergenic
931170638 2:59799977-59799999 CTGTGTGCACCTCTACCGGGAGG - Intergenic
931230798 2:60372801-60372823 TTGTGTACTCCTCTTCTGGCTGG - Intergenic
931247791 2:60505697-60505719 CTGTGTCCCCTGCTTCCGGGAGG - Intronic
931572346 2:63681612-63681634 CTGTGTCCTTCCCTTCAAGGTGG - Intronic
931637346 2:64352362-64352384 CTGTGTCCTTCCCTTCAGGGTGG - Intergenic
931989882 2:67779359-67779381 CTGTGAACTTCCCTTCAGGGTGG - Intergenic
932100638 2:68896519-68896541 CTTTGTCTTCCTCTACAAGGTGG + Intergenic
932491974 2:72128137-72128159 CTGGGTCCTTCTCTTCTGGGTGG + Intergenic
933162938 2:79045600-79045622 CTGTGTCCTTCACTTCAGGATGG - Intergenic
933591595 2:84239104-84239126 CTGTTTCTTCATCTTCTGGGGGG + Intergenic
934558784 2:95301513-95301535 CTGTGTCCTCATTTTCCTGGGGG + Intronic
934915783 2:98300061-98300083 CTATGTTCTCCTCTGCAGGTTGG + Exonic
935067821 2:99666072-99666094 CTGTGTCCTCCTGTTGTGAGAGG - Intronic
935478528 2:103556585-103556607 TTGTGTCCTTCCCTTCAGGGTGG + Intergenic
935950495 2:108324279-108324301 AAGTGTCCTCCTCTGAAGGGAGG - Intergenic
936901262 2:117484542-117484564 TTGTGTCCTTCTCTTCAAGGTGG + Intergenic
936925424 2:117731519-117731541 CTGTGTCCTTCCCTTTAGGGTGG - Intergenic
937552205 2:123108040-123108062 CTATGTCCTACTCTTCAAGGTGG + Intergenic
937739553 2:125333876-125333898 CTCTGTCTTCCTTTTCAGGGTGG - Intergenic
937867825 2:126767225-126767247 CTGTGTCCTCCTCTGGGGTGGGG - Intergenic
937941424 2:127289131-127289153 CAGTGTCCTCTTTTTCAGGCTGG - Intronic
938014250 2:127854416-127854438 CTGTTGCTTCCTCTTCAGTGTGG - Intronic
938486824 2:131720044-131720066 CTGTGTCCTTCTCTTCAGGGTGG + Intergenic
939244731 2:139609415-139609437 TTGTGTCCTTCCCTTCAGGGTGG + Intergenic
939273672 2:139971552-139971574 TTATGCCCTCCTCTCCAGGGTGG - Intergenic
939635866 2:144582043-144582065 CTGAGTCCTTCTCATCAGTGTGG + Intergenic
939930686 2:148230117-148230139 CTGTATCCTTCACTTCAGAGTGG + Intronic
940429692 2:153575437-153575459 CTGTGTCTCTCTCTTCAAGGTGG + Intergenic
941634886 2:167925825-167925847 CTATGTCCTCCACTCCAGGCGGG - Intergenic
941745881 2:169087044-169087066 TTGTGTCCTTCCCTTCGGGGTGG + Intronic
942542963 2:177033731-177033753 CTCCTTCCTCCTCTACAGGGCGG + Intergenic
942750152 2:179277538-179277560 CTGTGTTCCTCCCTTCAGGGTGG - Intergenic
943237163 2:185337597-185337619 ATGTGTCCTTCCCTTCATGGTGG + Intergenic
943427810 2:187758740-187758762 TTGTATCCTTCCCTTCAGGGTGG + Intergenic
944685489 2:202113786-202113808 CCGTCTCCACCTCTGCAGGGTGG - Intronic
944760459 2:202808532-202808554 TTGTGTCGTTCTCTTCAGGGTGG - Intronic
944854995 2:203759270-203759292 TTGTGTCTTTTTCTTCAGGGAGG + Intergenic
944964470 2:204914664-204914686 ATGTTTCCTACTCTTCAGGCTGG - Intronic
945041950 2:205749789-205749811 CTGTGGCCTCCTCTTCGGTGGGG - Exonic
945461643 2:210116332-210116354 TTGTGTCCTTCCCTTAAGGGTGG - Intronic
945739682 2:213644923-213644945 CTGTGTCCTTTTCTTCAGGGTGG + Intronic
946135417 2:217642719-217642741 CAGTGGCCTCCTTTTCAGTGGGG - Intronic
946690196 2:222303674-222303696 GTGTGTCCTGCTCTTGGGGGAGG + Intronic
948503410 2:238411150-238411172 CAGTGTCCTCCTCTTCTAGGAGG - Intergenic
948610245 2:239162171-239162193 CTCTGTGCTCCTCTTCAGAAAGG + Intronic
948673240 2:239581926-239581948 CTGTGAGCTCCTTTCCAGGGTGG - Intronic
1168794874 20:604661-604683 CTTTCTCCCCCTCTGCAGGGTGG - Exonic
1169432323 20:5548874-5548896 CTGTTTTCTCCTCTTCACAGGGG - Intronic
1169491802 20:6077343-6077365 CTGTGCCTTCCTCTTCCAGGTGG - Exonic
1169617886 20:7470897-7470919 CTGTGTCCTTCACTTCAAGGCGG + Intergenic
1169628692 20:7600824-7600846 TTGTGTCCTTCCCTTTAGGGTGG - Intergenic
1169925581 20:10781004-10781026 CTGAGACCTCCTGATCAGGGGGG - Intergenic
1171398114 20:24852645-24852667 CTGAGTCCACCTCTTTGGGGGGG + Intergenic
1172760610 20:37318612-37318634 CTGGTTCCTCCTCTTGAGAGGGG + Intergenic
