ID: 1029800439

View in Genome Browser
Species Human (GRCh38)
Location 7:102941312-102941334
Sequence CAGGGTAAAGAATCTGGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 375}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029800431_1029800439 5 Left 1029800431 7:102941284-102941306 CCAGTGTCATGTCCACAAAGCCA 0: 1
1: 0
2: 0
3: 27
4: 178
Right 1029800439 7:102941312-102941334 CAGGGTAAAGAATCTGGAAGTGG 0: 1
1: 0
2: 1
3: 31
4: 375
1029800436_1029800439 -7 Left 1029800436 7:102941296-102941318 CCACAAAGCCAGGGTACAGGGTA 0: 1
1: 0
2: 2
3: 12
4: 145
Right 1029800439 7:102941312-102941334 CAGGGTAAAGAATCTGGAAGTGG 0: 1
1: 0
2: 1
3: 31
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029800439 Original CRISPR CAGGGTAAAGAATCTGGAAG TGG Intronic
901078811 1:6572071-6572093 CAGGGTAGAGGGCCTGGAAGAGG - Intronic
901333932 1:8432249-8432271 CAGGGAAAGGAATCAGGATGGGG - Intronic
902580895 1:17406902-17406924 CAGGAAAAAGAATTTGAAAGAGG - Exonic
903253348 1:22073234-22073256 TAGTGTTAAGAACCTGGAAGAGG + Intronic
907669107 1:56459085-56459107 CAGGCAGAAGAATGTGGAAGAGG + Intergenic
908035608 1:60048417-60048439 CAGGGAAAGGAATCTAGGAGTGG - Intronic
908782146 1:67700477-67700499 GAAGGTAATGAAGCTGGAAGAGG - Intergenic
909032907 1:70562464-70562486 GTGGGTAAAGAATTTGGAAAGGG + Intergenic
909151990 1:72018660-72018682 TAGGGAAAAGAAACTGGCAGCGG + Intronic
910259151 1:85279156-85279178 AAGGGGAAAGAAGATGGAAGAGG + Intergenic
910263835 1:85317183-85317205 CAAGCTATAGATTCTGGAAGTGG - Intergenic
910306442 1:85769664-85769686 CAGGCTGCAGAATCTGGTAGAGG + Intronic
910353230 1:86324017-86324039 GAGGGTTAGGAATCTGAAAGGGG + Intergenic
912359149 1:109080441-109080463 AAGGGGAAAGAAGTTGGAAGTGG + Intergenic
912769007 1:112445229-112445251 GAGGGTCAGGAATCTGGGAGGGG - Intronic
915469738 1:156118683-156118705 TAGAGTAAAGAATTTGGGAGAGG + Intronic
915575374 1:156772653-156772675 CTTGGTAAACAATCTGAAAGTGG - Intronic
916363465 1:163997515-163997537 GATGGTAAAGAATTTGTAAGGGG + Intergenic
917405183 1:174698258-174698280 CAGGTGAAAGAATATGGAAAGGG - Intronic
917809035 1:178639672-178639694 TAGAGTAAAAAAACTGGAAGTGG - Intergenic
917874166 1:179270515-179270537 CAGGAGAAACAATCAGGAAGAGG + Intergenic
918780277 1:188690818-188690840 CAAGGGAAAGAATAAGGAAGGGG + Intergenic
919212150 1:194500842-194500864 CAGTGTAAAAAATCTGCAATGGG - Intergenic
920365746 1:205447580-205447602 CAGGGGAAGGAATGTGGGAGTGG + Intronic
921745918 1:218740764-218740786 CAGAGTAAAATATTTGGAAGTGG - Intergenic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
922052882 1:222011071-222011093 TAGGGTCAGGAATTTGGAAGTGG + Intergenic
924157523 1:241194757-241194779 CAGGGCAAATAATCTGACAGAGG + Intronic
924528919 1:244876992-244877014 TGGGTTAAAGAATCTTGAAGGGG + Intergenic
924954880 1:248916570-248916592 CAGGAAACAGAATCAGGAAGAGG - Intronic
1067039965 10:42944656-42944678 GAGGGTAAAGTAGCTTGAAGGGG + Intergenic
1067704450 10:48596584-48596606 CAGGGTGAAAAGCCTGGAAGTGG - Intronic
1068284208 10:54913464-54913486 CAGGCAGAAGAATGTGGAAGGGG + Intronic
1068466057 10:57393659-57393681 CAAGGTAAACAGTTTGGAAGTGG + Intergenic
1069142143 10:64839974-64839996 CAGTGTAGAGAATTTGGAAAGGG - Intergenic
1069156950 10:65041372-65041394 CAGGGAAAAATATGTGGAAGTGG + Intergenic
1069869368 10:71523868-71523890 CAGGGGAAAGAATCTTTAAGGGG - Intronic
1070448610 10:76534419-76534441 AAAGGGAAAGAATGTGGAAGAGG - Intronic
1071131279 10:82396399-82396421 AAGAGTAATAAATCTGGAAGTGG - Intronic
