ID: 1029800184

View in Genome Browser
Species Human (GRCh38)
Location 7:102938735-102938757
Sequence CAATTCTCATTGAAGTTCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 230}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029800184 Original CRISPR CAATTCTCATTGAAGTTCTA AGG Intronic
909658227 1:78054420-78054442 CAAATGTCCTTGAAGTTGTATGG + Intronic
909948091 1:81686492-81686514 CATTTCTCAGTGAAGTTATTTGG + Intronic
910142146 1:84037965-84037987 ATATTCTCTTGGAAGTTCTAGGG - Intergenic
910517078 1:88074012-88074034 CACTTCTCATGAAATTTCTAAGG - Intergenic
910915665 1:92285593-92285615 CAATTATACTTTAAGTTCTAGGG - Intronic
913240239 1:116823935-116823957 CATCTCTCATTGTAGATCTAGGG - Intergenic
916565262 1:165970183-165970205 TAATTATACTTGAAGTTCTAGGG - Intergenic
916757024 1:167781359-167781381 CAATTCTCATTAAATTTAAAAGG + Intronic
917006814 1:170424637-170424659 CAATTCTCAGGGACATTCTATGG + Intergenic
917729008 1:177855486-177855508 AAATTATCCTTTAAGTTCTAGGG - Intergenic
917833394 1:178917744-178917766 CATTTTTCATTAAAATTCTAAGG - Exonic
919158492 1:193799301-193799323 CCCTTCTCAATGAAGTTGTAAGG + Intergenic
919219347 1:194606551-194606573 TAATTATCCTTTAAGTTCTAGGG + Intergenic
920616671 1:207499364-207499386 TATTTCTCCTTGCAGTTCTATGG - Intronic
921021802 1:211242680-211242702 AAATTATCCTTTAAGTTCTAGGG - Intergenic
921300079 1:213743774-213743796 CACTTCTCATTGAGTTTCCAGGG - Intergenic
923271915 1:232363277-232363299 CAACCCTCATTAAAGTCCTAGGG + Intergenic
924456286 1:244221502-244221524 AAATTATACTTGAAGTTCTAGGG - Intergenic
1064216822 10:13407354-13407376 CAATTCTCCCTGACGTTCTCAGG - Intergenic
1066267414 10:33790002-33790024 CCATTATCATTGAATTGCTATGG - Intergenic
1068302175 10:55157934-55157956 AAATTATCCTTTAAGTTCTAGGG - Intronic
1068713794 10:60164073-60164095 AAATTATCATTCAAGTTGTAGGG + Intronic
1069198735 10:65587119-65587141 TAATTATACTTGAAGTTCTAGGG + Intergenic
1069251799 10:66276484-66276506 CAGTTCTCATTTATGTTTTAAGG + Intronic
1070041745 10:72787681-72787703 CAATTCTCAGACAAGGTCTATGG - Intronic
1070334948 10:75447093-75447115 GAATTTTCAATGTAGTTCTAGGG + Intronic
1071819660 10:89266837-89266859 CAATTCTCTCTGCAGTTCTCAGG - Intronic
1071854061 10:89605343-89605365 CAATTTTGAAAGAAGTTCTATGG - Intronic
1072302240 10:94072743-94072765 AAACTCTTATTGAAATTCTAGGG - Intronic
1072564895 10:96609386-96609408 TAATTCTCACTGAAGCTCTATGG - Intronic
1072817309 10:98522113-98522135 TAATTATCCTTTAAGTTCTAGGG - Intronic
1074231375 10:111539237-111539259 ACACTGTCATTGAAGTTCTATGG - Intergenic
1074414567 10:113255999-113256021 CAATTCTCATTGAACATTTTTGG - Intergenic
1077165629 11:1135511-1135533 CAAGTCTCAATAAACTTCTAAGG + Intergenic
1079002523 11:16769933-16769955 ACCTTTTCATTGAAGTTCTAGGG - Intergenic
1079495326 11:21036557-21036579 CAAGTCTAATTGGAGTTCCAAGG - Intronic
1080923768 11:36734646-36734668 CATTTCTAATTGAATTTCTTTGG - Intergenic
1081014338 11:37857581-37857603 CATTTCTCAGTGAAATGCTAGGG + Intergenic