1173228336 20:41175048-41175070 CTGTGTCCTCCTCCTCAGGCAGG - Exonic
1174750672 20:53108421-53108443 CCTAGTCCTCCTCCTCAGGGCGG - Intronic
1175347085 20:58287524-58287546 CCGTGTTCTCATCTTGAGGGTGG + Intergenic
1176048504 20:63104689-63104711 CAGAGTCCTCCTTTTCAGGCAGG - Intergenic
1176053652 20:63133805-63133827 CTGTGTCCTCCTCTTGGCAGTGG - Intergenic
1176254214 20:64142350-64142372 CTGTGCCCTCCTCCCCAGCGGGG - Intergenic
1176737241 21:10561812-10561834 CTGTGTCCTTGCCTTCAGGATGG - Intronic
1176899410 21:14420889-14420911 CTGTGTTCTTCCCTTCAGTGTGG - Intergenic
1177190440 21:17845618-17845640 TTGCCTCCTGCTCTTCAGGGTGG + Intergenic
1177658986 21:24057467-24057489 CTCTCTCCTCCGCTTCATGGCGG + Intergenic
1179236003 21:39546907-39546929 CTGTGTCCTCATGTTAGGGGTGG + Intergenic
1179515667 21:41904644-41904666 CTGCCTCCTCCTCTTGTGGGAGG - Intronic
1179659662 21:42866161-42866183 CTGTGTCCTCATCTTCGGCTTGG + Intronic
1179832620 21:44006980-44007002 CTGTGTCCACGTCTTCGGGAAGG + Intergenic
1180098526 21:45573322-45573344 CTGTTTCCTCCTCTGCAAGATGG - Intergenic
1180491033 22:15848946-15848968 CTGTGTCCTTCTCTTCAGGGTGG + Intergenic
1180563245 22:16639363-16639385 CTGTGTCCTTCCCTTCAGGATGG - Intergenic
1180760185 22:18196472-18196494 CTGTATTCTCCTCTCCAGGAAGG - Intergenic
1180770497 22:18380770-18380792 CTGTGTTCCCCTCTCCAGGAAGG - Intergenic
1180775483 22:18428224-18428246 CTGTATTCTCCTCTCCAGGAAGG + Intergenic
1180808554 22:18739279-18739301 CTGTGTTCCCCTCTCCAGGAAGG + Intergenic
1180828439 22:18883728-18883750 CTGTGTTCCCCTCTCCAGGAAGG - Intergenic
1181071481 22:20344243-20344265 CTGTGTTCCCCTCTCCAGGAAGG + Intergenic
1181194553 22:21173193-21173215 CTGTGTTCTCCTCTCCAGGAAGG + Intergenic
1181214890 22:21319585-21319607 CTGTGTTCTCCTCTCCAGGAAGG - Intergenic
1181366653 22:22381571-22381593 CTGTGTCCTAAGCTGCAGGGAGG - Intergenic
1181979706 22:26757248-26757270 CAGTTTCCTCCTCTGCAGGATGG - Intergenic
1182058400 22:27379168-27379190 CTGTTTCCTCCCCTGCAGGATGG + Intergenic
1183341542 22:37284461-37284483 CTCTGGCCTCCTCCTCAAGGAGG - Intronic
1183531883 22:38360781-38360803 CTGTGTCCTTCCCTTCAGGATGG + Intronic
1185128974 22:49026842-49026864 CAGAGTCCTCCCCTTCAGGCAGG - Intergenic
1185262910 22:49880110-49880132 CCGTTTCCTCCTCTTGAGGCTGG + Intronic
1203232332 22_KI270731v1_random:121942-121964 CTGTGTTCCCCTCTCCAGGAAGG - Intergenic
1203278536 22_KI270734v1_random:109717-109739 CTGTGTTCCCCTCTCCAGGAAGG - Intergenic
1203281671 22_KI270734v1_random:134967-134989 CTTTGTGCTGCCCTTCAGGGTGG - Intergenic
949331226 3:2925077-2925099 CTGTGTCTTGATCTTCATGGTGG + Intronic
949829172 3:8196385-8196407 TTGTGTCCTTCCCTTTAGGGTGG + Intergenic
950515146 3:13460266-13460288 CTGTGTCCTCCCATCCAGGGTGG - Intergenic
951032153 3:17894975-17894997 CTGTGTCCTTCCTTTCATGGTGG + Intronic
951204451 3:19910529-19910551 CTGTGTCCTTCCCTTCAGGGTGG - Intronic
951279466 3:20731112-20731134 TTGTGTTCTTCCCTTCAGGGTGG + Intergenic
951287583 3:20833767-20833789 CAGTGTCATCCTATTCAGGTTGG - Intergenic
951436898 3:22675969-22675991 TTGTGTACTTCTCTTCAGGGTGG + Intergenic
951794470 3:26523462-26523484 CTGTGTCTTTCCCTTTAGGGTGG + Intergenic
951819279 3:26790704-26790726 CTGTTTCCTTCCCTTCAGGATGG + Intergenic
951904381 3:27689186-27689208 CTCTGTCCTTCCCCTCAGGGTGG - Intergenic
952139750 3:30465685-30465707 CTGTGTTCTTCCCTTCAGGGTGG + Intergenic
952433025 3:33244287-33244309 CTTTCTCATCCTCTTCAGTGTGG - Intergenic
952639855 3:35580154-35580176 CTGTGTCCTTACCTTCATGGTGG - Intergenic
954461966 3:50632247-50632269 ATCTGTGCTCCTCTTCATGGGGG + Intronic
954622597 3:52004532-52004554 CTGTTTCCTCCTCTGCAACGTGG - Intergenic
955058864 3:55479850-55479872 CTGTTTCCTCCTTTTCTGAGTGG - Intronic
955632441 3:60989121-60989143 CTGTGTTGTCATCTTCATGGGGG - Intronic