1071294197 10:84207401-84207423 CAGGGTGAAGAATCTGAATGAGG + Intronic
1072967185 10:99983689-99983711 CAGGGTACAGAATGTCGAACTGG + Intronic
1074102876 10:110367412-110367434 CAGGGTGCAGAATCTGGACAGGG - Intergenic
1075351001 10:121725215-121725237 CTGGGGAAAGCATCTGGAATAGG + Intergenic
1076433922 10:130426632-130426654 CAGTGAGAAGAATGTGGAAGAGG + Intergenic
1078513413 11:12003517-12003539 CAGGGTGATAAATCTGGAAGGGG - Intronic
1078807693 11:14722762-14722784 GTGGGTCAAGAATCTGAAAGTGG - Intronic
1080898282 11:36463739-36463761 CTGGGAAAAGAGACTGGAAGTGG + Exonic
1081338534 11:41898860-41898882 GAGGAAAAAGAATCTGAAAGAGG + Intergenic
1081536930 11:44003253-44003275 CAGAGAGAAGAATCTGGCAGTGG - Intergenic
1082567906 11:54702258-54702280 TAGGGTAAAGAACCTGGGACTGG + Intergenic
1083393930 11:62375328-62375350 CAGGAAAAAGAATTTGAAAGAGG + Intronic
1085663886 11:78395131-78395153 CAAGGTGAAGAATGGGGAAGAGG + Intronic
1086392136 11:86375695-86375717 CAGGGTAAGTACTTTGGAAGGGG + Intronic
1087149930 11:94850235-94850257 CAGGGTCATCAAGCTGGAAGAGG + Exonic
1087315897 11:96601876-96601898 CATACAAAAGAATCTGGAAGTGG + Intergenic
1087440454 11:98177155-98177177 CAGGGTTAAGAAGCAGGGAGAGG + Intergenic
1088455960 11:110033349-110033371 CATGGGAAAGAATTTGGATGGGG - Intergenic
1089759195 11:120710675-120710697 CTGGGCACAGAATCTGGAGGAGG - Intronic
1090854538 11:130599850-130599872 GAGGGATAAGTATCTGGAAGTGG + Intergenic
1091533903 12:1387434-1387456 CAGGTTATAGAAACTGGACGTGG - Intronic
1091926975 12:4359705-4359727 TTGGGTAAATAATCTGGGAGTGG + Intergenic
1092979142 12:13776284-13776306 CAGGGGAAAGCATCAGGAAGAGG + Intronic
1093029767 12:14277504-14277526 CAGGATTAAGAACTTGGAAGTGG - Intergenic
1093878809 12:24380387-24380409 CAGGCTTATGAATCTGGATGAGG - Intergenic
1096261738 12:50096969-50096991 CAAGGTAAAGAACCTAGGAGAGG + Exonic
1096427625 12:51517504-51517526 AAGCGGAAAGAATCTGGAGGTGG - Intergenic
1096430021 12:51535165-51535187 GAAGGTACAGAATCTGGACGCGG + Intergenic
1096986322 12:55760874-55760896 TAGGGTAAAGAAACAGTAAGAGG + Intronic
1097618458 12:61911239-61911261 CAGAGTAAAGAATCAGGGAAGGG - Intronic
1097805532 12:63960841-63960863 CAGGCTCTAGAAGCTGGAAGAGG + Intronic
1100252283 12:92839916-92839938 GAGGGTCAGGAATCTAGAAGTGG + Intronic
1101400451 12:104382417-104382439 CAGGGGGCAGGATCTGGAAGGGG - Intergenic
1102686924 12:114732160-114732182 CAGGGGAAAGTATCTGCCAGGGG + Intergenic
1102894164 12:116585231-116585253 GTGGGTCAGGAATCTGGAAGTGG - Intergenic
1106532633 13:30608206-30608228 CATGGTCAGGAATCTGGGAGTGG - Intronic
1106814079 13:33387864-33387886 CAAGCTAAAGAATCTGGGAGCGG - Intergenic
1109860146 13:68187618-68187640 GAAGGTAAAGAATATGGAGGGGG + Intergenic
1111180302 13:84654761-84654783 GAGGGTAAAGGATTTGGAAAGGG + Intergenic
1112947400 13:104947586-104947608 GATGGTAAAGAACCTGGTAGAGG - Intergenic
1113039732 13:106091782-106091804 CAGGGTAACTAATCAGGAACTGG - Intergenic
1113443611 13:110348424-110348446 CAGGGCAAGGTATATGGAAGAGG - Intronic
1114980679 14:28159051-28159073 CAGGGTGAAGTAGCTGGAAACGG + Intergenic
1116418211 14:44704069-44704091 TAGAGTAAAGTATCAGGAAGTGG - Intergenic
1116869925 14:50061084-50061106 CAGGGAGAAGAGGCTGGAAGAGG + Intergenic
1116925994 14:50638135-50638157 CAGAGGAAAGAATTTGGAATAGG - Intronic
1119014797 14:71039280-71039302 CTGGGTTATGAATCTGGGAGTGG + Intronic
1119681267 14:76593909-76593931 AAGGCCAGAGAATCTGGAAGTGG - Intergenic
1119775177 14:77243662-77243684 GAGGCTAAAGAATTTGGAAATGG - Intronic
