ID: 1029799810

View in Genome Browser
Species Human (GRCh38)
Location 7:102934648-102934670
Sequence TGTGTTTCCCATACAAACAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 176}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029799807_1029799810 21 Left 1029799807 7:102934604-102934626 CCAGTCATCAAGCCTGAGGTGGA 0: 1
1: 0
2: 0
3: 7
4: 132
Right 1029799810 7:102934648-102934670 TGTGTTTCCCATACAAACACTGG 0: 1
1: 0
2: 0
3: 14
4: 176
1029799805_1029799810 22 Left 1029799805 7:102934603-102934625 CCCAGTCATCAAGCCTGAGGTGG 0: 1
1: 0
2: 1
3: 6
4: 133
Right 1029799810 7:102934648-102934670 TGTGTTTCCCATACAAACACTGG 0: 1
1: 0
2: 0
3: 14
4: 176
1029799808_1029799810 9 Left 1029799808 7:102934616-102934638 CCTGAGGTGGACTCAACTTTTTG 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1029799810 7:102934648-102934670 TGTGTTTCCCATACAAACACTGG 0: 1
1: 0
2: 0
3: 14
4: 176
1029799804_1029799810 23 Left 1029799804 7:102934602-102934624 CCCCAGTCATCAAGCCTGAGGTG 0: 1
1: 0
2: 0
3: 18
4: 187
Right 1029799810 7:102934648-102934670 TGTGTTTCCCATACAAACACTGG 0: 1
1: 0
2: 0
3: 14
4: 176
1029799803_1029799810 24 Left 1029799803 7:102934601-102934623 CCCCCAGTCATCAAGCCTGAGGT 0: 1
1: 0
2: 2
3: 8
4: 112
Right 1029799810 7:102934648-102934670 TGTGTTTCCCATACAAACACTGG 0: 1
1: 0
2: 0
3: 14
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029799810 Original CRISPR TGTGTTTCCCATACAAACAC TGG Exonic
903329961 1:22592287-22592309 TGTGTGTCCCTTGCAAACAGTGG + Intronic
905430058 1:37915792-37915814 TGTGTTTTATATACATACACAGG + Intronic
908235335 1:62142592-62142614 TGTATTTCCCACCCAATCACAGG - Intronic
908427200 1:64018617-64018639 TGTGTCTCCCATTCAAAGAGAGG + Intronic
915235600 1:154478535-154478557 TGTTTTTCAGATAAAAACACGGG - Intronic
916881318 1:169022083-169022105 TCTGTTCCCCACACACACACAGG + Intergenic
921636186 1:217496770-217496792 TGTATTTCCCCTACAAGCAATGG + Intronic
923020675 1:230160953-230160975 GCTGTTGCCCATAAAAACACTGG - Intronic
923633024 1:235667340-235667362 TGTGTTTACCATTCTATCACTGG - Intronic
924839796 1:247696978-247697000 TCTGTTTCCCTGACATACACGGG - Intergenic
1062853205 10:761387-761409 AGTCTTTCCTATATAAACACTGG + Intergenic
1063552036 10:7042509-7042531 TGTGTTGACCAGACAATCACAGG + Intergenic
1067543405 10:47174379-47174401 TGTGTTTTCCTTAGAAACCCTGG + Intergenic
1068264888 10:54633668-54633690 TGTCCTCCCCACACAAACACTGG + Intronic
1069210404 10:65751232-65751254 TGTGTTTCCCTTAGGAACAATGG + Intergenic
1070520900 10:77252570-77252592 TCTGTCTCTCATACATACACAGG - Intronic
1071786928 10:88911581-88911603 TGAGTATCCCATACATTCACTGG - Intronic
1073693094 10:105833516-105833538 TGTGTTTCCTGTACAAACTATGG - Intergenic
1075175314 10:120155108-120155130 TGTATTTCCCCTAGAAACAATGG + Intergenic
1080749934 11:35141979-35142001 TTGCTTTCCCATACAAAGACTGG - Intronic
1081263565 11:40990739-40990761 TGTATTTCAAATACATACACTGG + Intronic
1084451168 11:69239612-69239634 TGGGTTTTCCAATCAAACACTGG + Intergenic