955789166 3:62570710-62570732 CTGTATCCTCCTCTGAATGGTGG + Intronic
958876766 3:99625267-99625289 CTTTGTCCTTCACTTCAGGGTGG - Intergenic
959042003 3:101432367-101432389 CTGTGTTCTTCCCTTCAGGATGG - Intronic
959113532 3:102149371-102149393 TTGTGTCCTTCCATTCAGGGTGG - Intronic
959189790 3:103097037-103097059 CTGTGAACTTCTCTTCAGGGCGG + Intergenic
959328668 3:104973222-104973244 CTGTGTCTTTGCCTTCAGGGTGG + Intergenic
959547360 3:107612812-107612834 TTGTGTCCTTCTGTTCAGGGTGG + Intronic
959717108 3:109444737-109444759 CTGTGTTCTTCTCTTCAGAGTGG - Intergenic
959841722 3:110984132-110984154 TTGTGTCCTTCTCTTCAGCGTGG - Intergenic
960404231 3:117239275-117239297 CTGTGTCCTTCTCTTCAGGTTGG - Intergenic
960471771 3:118075146-118075168 CTGTTTCCCTCCCTTCAGGGTGG + Intergenic
960850809 3:122052143-122052165 CAGTGCCCTCTTCTTCAGGAGGG - Intergenic
961430729 3:126881063-126881085 CTGTGTCCTCCCATACAGGTCGG - Intronic
961459934 3:127043832-127043854 CAGTGCCCTCCCCTGCAGGGTGG + Intergenic
961736446 3:129004776-129004798 CTGTTTCCTCATCTACAGAGTGG - Intronic
962015234 3:131432171-131432193 TTGTGTCTTTCCCTTCAGGGTGG - Intergenic
962364361 3:134767899-134767921 CAGTGTCTTCTTCTTCAGGAAGG - Intronic
962698931 3:137978505-137978527 TTGTATCCTTCCCTTCAGGGTGG + Intergenic
963365119 3:144324162-144324184 CTGTGTCTTTCCCTTTAGGGTGG - Intergenic
964179483 3:153865900-153865922 ATGTGTCTTTCCCTTCAGGGTGG - Intergenic
964349894 3:155791906-155791928 TTGTGTCCTTCTCTTCTGGGTGG - Intronic
965059929 3:163772759-163772781 TTGTGTCCTTCCCTTCTGGGTGG + Intergenic
965526981 3:169731170-169731192 TTGTGTCTTTCCCTTCAGGGTGG - Intergenic
965742414 3:171889938-171889960 CTGGGTCCTTCCCTTCAAGGCGG + Intronic
965844598 3:172946770-172946792 TTGCGTCCTTCCCTTCAGGGTGG - Intronic
965871886 3:173274839-173274861 CTGTGGCCTGCTCTCCAGGATGG - Intergenic
966151188 3:176869092-176869114 TTGTATCCTTCCCTTCAGGGTGG - Intergenic
966312960 3:178615340-178615362 CTCTGTCCTTCCCTTCAGGATGG + Intronic
966427745 3:179798438-179798460 CTGTCTCCTCCTCACCAGGAAGG + Exonic
966915183 3:184580711-184580733 CTGTGCCCCCCTCACCAGGGCGG + Exonic
967123816 3:186407162-186407184 CTCGGCCCTTCTCTTCAGGGAGG - Intergenic
968088138 3:195883408-195883430 CTGTGAGCTCCTCATCTGGGTGG + Intronic
968096228 3:195932673-195932695 TTGTGTCTTTCTTTTCAGGGCGG - Intergenic
969401254 4:6957073-6957095 CTGTGTGCTCCTCTTGAGGGTGG + Intronic
969514395 4:7638444-7638466 CCTTGTCCTCCTCCTTAGGGTGG - Exonic
970413337 4:15832794-15832816 CCGTGTTCTTCTCTTCAGGTTGG + Intronic
970499351 4:16661480-16661502 CAGTTTCCTCATCTTCAGTGGGG + Intronic
971109608 4:23570366-23570388 CTGTGTCCTCATATTGAGTGAGG + Intergenic
971760285 4:30756401-30756423 CAGTTTCCTCATCTTCCGGGTGG - Intronic
971891540 4:32529816-32529838 CTGTGTCCTTCCCTTTAGGGTGG - Intergenic
972104078 4:35461190-35461212 CTATGTCCTTCCCTTCAAGGCGG + Intergenic
972851691 4:43057832-43057854 CTATGTCCTTCCCTTCAGGGTGG - Intergenic
973051754 4:45607386-45607408 CTGTGGCCTGCTCTCCAGGGTGG - Intergenic
973919723 4:55673077-55673099 TTGTGTCCTTCCCTTCAGAGAGG + Intergenic
974302724 4:60089709-60089731 CTTTGTCCTCTCCTTCAGTGAGG - Intergenic
975503983 4:75117815-75117837 CTGTGTCATTCTTTCCAGGGTGG - Intergenic
975620507 4:76291625-76291647 TTGTGTCCTCTTCTGCAGGAGGG - Intronic
975723686 4:77271913-77271935 CTGTATCCTCCTATTCAGACTGG - Intronic
975911075 4:79267655-79267677 TTGTGTCCTCCTCTTCTTGGGGG + Intronic
976016501 4:80560891-80560913 CTGTGTCCTTCCCTTTAGGGTGG - Intronic
976350592 4:84055915-84055937 CTGTCTACTTCTCTTCAAGGGGG + Intergenic
976762751 4:88568345-88568367 TTCTGTCCTTCTCTTCATGGTGG + Intronic
977753439 4:100635999-100636021 CTGTAGCCTTCTCTTCAGGATGG - Intronic
977935779 4:102803090-102803112 CTCTGTTCTCCTCTTGAAGGTGG - Intronic