1086761684 11:90639136-90639158 CAATTCACACTGAACTCCTAGGG + Intergenic
1087024869 11:93639997-93640019 CAATTTGCCTTGAAGTTCAATGG - Intergenic
1088685980 11:112284888-112284910 CAATTCTCAAGGAAATTCAAGGG + Intergenic
1090102387 11:123813061-123813083 CAATTCTGTTTTAAGTTCTTTGG + Intergenic
1092929147 12:13298877-13298899 CAATTCTACTTCAAGTTCTGAGG + Intergenic
1094420831 12:30269420-30269442 AATTTTTCATTGAAATTCTAGGG - Intergenic
1095980144 12:47968127-47968149 AAATCTTCACTGAAGTTCTAGGG - Exonic
1096032136 12:48428453-48428475 CATTTCTCATTGAGGTTATTTGG - Intergenic
1097788346 12:63786797-63786819 CAATTTTGAAAGAAGTTCTATGG - Intronic
1097859260 12:64502006-64502028 TAATTGTCATTAAAATTCTAAGG + Exonic
1099929901 12:89061540-89061562 TAATTCTCATAAAAATTCTATGG + Intergenic
1101887136 12:108674945-108674967 CAATTTTGAAAGAAGTTCTATGG + Intronic
1102874574 12:116439735-116439757 GAATTCTCATAGCAGTCCTAGGG + Intergenic
1104615636 12:130266035-130266057 CAATTCTCTGTTAAGTTTTATGG + Intergenic
1106507757 13:30386390-30386412 CATTTCTCATTGATGTTCCTTGG - Intergenic
1106792800 13:33172873-33172895 CAAATCTCCTTGAATTTCTATGG + Intronic
1106989305 13:35398003-35398025 CAATTTTGAAAGAAGTTCTATGG - Intronic
1107182929 13:37483171-37483193 CAACTCTCATTCTAGTTCTTTGG - Intergenic
1109979566 13:69889300-69889322 CCATTCCCTTTGAAATTCTAAGG - Intronic
1110426615 13:75374436-75374458 AAATTCTACTTGAAATTCTAAGG - Intronic
1113519718 13:110931423-110931445 CATTTCTCATTCAATTTCAAAGG + Intergenic
1115110334 14:29813530-29813552 TTATTCTCATTATAGTTCTAGGG + Intronic
1115362859 14:32523307-32523329 AAATTCTACTTTAAGTTCTAGGG - Intronic
1116254380 14:42532300-42532322 TAATTCTACTTTAAGTTCTAGGG - Intergenic
1116312836 14:43347386-43347408 CAATTATACTTTAAGTTCTAGGG - Intergenic
1116377111 14:44216876-44216898 AAATTCTACTTTAAGTTCTAGGG - Intergenic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1118898724 14:69968951-69968973 CAGTTGTCCTTGAAGTTCTGAGG + Intronic
1119924305 14:78477821-78477843 TAATTTTCATAGAAGTTCTAAGG + Intronic
1120108982 14:80530540-80530562 AAATTATCATTAAAGTTTTAGGG + Intronic
1120545490 14:85806502-85806524 CATTTCTCATTGAAGTTATTTGG + Intergenic
1122662324 14:103305443-103305465 CAATTTTCAAAGAAGTTCTACGG - Intergenic
1122956230 14:105072807-105072829 CCATTCTCATTGAAGTGAAAAGG - Intergenic
1123724802 15:23091365-23091387 CAATGATAAGTGAAGTTCTAGGG - Intergenic
1127446883 15:59072323-59072345 CAATTCTGAAAGAAGTTCTATGG - Intronic
1130168581 15:81487750-81487772 AAATTATACTTGAAGTTCTAGGG + Intergenic
1131367294 15:91852369-91852391 CCATTCTCATTCAAGTTCTTCGG + Intergenic
1132475167 16:131846-131868 CAATTCTGAAAGAAGTTCTGTGG - Intronic
1140019951 16:71229285-71229307 TTATTCTCCTTTAAGTTCTAGGG - Intronic
1144407916 17:14970445-14970467 CATTTCTCATTGAGGTTATTTGG + Intergenic
1146756925 17:35440982-35441004 CAATTCTCAGTGAAGCTAAATGG - Exonic
1149228458 17:54503619-54503641 CAATTTTGAAAGAAGTTCTATGG + Intergenic