1085056632 11:73408243-73408265 TGTGTTTCCCACACTAACCTGGG + Intronic
1086241424 11:84697100-84697122 TTTGTTTGCCCTATAAACACAGG - Intronic
1089083679 11:115798821-115798843 TGTGTTTCAAACACAAACCCAGG - Intergenic
1090483104 11:127085537-127085559 TGTGTGTCACATACAGATACAGG + Intergenic
1094855641 12:34401666-34401688 TGTGTTTTCCTTCCACACACAGG - Intergenic
1096679328 12:53244615-53244637 TGTGTTTCCATGACAGACACTGG - Intergenic
1099247195 12:80207026-80207048 TGTGTTTCTGATACAAACTTTGG - Intergenic
1100189932 12:92179655-92179677 TGTGTGTCCCATACAGAGCCAGG - Intergenic
1100291542 12:93219648-93219670 TATGTTTCCCATAGAAAGATTGG - Intergenic
1104594534 12:130112212-130112234 AGTGTTTCCCATCCCAGCACTGG + Intergenic
1105882810 13:24618420-24618442 GGTGTTTCCATTACACACACAGG + Intergenic
1106285500 13:28314994-28315016 TGTGTTTCCCATTCATACCCAGG - Intronic
1107389986 13:39953717-39953739 TGTGTCTCCCTGACAAATACTGG + Intergenic
1107922799 13:45227905-45227927 TGAGTTTGCCATACAAAGAAGGG + Intronic
1108480471 13:50865238-50865260 TATATTTCATATACAAACACAGG + Intergenic
1108755921 13:53502310-53502332 TGTGATTAGCTTACAAACACAGG + Intergenic
1109054390 13:57528296-57528318 TGTCTTTGCCATACAAACATTGG - Intergenic
1112005843 13:95253078-95253100 GGTGTTTTCCTTAGAAACACAGG - Intronic
1116738372 14:48723745-48723767 TCTATTGCCCATACAAATACAGG + Intergenic
1117867433 14:60164773-60164795 GGAGTTTCCCTTACAAACGCAGG + Intronic
1119952841 14:78763759-78763781 TGTGTGTCCCAGGGAAACACTGG - Intronic
1119957324 14:78812908-78812930 TGTTTTTTCCAGTCAAACACTGG - Intronic
1120788248 14:88556155-88556177 TTTTTTTCCCTTAGAAACACAGG - Intergenic
1122002627 14:98673947-98673969 TGTATTTCCCATACCAGCAATGG - Intergenic
1122680049 14:103452881-103452903 TGTGTGTCCCACACACACAATGG - Intronic
1125187065 15:36943306-36943328 TTTGTCTCCCATCCAAATACTGG + Intronic
1125821957 15:42639431-42639453 TGTGTTTCCTAACCAAATACTGG + Intronic
1127559389 15:60120606-60120628 TGTGTGTCACTTACAAATACAGG + Intergenic
1129246028 15:74279426-74279448 TGTGTTTATCATAGGAACACAGG + Intronic
1131638493 15:94263341-94263363 TGTATTTCCCCTACAAGCAATGG - Intronic
1135811122 16:25587694-25587716 TGTGTTTACCAAACAGACCCAGG + Intergenic
1138885780 16:61077026-61077048 TGTGATTCTAATACAATCACTGG + Intergenic
1140132856 16:72179283-72179305 TGTGTTTCCCATAGCACCAGGGG - Intergenic
1143493198 17:7295415-7295437 CTTGTTTCCAATACAAACATAGG - Intergenic
1144720350 17:17465008-17465030 TGAGTTTACCGTCCAAACACAGG - Intergenic
1144856232 17:18269716-18269738 TGTGTTCCAAAGACAAACACCGG + Intergenic
1147512549 17:41083949-41083971 AGTGTTTCCAATAGAAACACAGG + Intergenic
1147514716 17:41105131-41105153 AGTGTTTCCAATAGAAACACAGG + Intronic
1147837429 17:43344443-43344465 TCTGTTTCTCATACAAGAACTGG + Intergenic
1152289493 17:79431266-79431288 TGTGTTTCCCCTAGGAACAATGG - Intronic
1156688240 18:39675620-39675642 TCTGTTTCCCTTGAAAACACTGG - Intergenic
1156752777 18:40480012-40480034 TGTGAAACCCATACAAAAACAGG - Intergenic