978008570 4:103651122-103651144 TTGTGTCCTTCCCTTCAGGGTGG + Intronic
978082859 4:104616097-104616119 TTTTGTCCTGCCCTTCAGGGTGG + Intergenic
978116250 4:105023073-105023095 CTGTGTCCTTCCCTTCAGGGTGG - Intergenic
979073388 4:116240578-116240600 TTATGTCCTTCCCTTCAGGGAGG + Intergenic
979213205 4:118132131-118132153 TTGTGTCCTTCCCTTCAGAGCGG + Intronic
979445660 4:120808741-120808763 CCGTGCCCTCCCCTACAGGGAGG + Intronic
979573071 4:122252729-122252751 TTGTGTCTTTCCCTTCAGGGTGG - Intronic
980597005 4:134967185-134967207 TTGTGTCTTTCTTTTCAGGGAGG - Intergenic
980960480 4:139470117-139470139 CTGTGTCCTTCTCTTCAGGGTGG + Intronic
983698064 4:170557077-170557099 CTGTGTACTGCTCTTTAGCGTGG + Intergenic
985074739 4:186203361-186203383 CTGTGGCCTCCTCCACAGGTCGG + Intronic
985074746 4:186203402-186203424 CTGTGGCCTCCTCCACAGGCCGG + Intronic
985074754 4:186203445-186203467 CTGTGGCCTCCTCCACAGGCTGG + Intronic
986072626 5:4300995-4301017 CTGTTTCCCCCTCTTCTGGGTGG + Intergenic
986657498 5:10030144-10030166 CTGTGTCCTTCTTTTCAGGATGG + Intergenic
986667209 5:10114234-10114256 CAGTGTCCACCCCCTCAGGGGGG + Intergenic
986787216 5:11125454-11125476 CTTTGGCCTCCTCATCCGGGAGG + Intronic
986885156 5:12225619-12225641 TTGGGTCCTCCTCTTCAGGGTGG + Intergenic
986899280 5:12412482-12412504 CTCTGTCCTTCTTTTCAGGGTGG + Intergenic
987631540 5:20478681-20478703 TTGTGTCCTACCCTTCAGGGTGG - Intronic
987911771 5:24155620-24155642 CCGTTTCCTTCTCTTCAGAGTGG - Intronic
988064727 5:26219267-26219289 TTGTGTCTTTCTCTTCAGGGTGG - Intergenic
988694024 5:33601261-33601283 CCTTGTCCTCATCTTCAGGATGG + Intronic
989586149 5:43075186-43075208 CTGTGGCCTGTTCTCCAGGGTGG + Intronic
989672681 5:43936746-43936768 GTGTGTCCTTTGCTTCAGGGTGG - Intergenic
989681319 5:44032621-44032643 CTGTGTCCTTCCCTTCTGGGTGG - Intergenic
989970669 5:50520962-50520984 TCGTGTCCTTCCCTTCAGGGTGG + Intergenic
990251546 5:53920759-53920781 CTGTGTCCTCCTCTTCTTCCAGG + Intronic
990881682 5:60546273-60546295 CTCTGTGCTCCTTTTCTGGGTGG - Intergenic
990923726 5:60995751-60995773 CTGTGTCCTTCCCTTCAGAGTGG + Intronic
991209063 5:64083976-64083998 TTGTGTCCTTCCCTTCAGGGTGG + Intergenic
991987777 5:72307994-72308016 CGGTTTCCTCCTCTCCACGGTGG + Intronic
992291459 5:75283834-75283856 TTATGTCCTTCCCTTCAGGGTGG - Intergenic
992309641 5:75482450-75482472 CTATGTCCTTCCCTTTAGGGTGG - Intronic
992345273 5:75869584-75869606 CTTTGTCCTTCTCTTCAGGGTGG - Intergenic
992587245 5:78252806-78252828 CTGTGTCCTTCCCTTAAGGGTGG - Intronic
993382931 5:87228620-87228642 CTGTTTCCACCTCTGCAGTGAGG - Intergenic
993623392 5:90193577-90193599 GTGTGTCATTCCCTTCAGGGAGG - Intergenic
994235537 5:97358171-97358193 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
994274627 5:97821614-97821636 CTGGGCCCTTCCCTTCAGGGTGG + Intergenic
994292980 5:98051443-98051465 ATGTGTCTTTCCCTTCAGGGTGG - Intergenic
994974185 5:106780544-106780566 TTGTTTCCTTCTCTTCAGGGTGG - Intergenic
995096444 5:108240635-108240657 TTGTATCCTTCCCTTCAGGGTGG - Intronic
995206635 5:109487976-109487998 CGGTGCCCTGCTCTGCAGGGAGG + Intergenic
995697720 5:114899152-114899174 TTGTCTCCTTCCCTTCAGGGTGG + Intergenic
996116332 5:119624201-119624223 TTGTGTCCTTCCCTTCAGGGTGG + Intronic
996161702 5:120174268-120174290 CTATGTCCTTCCCTTCATGGAGG - Intergenic
996927619 5:128846577-128846599 TTGTGTCCTTCCCTTCAGGATGG - Intronic
997193165 5:131959081-131959103 CTGTTTCCTCCTCTTTACAGAGG + Intronic
997832740 5:137164995-137165017 CTGTGTCCTTCCCTTTAGGGTGG - Intronic
997890412 5:137671479-137671501 CTCTGTACCCCTCATCAGGGTGG + Intronic
1000047441 5:157533315-157533337 CTTTGTGCTCCTCTCAAGGGTGG - Intronic
1002540864 5:179906167-179906189 CTGTCTGCTCCTCTTCAGGGAGG + Intronic