1120054333 14:79905138-79905160 CAGTCTGAAAAATCTGGAAGAGG - Intergenic
1120187396 14:81408063-81408085 CAAGGAAAAGAATGTGGAAGAGG - Intronic
1121171042 14:91854760-91854782 CAGGGTATGGATTGTGGAAGTGG - Intronic
1122158794 14:99768035-99768057 CAGGGTAAATCAGGTGGAAGAGG + Intronic
1122164956 14:99815909-99815931 CAGGGGTAAGAATCTGACAGGGG + Intronic
1122404737 14:101493236-101493258 CTGGGTAACCACTCTGGAAGGGG - Intergenic
1124042560 15:26118657-26118679 CAGGGTAAACAACCTGCCAGTGG - Intergenic
1124167591 15:27342017-27342039 CAGGGTGATTAATTTGGAAGAGG + Intronic
1124889892 15:33723088-33723110 CAGAGTAGAGAAAATGGAAGGGG - Intronic
1126741533 15:51781477-51781499 CAGTGTCAGGAATCTGGTAGTGG + Intronic
1127375783 15:58383267-58383289 CACTGTACAGAATCTGGATGTGG + Intronic
1127469226 15:59275659-59275681 GAGAGTAAAGAACCTGGAGGTGG + Intronic
1128264840 15:66256654-66256676 CAGAGTAGGGAACCTGGAAGAGG + Intergenic
1128657327 15:69471961-69471983 CAGAGTAAAGACTATAGAAGGGG - Intergenic
1128860872 15:71070861-71070883 CAGGGTTGAGAAACTGAAAGTGG + Intergenic
1129003567 15:72353757-72353779 CAGAGTAAAGACTCAGGGAGTGG + Intronic
1129831568 15:78674264-78674286 CAGGGTAACACAGCTGGAAGGGG + Intronic
1130994726 15:88897449-88897471 CAGGGAAATGTGTCTGGAAGTGG - Intergenic
1131087456 15:89588918-89588940 GAGGGAAAATGATCTGGAAGAGG + Intronic
1132839984 16:1974238-1974260 CAGAGTCAACATTCTGGAAGTGG + Exonic
1133661155 16:7919054-7919076 CAGGGTGAAGAATTTGGAAAAGG + Intergenic
1134065947 16:11228313-11228335 CGGCTTAAAGAATCTGGAAATGG - Intergenic
1134903767 16:17961709-17961731 CAGGCTAAAGGAGCTGGAAAAGG + Intergenic
1135206709 16:20491311-20491333 GTGGGTAAAGAATATGGAAGGGG + Intergenic
1135212176 16:20532321-20532343 GTGGGTAAAGAATATGGAAGGGG - Intergenic
1135786187 16:25351392-25351414 TAGGAAAAAGATTCTGGAAGAGG + Intergenic
1135984614 16:27174968-27174990 CACGCTAAGGAATCTGGGAGTGG + Intergenic
1136106240 16:28031972-28031994 AAAGGAAAATAATCTGGAAGTGG + Intronic
1137512490 16:49113948-49113970 AAGGGTCAGGAATCTGGAAGTGG + Intergenic
1137587805 16:49674605-49674627 CAGGGAAAATAATCAGGCAGGGG + Intronic
1137598357 16:49739641-49739663 CAGGGTAAAGACTTTGGAAATGG - Intronic
1138681036 16:58683868-58683890 CAAGGCAGAGAATCTGCAAGAGG - Intronic
1140039839 16:71398916-71398938 CAGGAAAAAGAATTTGAAAGAGG + Intergenic
1140047216 16:71448910-71448932 CAGTGTAAAGAGTGTGGAAAAGG - Exonic
1141488758 16:84357747-84357769 CAGGGTAAAGGAGAGGGAAGAGG - Intergenic
1142321176 16:89383957-89383979 CAAGATAAAGAATCTGAAACTGG + Intronic
1142337981 16:89502542-89502564 GAGGGTCAGGAATCTGGGAGTGG - Intronic
1143129661 17:4669894-4669916 CATGTTAAAGAATCTGGGATGGG + Intergenic
1143891908 17:10108355-10108377 CATGCTAAAGAATCAGGCAGTGG - Intronic
1143948027 17:10611228-10611250 GAGGGTGAAGAATCTTCAAGGGG + Intergenic
1144431473 17:15196077-15196099 CATGGAAAAGAATCAGCAAGTGG + Intergenic
1145052122 17:19670860-19670882 GAGGGTAAAGAATGAGGGAGGGG - Intronic
1145284527 17:21495469-21495491 CCGGGTGGACAATCTGGAAGGGG + Intergenic
1146415924 17:32632868-32632890 CAGAGCAGAGAATCCGGAAGAGG + Intronic
1146426837 17:32748377-32748399 CAGGGGAATGAATTAGGAAGAGG - Intronic
1149605805 17:57924402-57924424 CAACGTAAAGAAGCCGGAAGAGG - Intronic
1152497889 17:80687255-80687277 CAGGAGAAAGAAACAGGAAGAGG - Intronic
1153550589 18:6258098-6258120 CAGGGGAAAGAGGCAGGAAGAGG + Intronic
1155802356 18:30123595-30123617 CAGGGTTAGGAATCTGCAAAAGG - Intergenic