1158850456 18:61491518-61491540 TGGGTTTCAGATTCAAACACAGG + Intronic
1166641521 19:44498633-44498655 CCTGTTTCCCAACCAAACACCGG + Intronic
925664893 2:6242316-6242338 TGTGTGTTACATGCAAACACGGG + Intergenic
926079279 2:9970922-9970944 CCGGTTTCCCATCCAAACACAGG - Intronic
926512832 2:13803594-13803616 TGGATTTCCCATAAAAAAACTGG - Intergenic
926600283 2:14835640-14835662 TGTATTTCCAATACATACCCAGG + Intergenic
927073188 2:19550661-19550683 TGTGTTCCCCATACAAAAAGAGG + Intergenic
928001159 2:27524071-27524093 TATGTTCCTCTTACAAACACGGG - Intergenic
928629835 2:33179919-33179941 TGGGTTTCAGATACAGACACAGG - Intronic
930401103 2:50889462-50889484 TTTGTTTCCCATCTAAACAAAGG + Intronic
940607581 2:155946749-155946771 TTTATTTCCCATATAAACACAGG + Intergenic
943025200 2:182619390-182619412 TGTGTGACCCATACAAGCAGAGG + Intergenic
946147777 2:217743895-217743917 TGAGTCTCCCATATAAACAATGG + Intronic
947090804 2:226509262-226509284 TGTGTTTACCATCCAACCAGTGG - Intergenic
947507438 2:230719617-230719639 TGTGTTTCCCACTGTAACACAGG - Intronic
1171109405 20:22466465-22466487 TGTGTTTCCCAGAAACAAACTGG + Intergenic
1172257804 20:33535313-33535335 TGGGATTCCCTTACAAAAACTGG + Intronic
1175840056 20:62021005-62021027 TGTTTTTCCCCTGGAAACACGGG - Intronic
1177083676 21:16675031-16675053 TGTTTTTGCCATACAAAGTCTGG - Intergenic
1183137771 22:35906243-35906265 TGTCTTTCCCCTACAGGCACTGG - Intronic
1183803298 22:40186346-40186368 AATGATTCCCATACCAACACTGG - Intronic
1184971890 22:48028403-48028425 TGTTTTTGACATACAAACAATGG + Intergenic
950027286 3:9828899-9828921 TGTCTCTCCCATCCAAACTCAGG - Intronic
951419107 3:22462836-22462858 TGTGTTTCCTATACAAATTTTGG - Intergenic
952126380 3:30305514-30305536 TGTGTTTCCAATAGATACAAAGG - Intergenic
953288699 3:41639988-41640010 TTGGTTTCTCATACACACACAGG - Intronic
953824052 3:46234641-46234663 TGTGTTCCACATAAAAACAAGGG - Intronic
954055810 3:48023707-48023729 TGTTTTTCTTATACAAGCACTGG + Intronic
954467987 3:50668290-50668312 TGTGCTTCCCCTCCAAACCCGGG + Intergenic
957054276 3:75432181-75432203 TATGTTTTCCATACAAACTCAGG - Intergenic
957886306 3:86291911-86291933 TATTTTTTCCATACAAACAACGG - Intergenic
960490865 3:118315005-118315027 AGACTTTCCCATACAAACAAAGG + Intergenic
963242828 3:143026584-143026606 TGTGTGTACCAGAAAAACACAGG + Intronic
963748706 3:149152118-149152140 TGTGTATCTTATACAAACAAAGG - Intronic
965113344 3:164455270-164455292 TATTTTTCACATTCAAACACTGG - Intergenic
965130060 3:164686605-164686627 TGTTCTTACCATACACACACAGG + Intergenic
965200064 3:165646731-165646753 TGTGTTTCGCTTTCAAACTCAGG + Intergenic
965352462 3:167630729-167630751 TGTGTTTCCCGTAGGAACAATGG - Intronic
966265067 3:178030537-178030559 TGTGTTTCCCAAACTGTCACTGG - Intergenic
967955021 3:194871485-194871507 TGTGTTTGCTATGCAAACACAGG + Intergenic
968220232 3:196932251-196932273 TGAGTTTCTCATACATACATTGG - Exonic
968607519 4:1542484-1542506 TGGGTTTATCTTACAAACACGGG + Intergenic