1002936810 6:1680980-1681002 CTGTTGCCTCCTCGGCAGGGAGG + Intronic
1003084198 6:3048427-3048449 CGATGGCCTCCTCTTCAGGCAGG + Intergenic
1003622271 6:7711296-7711318 CAGTCTCCTCCTCTTGAGTGTGG - Intergenic
1003860592 6:10319008-10319030 CATTTTCCTCCTCCTCAGGGAGG - Intergenic
1004742221 6:18473033-18473055 CTGTGTTCTCCTCTGGAGGGAGG + Intergenic
1005819166 6:29582875-29582897 CTCCTTCCTCTTCTTCAGGGTGG - Intronic
1006055684 6:31382944-31382966 CTGTGTCCTCATCTTGAGGCTGG + Intergenic
1006238624 6:32658187-32658209 TTTTGTCCTCTTCCTCAGGGTGG - Intergenic
1006462856 6:34173598-34173620 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1007576032 6:42925650-42925672 CTGCCTCCTCCTCTGCAGGCTGG + Exonic
1008171608 6:48214402-48214424 ATGTGTCCTCCCCATGAGGGAGG + Intergenic
1008215170 6:48779054-48779076 CAGTGTTCTTCTCTTCAGGGTGG - Intergenic
1008314781 6:50026323-50026345 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1008731704 6:54491088-54491110 TTGTGTTTTCCTCTTCAGGGTGG + Intergenic
1008940600 6:57041419-57041441 TTGTTTCCTTCCCTTCAGGGTGG - Intergenic
1009028989 6:58034591-58034613 CAGTGTCTTCCTCCTCATGGTGG + Intergenic
1009204525 6:60785980-60786002 CAGTGTCTTCCTCCTCATGGTGG + Intergenic
1009301700 6:62031810-62031832 CTGTGTCCTTCCCTTCTGGGTGG - Intronic
1010328144 6:74588503-74588525 CTGTGTCCTTCCCTTCAGGGCGG - Intergenic
1010483496 6:76382149-76382171 CTATGTCCTTCCCTTCAGAGTGG + Intergenic
1011033282 6:82945041-82945063 TTGTGTTCTTCCCTTCAGGGTGG - Intronic
1011271168 6:85580928-85580950 TTGTGTCCTTCCCTTCAGGGTGG - Intronic
1011901413 6:92302626-92302648 CTGTGTTCTTCACTTTAGGGTGG - Intergenic
1012050002 6:94329120-94329142 CTGTGTCCTTCCCTTCACGTTGG - Intergenic
1012714355 6:102649447-102649469 CTGTGTCCTTCTCTTTAGTGTGG - Intergenic
1012717712 6:102698510-102698532 CTGTGTCCTTCCCTTCTGGATGG + Intergenic
1012940556 6:105410240-105410262 TTGTGTCCTTCCCTTCAGGATGG - Intergenic
1013687533 6:112602110-112602132 TTGTGTCCTTCCCTTCAAGGTGG - Intergenic
1014583120 6:123162363-123162385 CTATGTCCTTTCCTTCAGGGCGG - Intergenic
1014840723 6:126217816-126217838 TTGTGTCCTTCCTTTCAGGGCGG + Intergenic
1014865175 6:126520824-126520846 CTGTGTCCTTCTCTTCAGGGTGG + Intergenic
1014928466 6:127303971-127303993 CTGTGTTCTTCCCTGCAGGGTGG - Intronic
1015030390 6:128587208-128587230 CTGTGTCCTTTTCTTCAGGGTGG - Intergenic
1015959526 6:138632297-138632319 CTGTGTCCTTGCCTTCAGGGTGG - Intronic
1016136806 6:140554488-140554510 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1016231002 6:141803933-141803955 CTGTGTCCTTCTCTTCAGGGTGG + Intergenic
1016457300 6:144244729-144244751 TTGGGTCCGACTCTTCAGGGCGG + Intergenic
1016727818 6:147395837-147395859 GTCTTTCCTCCTCTTCATGGTGG - Intergenic
1017387456 6:153902115-153902137 TTGTGTCCTTCCCTTCAGGGCGG - Intergenic
1018141007 6:160837325-160837347 CTCTGTCCTCCGCTCCGGGGAGG + Intergenic
1018818094 6:167350960-167350982 CTCTGTCCTCCGCTCCGGGGAGG - Intronic
1019276276 7:177633-177655 CTGTGTGCTCCTGTGCATGGAGG + Intergenic
1019276294 7:177710-177732 CTGTGTGCTCCTGTGCATGGAGG + Intergenic
1019276312 7:177787-177809 CTGTGTGCTCCTGTGCATGGAGG + Intergenic
1019276346 7:177941-177963 CTGTGTGCTCCTGTGCATGGAGG + Intergenic
1019276364 7:178018-178040 CTGTGTGCTCCTGTGCATGGAGG + Intergenic
1019276381 7:178095-178117 CTGTGTGCTCCTGTGCATGGAGG + Intergenic
1019999833 7:4749441-4749463 AAGCGTCCTCCTCTGCAGGGAGG + Intronic
1020574736 7:9912741-9912763 TTGTGTCCTTCCCTTCAGAGTGG + Intergenic
1021130917 7:16912720-16912742 CTGTGTCCTTCCCTCCAGGGTGG + Intergenic
1021214513 7:17900380-17900402 TTGTGTCCTTCCCTTCAAGGTGG + Intronic
1021353809 7:19628713-19628735 CTGTGTCCTTCCCTTCAGGATGG - Intergenic
1021382327 7:19983368-19983390 CTGCGACCTGCTCTTCAGGGTGG + Intergenic