1149338067 17:55658192-55658214 CAATGCTCATTGATGATCTGTGG - Intergenic
1154266327 18:12882416-12882438 CAATTCTCATTGAATTTTCAAGG + Intronic
1156228551 18:35132276-35132298 TAATTCTCATTGAGGTCCTGGGG - Intronic
1156502651 18:37569327-37569349 CATTTCTCTTTGATGATCTAAGG - Intergenic
1156728256 18:40157276-40157298 CAATTATACTTTAAGTTCTAGGG + Intergenic
1156814473 18:41293221-41293243 CAATACTAATTTAAGTTCTTTGG + Intergenic
1157372727 18:47131489-47131511 CAATTCCCACTGTAGTTCTTTGG - Intronic
1158960265 18:62582351-62582373 CAATTCTCATTTTACATCTAGGG - Intronic
1159227525 18:65558265-65558287 TAATTATAATTTAAGTTCTAGGG - Intergenic
1159283070 18:66311686-66311708 CATTTCTCATTGAAATTCACTGG + Intergenic
1163057743 19:14733942-14733964 CAATACTCATTGAGCTTATACGG + Exonic
1163677400 19:18662231-18662253 CAAATCTCCTTGAACTTCTAAGG + Intronic
1165969856 19:39618501-39618523 CAATTATAATTTAAGTTCTGGGG + Intergenic
1166208971 19:41293321-41293343 CATTTATCATTGAGATTCTATGG + Intronic
1167974463 19:53213571-53213593 CCATGCTCATTGGATTTCTAAGG - Intergenic
926938724 2:18113414-18113436 CAATTCTCATTAAACATCCAGGG + Intronic
927269939 2:21196006-21196028 CAATTATTTTTTAAGTTCTAGGG - Intergenic
927821530 2:26269897-26269919 AATTTTTCATTGAAGCTCTAGGG + Intronic
928475621 2:31624375-31624397 TAATTCTACTTTAAGTTCTAGGG + Intergenic
930378880 2:50602155-50602177 CAAATCTCATTGAAATCCTATGG - Intronic
932116885 2:69059194-69059216 CAATTTTGAAAGAAGTTCTATGG + Intronic
933386649 2:81619311-81619333 TAATTATTATTAAAGTTCTAGGG - Intergenic
933397612 2:81752863-81752885 CATTTCTCTTGGGAGTTCTAGGG + Intergenic
935428014 2:102941674-102941696 CTATTTTCTTTAAAGTTCTAGGG - Intergenic
935463953 2:103372939-103372961 CAATTCTCACAGAAGTGCAAAGG - Intergenic
936856408 2:116963463-116963485 GAATTGTCCTTGAAGTTCTTAGG + Intergenic
937466894 2:122140912-122140934 TAATTATCCTTTAAGTTCTAGGG + Intergenic
937572502 2:123381110-123381132 ATATTCTCTTGGAAGTTCTAGGG + Intergenic
937617500 2:123943643-123943665 CAATTCTTAGGGAAGTCCTAGGG + Intergenic
940524114 2:154790557-154790579 CATTTCTCACTGTAGTTCCATGG + Intronic
940823088 2:158379492-158379514 CAATTTTGAAAGAAGTTCTATGG + Intronic
941204197 2:162551022-162551044 TTATCCTCCTTGAAGTTCTAAGG - Intronic
941227702 2:162868872-162868894 CAATGTTCTTTTAAGTTCTAAGG - Intergenic
942065236 2:172264719-172264741 AAATTATACTTGAAGTTCTAGGG + Intergenic
943077245 2:183210264-183210286 CAATTATACTTTAAGTTCTAGGG + Intergenic
943478760 2:188391675-188391697 CTTTTCTCATTGAGGTTCTCAGG + Intronic
943616426 2:190097559-190097581 CAATTTTGAAAGAAGTTCTAAGG - Intronic
945226726 2:207538806-207538828 CAATTTTAAGTGAATTTCTAAGG + Intronic
946561494 2:220918921-220918943 CAATTATGATTGAAGATGTAAGG - Intergenic
947024533 2:225722237-225722259 CCATTCTCATTAAAGTTTTAAGG - Intergenic
948088594 2:235271469-235271491 CAATTCTCATGGAAGGTCTTAGG - Intergenic
1170902415 20:20478024-20478046 CAAATCTCAATAAATTTCTAGGG + Intronic