968894153 4:3388876-3388898 CATTTTTCCCATAAAAACACTGG - Intronic
969816893 4:9693766-9693788 TACGTTTTCCATACAAACTCAGG + Intergenic
970293962 4:14607631-14607653 TCTGTTTCCCTTACACACTCTGG - Intergenic
970990638 4:22209410-22209432 TGTGCTTCCCACCCAAACGCAGG - Intergenic
971607691 4:28679615-28679637 TGTGTTTCGCTTACAATCACAGG - Intergenic
972359889 4:38317035-38317057 TGTGTTTCCAATGCAAAAATGGG - Intergenic
972599481 4:40559302-40559324 TGTGTTTCTCAAACAATTACAGG + Intronic
973011004 4:45073088-45073110 TGTGTTTCCCAAGCAAACTGTGG - Intergenic
973650974 4:52996874-52996896 GGTGTTTCCAATAGAAGCACTGG - Intronic
974731031 4:65866618-65866640 TGTGCTTCCCAGACTAACATAGG + Intergenic
976755315 4:88491735-88491757 ATTGTCTCCAATACAAACACGGG - Intronic
979188309 4:117826466-117826488 TGCATTTCCCATAGAAACAATGG - Intergenic
979478663 4:121188351-121188373 TGTTTTTCCCAGACTAACATTGG + Intronic
983676091 4:170295013-170295035 TGTCTTTCCTATATAAACACAGG - Intergenic
984402870 4:179289380-179289402 TGTGTTAAACATACAAGCACAGG - Intergenic
984507043 4:180633141-180633163 GTTGTTTCCCAGCCAAACACTGG + Intergenic
985890044 5:2708395-2708417 GGTGTTTCCCGTAGAGACACCGG + Intergenic
985993411 5:3582450-3582472 TGTATTTCCCAAACAATCAGAGG + Intergenic
986142881 5:5048406-5048428 TGTGATTCCCTTTCAAGCACTGG - Intergenic
987077487 5:14397745-14397767 AGTGTTACCCATAAAGACACAGG - Intronic
987419677 5:17704381-17704403 TGTTTTTCCCTTACAAAAATAGG - Intergenic
990972452 5:61523746-61523768 TGTGTTTCCCATATTATTACAGG + Intronic
991336781 5:65557568-65557590 TGAGGTTCCCAGACAAACGCTGG + Intronic
996294885 5:121900784-121900806 TGTGTTTCCCATGAGGACACAGG + Intergenic
996582474 5:125047156-125047178 TGTTGTTCGCATACAACCACAGG - Intergenic
996689648 5:126326327-126326349 TGTGTTTTCTTTACAAAGACGGG - Intergenic
996904229 5:128578976-128578998 TGTGTTTCACAGACCAGCACTGG - Intronic
998999959 5:147909662-147909684 TGTCTGTCCTATACAAACAGTGG - Intergenic
1000176780 5:158763841-158763863 GGTCTTTCCCAAACCAACACAGG - Intronic
1000851065 5:166340928-166340950 TTTGTTTCCCAGACAAAGAAGGG + Intergenic
1004458686 6:15815889-15815911 TCAGTTTCCCAGACAAACTCAGG - Intergenic
1005041024 6:21600657-21600679 TGTGTGTACCCTACAAACACAGG - Intergenic
1009657529 6:66566342-66566364 TGTTTTTCCCATAAAACCCCAGG - Intergenic
1009702827 6:67204624-67204646 AGTCTTTCCCATACAAGCAAAGG + Intergenic
1009937996 6:70256227-70256249 TGTCTTTCCCATTGGAACACAGG + Intronic
1010690852 6:78909942-78909964 TCTGTTTCCCACAAAAATACAGG + Intronic
1011837233 6:91447931-91447953 TATGTTTCCCATAAAAAGAGAGG + Intergenic
1012464174 6:99499182-99499204 TGTGTTTAACATACAGGCACAGG + Intronic
1012468000 6:99537102-99537124 TGTGTATGCCATAGAAATACTGG + Intergenic
1012807614 6:103914930-103914952 AGTGTTTCTCATATAAACAGTGG + Intergenic
1012983360 6:105852753-105852775 TGGGATTCCCTTACAAAAACTGG + Intergenic
1014919477 6:127196565-127196587 TGTGTTTCTTATAAAAATACAGG - Exonic
1015289114 6:131518471-131518493 AGTCTTTCCCAGACAAACACAGG - Intergenic