1022541945 7:31145899-31145921 TTGTGTCTTTCCCTTCAGGGTGG + Intergenic
1023876189 7:44287453-44287475 CTGTCTCCTCCCCTTCCTGGTGG + Intronic
1024170265 7:46777901-46777923 CTGGGTTCTTCTCTTCAAGGGGG - Intergenic
1024302970 7:47902159-47902181 CTGTCTCCTCCTGTCCAGGCTGG + Intronic
1024415092 7:49096858-49096880 CTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1024556728 7:50610118-50610140 CTGTGTCCTCCTCTGGAGGAAGG + Intronic
1026286728 7:68969762-68969784 CTGTTTCTTCCTGTACAGGGAGG - Intergenic
1028161009 7:87484324-87484346 TTGTATCCTTCCCTTCAGGGTGG - Intergenic
1028264381 7:88705207-88705229 CTGTGTCCTTCCTTTCAGGATGG + Intergenic
1029586769 7:101477696-101477718 CTGTGTCCTCCCCTTCACTCAGG - Intronic
1029701577 7:102249543-102249565 TTGTGTCCTCCTGTTCCGTGTGG + Exonic
1029797225 7:102908965-102908987 CTGTGTCCTCCTCTTCAGGGTGG + Intronic
1030222534 7:107111332-107111354 TTGTGTCCTTCCCTTCATGGTGG - Intronic
1030517435 7:110555528-110555550 TAATGTCCTCCTCTTGAGGGTGG + Intergenic
1030598958 7:111571151-111571173 CTGTGTCCTTCCCTTCAGGGAGG - Intergenic
1031189655 7:118531392-118531414 CTATGTCCTCAACTTCAAGGGGG - Intergenic
1031231542 7:119114051-119114073 CTGTGTCATTCCCTTTAGGGTGG + Intergenic
1031639039 7:124139837-124139859 CTGTGTCTTCCCCTTCAGGGCGG + Intergenic
1031753889 7:125613154-125613176 TTGTGTCCTTCTCTTCAGGGCGG - Intergenic
1032942426 7:136810377-136810399 CTGTGTCCTTCTTTTCAAGGCGG - Intergenic
1032952805 7:136935198-136935220 CACTGTACTCCTGTTCAGGGGGG + Intronic
1032972009 7:137175154-137175176 CTGTGTCCTTCCCTTCAAGGTGG - Intergenic
1033368040 7:140685990-140686012 CTGTGTCCTCCTCCACAGAAGGG + Intronic
1034018970 7:147619756-147619778 CTATGTCCTTCCCTTCAGGGTGG - Intronic
1034126488 7:148676109-148676131 TTGTGTCCTTCCCTTCAAGGTGG - Intergenic
1034972534 7:155428055-155428077 CTGTTTCCTGCACTTGAGGGGGG + Intergenic
1037295719 8:17397649-17397671 ATGTGTCCTTCCCTTCAGGGTGG - Intronic
1037922467 8:22817050-22817072 CTGGCTCACCCTCTTCAGGGAGG - Intronic
1037940096 8:22944796-22944818 CTGTTTCCTCATCTTTAGAGTGG + Intronic
1039468594 8:37800101-37800123 CTGTCTCCTCCCCATCAGGAAGG + Intronic
1039647380 8:39302935-39302957 CTTTGTCCTTCCCTTCAGGGTGG + Intergenic
1039887162 8:41661469-41661491 CTGTTTCCCCCTTTTCAGGCTGG + Intronic
1040408758 8:47134205-47134227 CTGTGTCCTTCTCGACAGGAGGG + Intergenic
1040575125 8:48645386-48645408 CTGTTTCCTCATCTGCAAGGTGG + Intergenic
1040701804 8:50075090-50075112 CTGAGTCCTACTTTTCAGGGAGG - Intronic
1041720411 8:60970255-60970277 CTGTCTCCTCATCTTCTGAGAGG + Intergenic
1042839247 8:73107386-73107408 CTCTGTTCTCCTCTTCCTGGTGG - Intronic
1043340200 8:79229165-79229187 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1043760497 8:84062529-84062551 CTGTGTCTTTCGCTTCAGGGTGG + Intergenic
1043922682 8:86001966-86001988 CTGTGTGCTCCTTTTCAAGGTGG - Intronic
1044395144 8:91702675-91702697 CTGTGTCTCTCCCTTCAGGGTGG + Intergenic
1045159556 8:99523292-99523314 TTGTGTCCTTCCCTTCAGAGTGG - Intronic
1045207175 8:100055082-100055104 TTGTGTCCTTCCCTTCAGGGTGG - Intronic
1045325315 8:101113324-101113346 CAGTGTCCTCATCTGTAGGGTGG - Intergenic
1045743654 8:105390589-105390611 CCGTATCCTCCTCTACAGTGAGG + Intronic
1048317656 8:133374310-133374332 CAGTGTCCTGCTCTGCAGGCAGG + Intergenic
1048390872 8:133963301-133963323 GTGTGTCCTCCTCCCCAGGAGGG - Intergenic
1048507403 8:135033897-135033919 CTGTGTCCTCCTCATGGGGCAGG + Intergenic
1049029741 8:140025252-140025274 CTGTGTCCTCTGCTTCCGGAGGG - Intronic
1049359643 8:142206234-142206256 CTGGGTCCTCCCTTTCAGGCCGG - Intergenic
1049509584 8:143020797-143020819 CTGTGTCCTCATCTGCAAAGTGG + Intronic
1050355957 9:4782626-4782648 CTATGTCCTTCACTTCAAGGTGG - Intergenic
1050471745 9:5999925-5999947 CTGTGTCCATCCCTTAAGGGAGG + Intronic