1155925620 18:31652152-31652174 TGGGGTAAAGGATCTGGAGGAGG - Intronic
1156484498 18:37456284-37456306 CTTGGTAAGGACTCTGGAAGTGG + Intronic
1156743218 18:40358245-40358267 CTGGGAAAACAATCTGCAAGGGG + Intergenic
1157059042 18:44265445-44265467 TAGGGTAGAGAATGTGGCAGAGG - Intergenic
1158175805 18:54654588-54654610 GAAGGTAAAGAATTGGGAAGAGG - Intergenic
1163049146 19:14668305-14668327 GTGGGTTAAGAATCTGGGAGGGG - Intronic
1163767755 19:19172712-19172734 GAGGGGAGAGAATCTGGAGGAGG - Intronic
1165172964 19:33906414-33906436 CAGGGGAGAGAATAGGGAAGAGG + Intergenic
1165900207 19:39165980-39166002 CCGGGTAAAGTGCCTGGAAGAGG + Intronic
1166228932 19:41414300-41414322 CAGGGTTAGGACTCTGGAGGGGG + Intronic
926384363 2:12321598-12321620 CTGAGCAGAGAATCTGGAAGTGG - Intergenic
927858426 2:26542189-26542211 CAGGGTAAGCTGTCTGGAAGAGG - Intronic
927945560 2:27133224-27133246 CAGGGTAGAGAATTTGCAGGCGG - Exonic
929617086 2:43319744-43319766 CAGGGTAATGAGTCTGCAACTGG - Intronic
929957158 2:46466727-46466749 CAGGGTCATGAATGTGGAAGGGG + Intronic
930241586 2:48941157-48941179 GAAGGAAAAGAATGTGGAAGAGG + Intergenic
931086319 2:58834697-58834719 CAGGTGAGAGAGTCTGGAAGGGG + Intergenic
931929552 2:67115048-67115070 CAGGGTAAATAATTAGGAATAGG + Intergenic
932072853 2:68637922-68637944 GAGGGTTAAGAATCTGGGAGTGG - Intergenic
932214574 2:69958574-69958596 GAGGGTAAAGAGTCTGTAAGTGG - Intergenic
933896713 2:86817294-86817316 CTGAGCAATGAATCTGGAAGTGG - Intronic
935524009 2:104143629-104143651 CAAGCTAAAGAATATGGAAATGG - Intergenic
936921739 2:117696096-117696118 CAGGGCAAAGAATTTGGAAGGGG + Intergenic
937930495 2:127201358-127201380 TATGGTAAATAATCTAGAAGAGG - Intronic
939810270 2:146823416-146823438 CAGTGTCTAGAAGCTGGAAGAGG + Intergenic
939998548 2:148943489-148943511 GAGGGAAAAAAATCTGGAGGAGG + Intronic
940170465 2:150824558-150824580 CAGGGTCAAGAATCAAGAAGGGG + Intergenic
940284469 2:152020042-152020064 CAGGGTGAAAATCCTGGAAGTGG - Intronic
941529346 2:166646853-166646875 CAGGCAAAAGAAACTGGAAGAGG - Intergenic
942787027 2:179711568-179711590 CAAGCTAAAGAATCTGGGAGTGG + Intronic
943175145 2:184463308-184463330 CATGGAAAAGAATCTGAAATAGG - Intergenic
943618729 2:190123383-190123405 CAGGGAAAAAGATTTGGAAGGGG - Intronic
943791816 2:191941714-191941736 CTGGGTAAGGAATCTGCAAAGGG - Intergenic
944401632 2:199333397-199333419 CAGGGAAAAAAAATTGGAAGAGG + Intronic
947069197 2:226267670-226267692 GAGGGTAAAGAATCATGCAGTGG - Intergenic
947094432 2:226550131-226550153 TAGTGTGTAGAATCTGGAAGAGG + Intergenic
947137479 2:226989381-226989403 CGGGGTATAGTAACTGGAAGGGG + Intronic
947639617 2:231699643-231699665 CAGGAGAAAGATGCTGGAAGGGG + Intergenic
947903275 2:233740479-233740501 CACTGGAAAGCATCTGGAAGAGG - Intronic
948529985 2:238598136-238598158 CAGGGGCAGGAATCTGGGAGAGG - Intergenic
1171394093 20:24819865-24819887 GTGGGTAAGGAATTTGGAAGGGG - Intergenic
1173228081 20:41173692-41173714 CAGGGTTACTGATCTGGAAGTGG - Exonic
1173310467 20:41892294-41892316 CAAGTTAGAGAATCTGGGAGTGG + Intergenic
1174282081 20:49446821-49446843 CAGGGAAAGCATTCTGGAAGAGG + Intronic
1175604427 20:60300488-60300510 CAGGATAAACAAACTGGAGGTGG + Intergenic
1175606567 20:60316392-60316414 TAAGGTAAAAATTCTGGAAGAGG + Intergenic
1176912523 21:14583674-14583696 CAGAGTGCAGAATCTGGATGAGG - Intergenic
1178018889 21:28386206-28386228 GGAGGTAAGGAATCTGGAAGAGG - Intergenic
1178365611 21:31986740-31986762 CAGGGAAAACACTCTGGAAGAGG - Intronic
1180653138 22:17395761-17395783 AAGGGAAAAAAATCTGGAATTGG - Intronic