1171327152 20:24304828-24304850 CAATGCTCATTGAAAATATAGGG - Intergenic
1174861403 20:54095073-54095095 AAATTCTACTTTAAGTTCTAGGG + Intergenic
1175559826 20:59913099-59913121 GTATTCTTATTTAAGTTCTATGG - Intronic
1177646253 21:23903063-23903085 TAATTCTCCTTTAAGGTCTATGG - Intergenic
1177869337 21:26551852-26551874 CAATTTTGAAAGAAGTTCTACGG + Intronic
1179485453 21:41707294-41707316 GAATTCTCACTGAAGTTGAAGGG - Intergenic
951336442 3:21428434-21428456 AAATTCTTAGTGAATTTCTAAGG - Intronic
951963668 3:28356983-28357005 CAATTATACTTTAAGTTCTAGGG - Intronic
952094208 3:29928945-29928967 CCTTTGTCATTGAAGCTCTAAGG + Intronic
952614341 3:35251357-35251379 GAATTTTCATTGAAGTAATAAGG + Intergenic
952805849 3:37351057-37351079 CAATTTTGAAAGAAGTTCTATGG - Intronic
952810185 3:37395519-37395541 CAATTTTGAAAGAAGTTCTATGG + Intronic
953593935 3:44289589-44289611 CAATTTTCCTTGGAGTTCAAAGG + Intronic
956690830 3:71876397-71876419 CAATTGTCAGAGAAGTTCTTGGG - Intergenic
957694378 3:83615783-83615805 GAATTCTCACAGAAGTTCTTAGG - Intergenic
958121481 3:89295488-89295510 CAATTTTGAAAGAAGTTCTATGG - Intronic
959293710 3:104507789-104507811 CATTTCTCTTTGAAGTTATATGG - Intergenic
960029430 3:113042428-113042450 CAAATCTCATGGAAGTACAATGG - Intergenic
961995719 3:131239931-131239953 CAGTTCTCATTGAAGCTGAATGG - Intronic
962401583 3:135064555-135064577 CATTTCTCATTGAGGTTATTTGG + Intronic
963216911 3:142758689-142758711 CAATTATACTTTAAGTTCTAGGG + Intronic
965074284 3:163956605-163956627 CAATTCTCTTTTAAGTTTCATGG + Intergenic
967326125 3:188241816-188241838 CATTACTCTTTGAAGTTATAGGG - Intronic
971165435 4:24177599-24177621 TAATTATACTTGAAGTTCTAGGG - Intergenic
971477440 4:27085546-27085568 TATTTCTCAATGAAGATCTAGGG + Intergenic
971552179 4:27971155-27971177 CAATTCACCATGAAGTTCTTGGG + Intergenic
972248169 4:37268340-37268362 CCATTCTGAATGAACTTCTAGGG + Intronic
974403142 4:61429478-61429500 CAATTATCATTGTAGTTCTTTGG - Intronic
975002267 4:69239107-69239129 AAATTATAATTTAAGTTCTAGGG - Intergenic
975010371 4:69343148-69343170 AAATTATCCTTTAAGTTCTAGGG - Intronic
975269425 4:72412707-72412729 CAATTTTGATTCAAGTTTTAAGG + Intronic
975902099 4:79165288-79165310 CACTTCTCATTGCAGGTCTTGGG - Intergenic
977612721 4:99052831-99052853 CAATTTTCAAAGAAGTTCTGTGG - Intronic
978533178 4:109734447-109734469 AGAGTCTCATTGAAGTACTAGGG + Intergenic
979727375 4:123979327-123979349 CAAGTCTCAGTGAATTTCAAAGG + Intergenic
980987502 4:139709950-139709972 CAATTCTCTTTTAAGTACTAAGG - Intronic
981316762 4:143348274-143348296 CATTTCTCATTCCAGATCTATGG + Intronic
982077193 4:151749617-151749639 TAATTATACTTGAAGTTCTAGGG - Intronic
983668864 4:170213235-170213257 AAATTCTACTTAAAGTTCTAGGG - Intergenic
984274439 4:177592889-177592911 CAATGTTCATTTAATTTCTATGG - Intergenic
985021417 4:185695004-185695026 CAATTCTGCTTGAATTTCTTTGG + Intronic
985108615 4:186523811-186523833 TAATTATACTTGAAGTTCTAGGG + Intronic
985481550 5:114317-114339 CAATTCTGAACGAAGTTCTATGG - Intergenic