1050865114 9:10488524-10488546 CTGTGTCCTTCCATTCAGGATGG + Intronic
1051455070 9:17246614-17246636 CTGTGTCCTTCCCTTCAGTACGG + Intronic
1052063393 9:23987548-23987570 CTGTGTCTTTCCCTTCAGGATGG - Intergenic
1052258714 9:26490659-26490681 CTGTGTCCTTCCCTTCAAGATGG + Intergenic
1052605145 9:30689468-30689490 ATGTGTCCTCCCCGTGAGGGAGG - Intergenic
1055302133 9:74892613-74892635 TTGTGTCCTTCCTTTCAGGGTGG - Intergenic
1055373568 9:75625304-75625326 CTGGGAGCTCCACTTCAGGGAGG + Intergenic
1057216003 9:93229146-93229168 CTGTGTCCTCCTGCACAGGAGGG + Intronic
1058767881 9:108199276-108199298 CTGTGTCTTTTCCTTCAGGGTGG - Intergenic
1058876472 9:109249224-109249246 CTGTGTTCTGGTTTTCAGGGAGG + Intronic
1059515466 9:114890055-114890077 CTGCATCCTTCCCTTCAGGGTGG - Intergenic
1059839173 9:118192440-118192462 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1060175237 9:121492797-121492819 CAGTGCTCTCATCTTCAGGGGGG - Intergenic
1061241390 9:129375591-129375613 CTGTGAGCTCCTGTTCAGCGAGG + Intergenic
1061706914 9:132460308-132460330 CTGTGTTCTCCTCTGCAGAGTGG + Intronic
1061824018 9:133246792-133246814 CTGTGTTCTGCTCTCCCGGGCGG - Intergenic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1185499501 X:585791-585813 CAGGGTCCACCTCTGCAGGGCGG - Intergenic
1187314903 X:18183937-18183959 TTGTGTCCTTCCCTTCAGGGTGG - Intronic
1187610505 X:20938611-20938633 CTGTGCCCTTCCTTTCAGGGTGG + Intergenic
1188078554 X:25808006-25808028 CTGGGTCCTTCACTTCAAGGAGG + Intergenic
1188716322 X:33463805-33463827 TGGTGTCCTCTCCTTCAGGGAGG + Intergenic
1188815242 X:34705202-34705224 CTGTGTTCTTCACTTCAGGGCGG + Intergenic
1188846227 X:35076072-35076094 CTGTGTTCTTCCCTTCAGGGTGG + Intergenic
1188972221 X:36632370-36632392 TTATGTCCTTCCCTTCAGGGTGG + Intergenic
1189019676 X:37320916-37320938 CTGTGTCCTTCCTTTCAGGGTGG - Intergenic
1189628256 X:42921980-42922002 TTGTGTCCTTCTCTTCAGGGTGG - Intergenic
1189690487 X:43612686-43612708 CTGTGTTCTTCCCTTTAGGGTGG + Intergenic
1189874269 X:45419926-45419948 TTGTGTCCTTCCCTTCAGGGCGG + Intergenic
1190037894 X:47042779-47042801 TTGTGTCCTTCCTTTCAGGGTGG - Intronic
1190368209 X:49717184-49717206 TTGTGTCCTTTCCTTCAGGGTGG + Intergenic
1191150749 X:57219384-57219406 CTGTGGCCTGCTCTTTGGGGTGG - Intergenic
1191812418 X:65203462-65203484 CTGGGTCCTTTTCTTCAAGGTGG + Intergenic
1191892332 X:65956811-65956833 ATGTGTCCTCCCCGTGAGGGAGG + Intergenic
1192243908 X:69357868-69357890 CTCCTTCCTCCTCTTCAGGATGG + Intergenic
1192282921 X:69703365-69703387 CTGTGGCCTGCTCTCCAGGGTGG + Intronic
1192505565 X:71680087-71680109 CTTTGTCCTTCCCTTCAGGGTGG + Intergenic
1192521502 X:71805048-71805070 CTGTGTCTTTCCCTTCAGGGTGG - Intergenic
1192556099 X:72090694-72090716 CTGTGTTTGCCTCTTGAGGGAGG - Intergenic
1192714693 X:73627373-73627395 CTATGTCCTTCCCTTCAGGATGG + Intronic
1192812642 X:74560534-74560556 CTATGTCCTTTCCTTCAGGGTGG - Intergenic
1192826641 X:74704287-74704309 TTGTGTCCTCCCCTTCAAGGTGG + Intergenic
1192836204 X:74802138-74802160 CTGTGTCCTACCCTTCAGGGTGG - Intronic
1192908479 X:75578392-75578414 CTGTGTCCTTCCTTTCAGGGAGG + Intergenic
1192995408 X:76507322-76507344 ATGTGTCCTTCCTTTCAGGGTGG + Intergenic
1193213977 X:78840514-78840536 TTGTGTCCTTCCATTCAGGGTGG - Intergenic
1193366172 X:80636991-80637013 TTGTGTCTTTCCCTTCAGGGTGG + Intergenic
1193417151 X:81238571-81238593 CTGTGTTCTTCTCCTCAGTGTGG - Intronic
1193455388 X:81725285-81725307 CTGTTTCCTTCCCTTCAGGGAGG - Intergenic
1193676148 X:84454653-84454675 TTGTGTCCTTTTCTTCAGGATGG - Intronic
1193683649 X:84552258-84552280 CTGTGTCCTTCCTTTCAGGGTGG + Intergenic
1193815811 X:86103086-86103108 CTGGGTCTTTCACTTCAGGGTGG - Intergenic
1193830876 X:86288452-86288474 CTGTGTCCTTCCCTTCAGAGTGG + Intronic
1193880075 X:86910917-86910939 CTGTGTCTTTCCCTTCAGGGTGG + Intergenic