1181040682 22:20191209-20191231 CAGGGCAGAAAATCTGGAGGAGG - Intergenic
949358232 3:3204073-3204095 CAGCCTCAAGAAGCTGGAAGAGG + Intergenic
950171958 3:10844865-10844887 CAGGGAAGAGAAACTGGAGGAGG + Intronic
950637724 3:14327096-14327118 CTGGGTAAAGAAGCTGGGAGTGG - Intergenic
951187979 3:19736169-19736191 GAAGGTAAAGAAGCTGGATGGGG - Intergenic
951373266 3:21879888-21879910 CAAGGAAAAGAATGTGCAAGTGG + Intronic
952416291 3:33093887-33093909 CATGGTAAAGAAACTGGAATGGG + Exonic
954263367 3:49455836-49455858 CAGGGTAAGGAATTGGGAGGAGG - Intergenic
954263867 3:49458893-49458915 GAGGGTGAAGAAGCAGGAAGAGG + Intergenic
955240094 3:57170266-57170288 CCGGGAAAAGAAACGGGAAGTGG - Intronic
955437024 3:58912084-58912106 CAGAATAAAGAATATGGGAGGGG - Intronic
956280170 3:67547513-67547535 AAGGGTCAGGAACCTGGAAGAGG - Intronic
959563740 3:107813214-107813236 CAGGGTAAGGAATCTCCAAGCGG - Intergenic
959630884 3:108506167-108506189 CGGGGGAGGGAATCTGGAAGGGG - Intronic
959685927 3:109146445-109146467 CAGGGTCATGAATTTGGGAGTGG + Intergenic
960357189 3:116668035-116668057 CAGGGTAAGGAATAAGGAAGAGG - Intronic
962196366 3:133367163-133367185 CAAGCTAAGAAATCTGGAAGTGG - Intronic
963115848 3:141728328-141728350 CATGGGAAAGAATATGGAGGAGG + Intergenic
963125899 3:141815945-141815967 GAGGGTCAAGAATCTGGACATGG - Intronic
963208691 3:142663704-142663726 TAGGGGAAAGAATGTGGCAGTGG + Intronic
963680189 3:148364688-148364710 CAGGTAGGAGAATCTGGAAGTGG - Intergenic
964313024 3:155414407-155414429 CAGGGAAAAGACTCAGGAAGTGG + Intronic
964338761 3:155685945-155685967 CAGGGAAATGAACCTGGGAGAGG - Intronic
964787322 3:160412331-160412353 CAGGGTAAAGATGGTGGAAAAGG + Exonic
965720940 3:171661601-171661623 CAGGGAAAAGAACGTGGAAAAGG - Intronic
966310229 3:178586065-178586087 CAGGGTAGAGAAACAGCAAGAGG - Intronic
967723661 3:192841673-192841695 GAGGGTCAGGAATCTGGGAGTGG - Intronic
968126774 3:196165911-196165933 CAGAATAAAAAATCTGGAAGTGG + Intergenic
968855920 4:3121940-3121962 CAGAGAAAAGAATCAGGAGGAGG - Intronic
969375199 4:6758898-6758920 CAAGCTAAGGAATCTGGGAGTGG + Intergenic
969478417 4:7434177-7434199 CAGGGACAAAAAACTGGAAGAGG + Exonic
969718517 4:8880259-8880281 GAGAGTAAAGGATGTGGAAGAGG + Intergenic
970299461 4:14666472-14666494 CAGCCTCCAGAATCTGGAAGAGG + Intergenic
970980065 4:22086005-22086027 CAAGGTAAGGAATCTGGGTGTGG + Intergenic
971495950 4:27265401-27265423 AAGGGTCAGGAATCTGGAAGTGG - Intergenic
972273882 4:37539065-37539087 CAAGCTAAGGAATCTGGGAGTGG + Intronic
972333288 4:38082760-38082782 CAGGGAAGAGAACCAGGAAGAGG - Intronic
972911371 4:43821688-43821710 CATGGTAAAGAAGAAGGAAGAGG + Intergenic
973271525 4:48267813-48267835 TAGGGGTAAGAATCTGGGAGGGG + Intronic
975593500 4:76024004-76024026 CAGGGTCAAAGATCTGGAACTGG + Intronic
977235211 4:94500175-94500197 CATAGTAGAGAATCTAGAAGTGG + Intronic
977995361 4:103493634-103493656 CGGGCTAAGGAATCTGGGAGTGG + Intergenic
978446550 4:108786241-108786263 CAGGAAAAAGAATTTGAAAGAGG - Intergenic
982344373 4:154340795-154340817 AAGGGTAAAGATTCTTGAAAAGG - Intronic
983534711 4:168845046-168845068 CTGGGTAGAGAAGCTGGAGGGGG + Intronic
983626354 4:169805491-169805513 CAAGGTTAAGATTATGGAAGGGG + Intergenic
984126037 4:175812206-175812228 CATGGAAGAGAATATGGAAGAGG - Exonic
985824606 5:2183154-2183176 CAGGGCACAGAAGCAGGAAGTGG + Intergenic
986422286 5:7597472-7597494 CAGGGTAAAGAATGCAGTAGTGG + Intronic
986982961 5:13470018-13470040 CAGGGTAAAGAGACTGAAACAGG + Intergenic
987506467 5:18780178-18780200 CAGTGTGTAGAATCTGGAACAGG + Intergenic