986914174 5:12596108-12596130 CAATTCTAATCCAAGTGCTATGG - Intergenic
987704245 5:21443256-21443278 CATTTCTCAGTGAAGTTATTTGG + Intergenic
988388654 5:30598926-30598948 TTATTATTATTGAAGTTCTAGGG + Intergenic
990068042 5:51742762-51742784 CAATTTTAAAAGAAGTTCTACGG - Intergenic
991393630 5:66178504-66178526 CAATTCTAATTTAATTTCCATGG + Intronic
992335784 5:75767684-75767706 CATTTCTAATTGAAGTTGTTTGG + Intergenic
993408743 5:87547844-87547866 CAATTATACTTTAAGTTCTAGGG + Intergenic
994374127 5:98998943-98998965 CACTTCTCCTGGAATTTCTAGGG - Intergenic
994945526 5:106383136-106383158 GAATTCTCCTTGAGGTACTAGGG + Intergenic
995658752 5:114457052-114457074 CAATTTTGAAAGAAGTTCTATGG + Intronic
995750412 5:115448180-115448202 CAATTATACTTTAAGTTCTAGGG - Intergenic
996794090 5:127325357-127325379 CAATACTCATTAAAGATCTAAGG - Intronic
999057453 5:148594793-148594815 TAAGTCTCCATGAAGTTCTATGG + Intronic
999617326 5:153438056-153438078 CATATCTCATTGAAAATCTAAGG + Intergenic
1000453925 5:161425235-161425257 CAATTTTGAAAGAAGTTCTATGG + Intronic
1000532980 5:162446461-162446483 AAATTATACTTGAAGTTCTAGGG - Intergenic
1000592173 5:163171171-163171193 AAATTATAATTTAAGTTCTAGGG - Intergenic
1001356776 5:171034420-171034442 CATGTCTCATTGCAGTTCTTTGG - Intronic
1005789862 6:29287660-29287682 TAATTGTCATTAAAGTACTATGG + Intergenic
1006438692 6:34040278-34040300 CCATTCTCATTGAAGGTCACAGG + Exonic
1007603240 6:43096931-43096953 GAATTCTTAATGAGGTTCTAAGG - Intronic
1008306063 6:49901512-49901534 CAATTCCCATTGTTGTTCAAGGG + Intergenic
1008354575 6:50537005-50537027 TAATTATAATTTAAGTTCTAGGG + Intergenic
1008732366 6:54497720-54497742 CAATTATACTTTAAGTTCTAGGG - Intergenic
1009574686 6:65437868-65437890 CAATTATACTTTAAGTTCTAGGG + Intronic
1009827600 6:68886912-68886934 GAACTTTCATTGAAGTTATAGGG - Intronic
1010880071 6:81156352-81156374 CAATTCTCATTGAGCTTATTTGG - Intergenic
1011144871 6:84202795-84202817 TAAATCTCATTAAATTTCTAAGG + Intronic
1012084265 6:94803733-94803755 CAATTTTGAAAGAAGTTCTATGG + Intergenic
1014684078 6:124473238-124473260 CAATGCTCATTGTAAGTCTAGGG + Intronic
1021051227 7:15987788-15987810 CAATTCTAATTTGAGTTCAAAGG - Intergenic
1021394357 7:20129086-20129108 CAATTCTCATTTAATTTATTTGG + Intergenic
1023816084 7:43951037-43951059 AAATTCTGATTTAAATTCTAGGG + Intronic
1025794531 7:64726527-64726549 CATTTCTAATTGAGGTTCTTTGG + Intergenic
1027294293 7:76751478-76751500 CAATTTTGAAAGAAGTTCTATGG + Intergenic
1029800184 7:102938735-102938757 CAATTCTCATTGAAGTTCTAAGG + Intronic
1031098793 7:117452639-117452661 TAATGATCATTGAATTTCTATGG - Intergenic
1031778395 7:125931134-125931156 GAATTCTCATGGAAGTTTTCTGG - Intergenic
1032375080 7:131405804-131405826 CAAGTCTCATTAAATTTCAAAGG - Intronic
1034703111 7:153113901-153113923 CACTTCCCAGTGAAGTGCTAGGG + Intergenic
1038702882 8:29866298-29866320 TATTTCTCCTTGCAGTTCTATGG - Intergenic
1040070533 8:43183647-43183669 AAATTATCCTTTAAGTTCTAGGG + Intronic
1043138162 8:76554027-76554049 TTATTTTCATTTAAGTTCTATGG + Intergenic