1016158718 6:140848438-140848460 TGTATTTCCCATAGGAACAATGG - Intergenic
1018098913 6:160418744-160418766 AGTATATCCCATACAAAAACGGG - Intronic
1018184202 6:161251724-161251746 TACGTTTCCCATTCAAACATGGG + Intronic
1021982807 7:26071228-26071250 TGTGTATCTCATTCAAACAGTGG - Intergenic
1023045390 7:36205982-36206004 TGTGTCTTCCATTCACACACCGG + Intronic
1023223786 7:37948256-37948278 TGTGCTTAGCATACAAACATGGG - Intronic
1026647829 7:72187842-72187864 TGTGACTCCCATACAGATACAGG - Intronic
1027750451 7:82138174-82138196 TATGTTTCTCAAACAAAAACAGG - Intronic
1027962481 7:84964293-84964315 TGTGTTTGCCCTAGAAGCACTGG - Intergenic
1028143042 7:87292205-87292227 TGTGCTTCCCGGAGAAACACAGG - Intergenic
1028222957 7:88218897-88218919 TGCGTTTCCCGGACAAACTCAGG - Exonic
1029799810 7:102934648-102934670 TGTGTTTCCCATACAAACACTGG + Exonic
1030354343 7:108526115-108526137 TGAGCTTCCAACACAAACACTGG + Exonic
1030406934 7:109126905-109126927 TCTGTTTCACATCCACACACTGG - Intergenic
1035355686 7:158274815-158274837 TGCATTTCACATAGAAACACAGG + Intronic
1036736908 8:11327442-11327464 TGTCTTGGCCAGACAAACACAGG - Exonic
1039219139 8:35309052-35309074 ACTGTTTTCCATAAAAACACTGG + Intronic
1042018136 8:64340118-64340140 TGAGTATCTAATACAAACACAGG + Intergenic
1042067436 8:64893630-64893652 TGTGTGTCCAATACAAAAACAGG - Intergenic
1042856701 8:73274607-73274629 TGTCTTTCCCTTAAAAACATAGG - Intergenic
1043482787 8:80669712-80669734 TGTGTTTGCCTTATGAACACTGG + Intronic
1044080477 8:87876151-87876173 TGTTTTTCCCATATTAACACTGG + Intergenic
1046030314 8:108775460-108775482 TGTATTTCCCTTACAAACTTAGG + Intronic
1046200274 8:110918184-110918206 TCTGTTTTACATGCAAACACTGG + Intergenic
1047169534 8:122478036-122478058 AGTGTTTCCCATGCAAATATGGG + Intergenic
1047644503 8:126855753-126855775 TCTGTTTGCCATAAAAACAGAGG + Intergenic
1049935207 9:495072-495094 TGTGTTTCCTAGAGAAATACAGG + Intronic
1051307517 9:15729176-15729198 TTTGTTTCACATTCAAACTCTGG - Intronic
1052680485 9:31685364-31685386 TCTGGTTCCCAAACTAACACAGG + Intergenic
1053270510 9:36746308-36746330 TGTGTATCCCAGACAACCAAAGG + Intergenic
1053621978 9:39828675-39828697 TGTGTTTCCAACACAGACTCAGG - Intergenic
1054475339 9:65568544-65568566 TGTGTTTCCAATACCAGCAGGGG + Intergenic
1055013414 9:71591360-71591382 TGTGGTTCCCATACCTAAACCGG - Intergenic
1056373361 9:85981712-85981734 GGTATTACCCATACAAGCACAGG - Intronic
1056804962 9:89721354-89721376 TGTATTGCCCTTACACACACTGG - Intergenic
1059021571 9:110581755-110581777 TGTGTTCCCCACACAAACCAAGG + Intergenic
1061049730 9:128187347-128187369 TGTGCTTCCCATCCCAGCACTGG - Intronic
1187323633 X:18266095-18266117 TGTGCTTCCCATAAAAATATGGG - Intronic
1189515428 X:41709239-41709261 TGTGTTTCCCTTTCACCCACTGG - Intronic
1191903230 X:66060307-66060329 TGTTTTTACCATAAAACCACAGG + Intergenic
1195853445 X:109307277-109307299 TGTGTTTCCAATACACCCAGTGG - Intergenic
1202046449 Y:20741001-20741023 TGTTTATCCCAGACAAACCCTGG + Intergenic