987682452 5:21155108-21155130 CAGAGTAATAAAGCTGGAAGAGG - Intergenic
990304112 5:54478149-54478171 CAGGCTAAGGAATCTGGGAGTGG - Intergenic
991028837 5:62061237-62061259 CAAGGTACAGAATGTAGAAGAGG + Intergenic
993968607 5:94389081-94389103 CAAGCTAAGGAATCTGGGAGTGG + Intronic
995122011 5:108546246-108546268 GAGGGTATGGAAGCTGGAAGGGG + Intergenic
995258833 5:110077637-110077659 CAGGGAAAAGAAGCAGGAACAGG - Intergenic
995479390 5:112579961-112579983 CAAGCTAAGGAATCTGGGAGTGG + Intergenic
995576922 5:113546689-113546711 GAGAGTCAAGAATCTGGGAGTGG + Intronic
995684424 5:114756902-114756924 CAGGGAAAATAATTTAGAAGAGG + Intergenic
997247768 5:132365406-132365428 CAAGCTAAGGAATCTGGGAGTGG - Intergenic
998270593 5:140703027-140703049 TTGGGTAAGGAATCTGGGAGTGG + Intronic
998378133 5:141704841-141704863 CAGGGTAGAGTCTATGGAAGTGG - Intergenic
999080876 5:148842503-148842525 CAGGTGACAGACTCTGGAAGGGG - Intergenic
1000123952 5:158225383-158225405 CAGCTTCTAGAATCTGGAAGAGG + Intergenic
1001118512 5:168959495-168959517 CAGGATAAAGCATCTATAAGTGG + Intronic
1001139464 5:169132168-169132190 CGGGGTAAAGAAAAAGGAAGGGG + Intronic
1001300614 5:170530984-170531006 CAGTGCAGAGAATCTCGAAGAGG - Intronic
1001617394 5:173054077-173054099 CAGGTTAAACACTTTGGAAGTGG + Intergenic
1002570810 5:180138328-180138350 CGGGGGGAAGAATCTAGAAGAGG - Exonic
1003083871 6:3045428-3045450 CATGGTGAAGAGTCTGGAAAGGG + Intergenic
1003234751 6:4285419-4285441 GTGGTTAAAGAATCTGGAGGGGG + Intergenic
1003760357 6:9172729-9172751 CAGGCTAAGGACTCTGGGAGTGG + Intergenic
1004308682 6:14524047-14524069 CAGCGTAAAGAAGCTTGAACTGG - Intergenic
1004543983 6:16579136-16579158 AGGGGTTAAGCATCTGGAAGAGG + Intronic
1005526246 6:26652884-26652906 CAGGGTAAAGAGAGTGGTAGGGG + Intronic
1006105492 6:31713822-31713844 CAGGCTCAGGAATCTGGGAGAGG + Exonic
1006913889 6:37582393-37582415 CAGCGTCTAGAAACTGGAAGAGG + Intergenic
1008116789 6:47560135-47560157 CAGGGTAAAGGATCTAAGAGAGG - Intronic
1008122421 6:47633733-47633755 CAGCCTAAAGAAGCTGGAAAAGG - Intergenic
1008806155 6:55431146-55431168 CAAGGGAAAGAATGTGGCAGAGG + Intergenic
1008885646 6:56429791-56429813 CAGGAGAAAGAATTTGAAAGAGG - Intergenic
1009195922 6:60684290-60684312 AATGGTTAAGGATCTGGAAGAGG + Intergenic
1011428282 6:87254896-87254918 CAGCGTAAAGAATTTGGTATTGG - Exonic
1012139025 6:95598296-95598318 AAGGGTCAAGCATCTGGAAGTGG + Intronic
1013346128 6:109262418-109262440 CATGGTAAAGAATGTGGATAGGG - Intergenic
1014483342 6:121966030-121966052 GAGGGGCAGGAATCTGGAAGTGG - Intergenic
1014857494 6:126419898-126419920 CTGGGTTAAGGATCTGGAAATGG - Intergenic
1015190850 6:130470620-130470642 CAGAGGAAAAATTCTGGAAGAGG + Intergenic
1015203006 6:130603561-130603583 ATGGGACAAGAATCTGGAAGTGG - Intergenic
1015939006 6:138430779-138430801 CTGGGTGAAGAGTCTGGGAGTGG + Exonic
1017953790 6:159161121-159161143 CAGTGTTAGGAAGCTGGAAGTGG - Intergenic
1020743869 7:12055983-12056005 CAGTGTATAAAGTCTGGAAGAGG + Intergenic
1021912069 7:25396284-25396306 AAGGGTCATGATTCTGGAAGAGG - Intergenic
1021921098 7:25485914-25485936 CAGGGTAAAGAAGTAGGAAATGG - Intergenic
1022318573 7:29266718-29266740 CAGTGGAAAGAATCAGGGAGTGG - Intronic
1022702554 7:32775489-32775511 CAGTATATAGAATCTGGATGGGG - Intergenic
1022974819 7:35547344-35547366 CAGGGTTAAGCAGCTGGAAGTGG + Intergenic
1023218744 7:37896329-37896351 CAGGGCAAAGAAGCAGGATGGGG + Intronic
1023624550 7:42103030-42103052 GAGGGTAGAGAATCCGGAAGCGG + Intronic