1193911912 X:87316612-87316634 TTATGTCCTTGTCTTCAGGGTGG + Intergenic
1194016328 X:88625564-88625586 CTGTGTCATTCCCTTCAGAGCGG - Intergenic
1194136681 X:90152265-90152287 CTTTGTCCTTCCCTTCAGGGAGG - Intergenic
1194223711 X:91227985-91228007 CTGTGTCTTCCCCTTCAGGGTGG - Intergenic
1194290997 X:92071900-92071922 CCATGGCCTTCTCTTCAGGGTGG + Intronic
1194481035 X:94424627-94424649 CTGTGTCCTTCCCTTCGGGGCGG + Intergenic
1194521970 X:94930833-94930855 CTGTGTCCATTGCTTCAGGGTGG + Intergenic
1194526563 X:94984089-94984111 TTGTGTCCTTCCCTCCAGGGTGG - Intergenic
1194568510 X:95523021-95523043 CTGTGTCCTTCCCTTCAGGATGG - Intergenic
1194857789 X:98956015-98956037 CTCTGTCTTTCCCTTCAGGGAGG + Intergenic
1194920863 X:99761873-99761895 CTGTGTTCTACCCTTCATGGTGG - Intergenic
1194990793 X:100544382-100544404 ATGTGGCCTTCCCTTCAGGGTGG - Intergenic
1195595533 X:106683917-106683939 TTATGTCCTTCCCTTCAGGGTGG - Intergenic
1195601364 X:106752134-106752156 TTGTGTCTTTCCCTTCAGGGTGG - Intronic
1195971429 X:110477854-110477876 CTGTGTCCTTCCCTTCAGGGTGG + Intergenic
1196247468 X:113416180-113416202 CTATGTCCTTCCCTTCAGGGTGG - Intergenic
1196357212 X:114809064-114809086 CTGTGTCCTTCCCTTCAGGGTGG + Intronic
1196399470 X:115299359-115299381 CTGTGTCCTTTCCTTCACGGTGG + Intronic
1196579098 X:117358824-117358846 CTGTATTCTTCCCTTCAGGGTGG + Intergenic
1196590900 X:117484446-117484468 CTGTGTTCTTCCCTTCAGGGTGG - Intergenic
1196619688 X:117807555-117807577 TTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1196625421 X:117871899-117871921 CTGTGCCCTTCCCTTCAGGGTGG - Intergenic
1197028260 X:121782174-121782196 CTGTTTCCTTCCCTTCAGGGTGG + Intergenic
1197139201 X:123097259-123097281 CTGTGTCCTTCCCTTCAGGGTGG - Intergenic
1197153507 X:123245527-123245549 CTGTGTCCACCTCCTCAATGAGG - Intronic
1197361038 X:125504324-125504346 CTGTGTCCTTCCCTTCAGGGAGG + Intergenic
1197382696 X:125765215-125765237 TTGTATCCTTCTCTTCAGGGTGG + Intergenic
1197399758 X:125975213-125975235 CTGTGTCCTTCACTACAGGATGG - Intergenic
1197469935 X:126855227-126855249 CTGTGTCCTTCCCTTCAGGGCGG + Intergenic
1197470074 X:126856194-126856216 CTGTGTTCTTCCCTTCAGGGTGG - Intergenic
1197527668 X:127582556-127582578 CTGTGCTCTTCACTTCAGGGTGG + Intergenic
1197600448 X:128520841-128520863 CTATGTCCTTCCCTTCAGGACGG - Intergenic
1197623463 X:128778603-128778625 TTGTGTTCTTCTCTTCAGGGTGG + Intergenic
1198462607 X:136877917-136877939 ATGTGTCCTCCCCGTGAGGGAGG + Exonic
1198788265 X:140314310-140314332 CTATGTCTTTCCCTTCAGGGTGG - Intergenic
1198841105 X:140859033-140859055 CTGTGTCCTTCCCTTCGTGGTGG - Intergenic
1199050652 X:143232857-143232879 CTGGGTCCTTTCCTTCAGGGTGG - Intergenic
1199148379 X:144397934-144397956 TTATGTCCTTCCCTTCAGGGTGG - Intergenic
1199173671 X:144759262-144759284 CTGTTTCCTTCTCTTAATGGTGG - Intergenic
1199191895 X:144980725-144980747 CTGTGTCTTCCCCTTCATGGTGG - Intergenic
1199239214 X:145526814-145526836 CTGTGTCCTTCCGTTCGGGGAGG - Intergenic
1199334258 X:146600151-146600173 CTGTGTTCTTCCCTTCAGGGTGG + Intergenic
1199358384 X:146887178-146887200 CTGTGTCCTTTGCCTCAGGGTGG - Intergenic
1199455113 X:148019974-148019996 TTGTATCCTTCCCTTCAGGGTGG + Intronic
1200107129 X:153720727-153720749 CTGTGTCTTTCTCTTGAGGGAGG - Intronic
1200177457 X:154126750-154126772 CAGTGTCGTCCCCTCCAGGGTGG - Intergenic
1200482428 Y:3722215-3722237 CTTTGTCCTTCCCTTCAGGGAGG - Intergenic
1200560175 Y:4691367-4691389 CTGTGTCTTCCCCTTCAGGGTGG - Intergenic
1200608506 Y:5296475-5296497 CCATGGCCTTCTCTTCAGGGTGG + Intronic
1201405209 Y:13643006-13643028 CTGTGTTCTCTCCTTTAGGGTGG - Intergenic
1202042713 Y:20701849-20701871 CTGGGTCCTTCCCTTCAGAGTGG - Intergenic
1202595511 Y:26535115-26535137 CTGTGTCCTTCCCTTCAGGATGG - Intergenic