1043253031 8:78100116-78100138 CAATTCTCATTGCAGTTTAGTGG - Intergenic
1044255132 8:90051153-90051175 TAATTATACTTGAAGTTCTAGGG - Intronic
1044976716 8:97672319-97672341 AAATTCTCATTGTAGTCCTTTGG + Intronic
1045384829 8:101662200-101662222 CAATTTTCTTTGCAGTTCAAAGG + Intronic
1045695114 8:104800705-104800727 CCATGCTGATTGAAGTTTTATGG + Intronic
1045881199 8:107042739-107042761 CATTTCTCAGTGAAGTTATTTGG + Intergenic
1046334121 8:112760665-112760687 TAAAACTCATTGAAGTTCAAGGG - Intronic
1050462368 9:5887444-5887466 CAGGTCTCATTCAAGTTCTCTGG - Intronic
1050688049 9:8193907-8193929 CATTTCTCATTGTAGTTATTTGG - Intergenic
1050859646 9:10411163-10411185 AAATTCTAAGTGAACTTCTAAGG + Intronic
1051600216 9:18865051-18865073 TAATTATACTTGAAGTTCTAGGG + Intronic
1052403753 9:28033228-28033250 CAAATCTCATTGAATTCCTATGG + Intronic
1055405925 9:75973798-75973820 CAACTCTCATTTTAGTGCTAAGG + Intronic
1056895359 9:90542366-90542388 CAGTTCTCAGTGAAGACCTAGGG + Intergenic
1058207430 9:102126402-102126424 TAATTATAATTTAAGTTCTAGGG + Intergenic
1058502052 9:105630180-105630202 TAATTATACTTGAAGTTCTAGGG - Intronic
1059210301 9:112508393-112508415 AAATTCTCATTCTATTTCTAAGG + Intronic
1059983562 9:119799390-119799412 CAATCCTCCTAGAAGCTCTAGGG + Intergenic
1186619702 X:11226012-11226034 TAATTATCCTTTAAGTTCTAGGG + Intronic
1187419992 X:19125676-19125698 CAATTACATTTGAAGTTCTAAGG - Intergenic
1189354013 X:40298078-40298100 CTATCCTCATTGAAGTTTTCTGG - Intergenic
1190867495 X:54397131-54397153 CAATTCTCCTTAAAGTGCTTGGG - Intergenic
1192679365 X:73235700-73235722 TAATTATCATTTAAGTTCTAGGG - Intergenic
1193807297 X:86010333-86010355 TAATTATCCTTTAAGTTCTAGGG - Intronic
1194070227 X:89314568-89314590 AAATACTCATTGAACTTATAAGG - Intergenic
1194354642 X:92867328-92867350 AGATTCTCATAAAAGTTCTAAGG - Intergenic
1194602402 X:95938588-95938610 CATTTCTCATTGAACTTATTTGG + Intergenic
1195436189 X:104846208-104846230 TAATTATCCTTTAAGTTCTAGGG + Intronic
1195909352 X:109874285-109874307 TAATTCTCTTTGTACTTCTATGG - Intergenic
1196538226 X:116873046-116873068 CTCTTCTCATTGAAGATCTGAGG + Intergenic
1196608732 X:117686455-117686477 AAGATCTCATTGAATTTCTATGG + Intergenic
1196619807 X:117808614-117808636 ACATTCTCTTGGAAGTTCTAGGG + Intergenic
1197375808 X:125680902-125680924 CAATTTTCAGTGAAGTGATAGGG - Intergenic
1198460507 X:136858722-136858744 TTTTTCTCATTGAAGTTATAAGG - Intronic
1198923996 X:141766499-141766521 TACTTCTCATTGAACTTCCATGG + Intergenic
1198981462 X:142401749-142401771 CAATTCTCATTGCTCTACTATGG - Intergenic
1199595478 X:149503350-149503372 CCATTCTCCTTGAAGTACTGGGG + Intronic
1199598400 X:149525861-149525883 CCATTCTCCTTGAAGTACTGGGG - Intronic
1200663006 Y:5984359-5984381 AGATTCTCATAAAAGTTCTAAGG - Intergenic
1200724465 Y:6650193-6650215 AAATACTCATTGAACTTATAAGG - Intergenic
1200987072 Y:9312932-9312954 CTATTATACTTGAAGTTCTAGGG + Intergenic
1202091638 Y:21196869-21196891 TAATTATCCTTTAAGTTCTAGGG - Intergenic