1023661789 7:42477984-42478006 CAAGCTAGGGAATCTGGAAGTGG + Intergenic
1024402100 7:48936095-48936117 CAGGGTAATGAAAATAGAAGAGG + Intergenic
1025957827 7:66196361-66196383 CTGGTTAAAGAGGCTGGAAGGGG - Intergenic
1026628741 7:72019316-72019338 AAGGGTAAAGATTCTGTAATTGG - Intronic
1028456663 7:91045119-91045141 CAGGGTTAAGAACCTAGAAAGGG - Intronic
1029800439 7:102941312-102941334 CAGGGTAAAGAATCTGGAAGTGG + Intronic
1030139086 7:106286384-106286406 CAGGGCAAAGATCATGGAAGTGG + Intergenic
1032136816 7:129286749-129286771 GAGTGTAAAGGAGCTGGAAGTGG - Intronic
1032787207 7:135210585-135210607 CAGAGTACAGAATCTGGAAAAGG + Intronic
1034164493 7:149014865-149014887 CAGGGTACTGAATATGGAAAGGG + Intronic
1034271200 7:149804124-149804146 CAGGGTACAGAATTGGGAGGAGG - Intergenic
1036561121 8:9901309-9901331 CAGCTTAAAGCATCTGAAAGGGG + Intergenic
1036741487 8:11365716-11365738 CAACTGAAAGAATCTGGAAGAGG + Intergenic
1037789434 8:21923972-21923994 CAGGGTTAGGAATCTGGGAGTGG + Intronic
1038084172 8:24175169-24175191 CAGGGGAAAGAAATTGGAAAGGG - Intergenic
1039309528 8:36301193-36301215 CAGGGTAATAATTCTGGCAGTGG + Intergenic
1039958170 8:42223136-42223158 CAAGGGGAAGAATTTGGAAGAGG - Intergenic
1040146691 8:44055429-44055451 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040149278 8:44093658-44093680 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040154692 8:44173846-44173868 CTTTGTATAGAATCTGGAAGTGG + Intergenic
1040158291 8:44227188-44227210 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040161593 8:44276096-44276118 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040161672 8:44277289-44277311 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040164208 8:44314673-44314695 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040166626 8:44350546-44350568 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040172388 8:44435860-44435882 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040175626 8:44483824-44483846 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040175759 8:44485691-44485713 CTTTGTATAGAATCTGGAAGTGG + Intergenic
1040177104 8:44505574-44505596 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040178048 8:44519510-44519532 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040178508 8:44526315-44526337 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040179393 8:44539407-44539429 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040182085 8:44579342-44579364 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040186143 8:44639378-44639400 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040191807 8:44723170-44723192 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040192439 8:44732525-44732547 CTTTGTATAGAATCTGGAAGTGG + Intergenic
1040194043 8:44756163-44756185 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040194125 8:44757357-44757379 CTTTGTATAGAATCTGGAAGTGG + Intergenic
1040195776 8:44781838-44781860 CTTTGTATAGAATCTGGAAGTGG + Intergenic
1040197327 8:44804794-44804816 CTTTGTATAGAATCTGGAAGTGG + Intergenic
1040202117 8:44875995-44876017 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040202594 8:44883129-44883151 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040205488 8:44926107-44926129 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040208899 8:44976531-44976553 CTTTGTATAGAATCTGGAAGCGG + Intergenic
1040211044 8:45008462-45008484 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040211632 8:45017130-45017152 CTTTGTATAGAATCTGGAAGTGG + Intergenic
1040213341 8:45042279-45042301 CTTTGTATAGAATCTGGAAGTGG + Intergenic
1040214833 8:45064378-45064400 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040216054 8:45082557-45082579 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040216689 8:45091912-45091934 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040220456 8:45147475-45147497 CTTTGTATAGAATCTGGAAGTGG + Intergenic
1040226949 8:45243174-45243196 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040228364 8:45264095-45264117 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040229339 8:45278544-45278566 CTTTGTATAGAATCTGGAAGTGG + Intergenic
1040232318 8:45322388-45322410 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040233809 8:45344503-45344525 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040234219 8:45350378-45350400 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040236158 8:45378907-45378929 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040237067 8:45392321-45392343 CTTTGTATAGAATCTGGAAGTGG + Intergenic
1040237926 8:45405065-45405087 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040240764 8:45446852-45446874 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040241321 8:45455171-45455193 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040244833 8:45506810-45506832 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040245591 8:45518032-45518054 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040247837 8:45550977-45550999 CTTTGTATAGAATCTGGAAGTGG + Intergenic
1040248436 8:45559820-45559842 CTTTGTATAGAATCTGGAAGTGG + Intergenic
1040250052 8:45583770-45583792 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040250175 8:45585639-45585661 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040250563 8:45591412-45591434 CTTTGTATAGAATCTGGAAGTGG + Intergenic
1040251541 8:45605847-45605869 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040252800 8:45624358-45624380 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040253800 8:45639128-45639150 CTTTGTATAGAATCTGGAAGTGG + Intergenic
1040254235 8:45645415-45645437 CTTTGTATAGAATCTGGAAGTGG + Intergenic
1040255812 8:45668687-45668709 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040255936 8:45670556-45670578 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040258195 8:45703829-45703851 CTTTGTATAGAATCTGGAAGTGG + Intergenic
1040261233 8:45748655-45748677 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040261481 8:45752392-45752414 CTTGTTATAGAATCTGGAAGTGG + Intergenic
1040261736 8:45756128-45756150 CTTTGTATAGAATCTGGAAGTGG + Intergenic
1040262239 8:45763605-45763627 CTTTGTATAGAATCTGGAAGTGG + Intergenic
1040267887 8:45847191-45847213 CTTTGTATAGAATCTGGAAGTGG + Intergenic
1040927059 8:52695752-52695774 CAGAGAGCAGAATCTGGAAGGGG - Intronic
1042094257 8:65195009-65195031 CAGCGTCTAGAAGCTGGAAGAGG + Intergenic
1042096752 8:65224631-65224653 CATGTTTTAGAATCTGGAAGGGG - Intergenic
1042569164 8:70143921-70143943 CAGGGTACAGGATGTGGATGTGG + Intronic
1043380784 8:79699888-79699910 CTGGGTCAACAAACTGGAAGAGG + Intergenic
1044681115 8:94778537-94778559 CAGGTTGAAGAAAGTGGAAGCGG - Intronic
1044845970 8:96381887-96381909 CAGAGTAGAAGATCTGGAAGAGG - Intergenic
1044879066 8:96703816-96703838 AAAGGTCAAGAATCTGTAAGGGG + Intronic
1045559690 8:103248939-103248961 CAAGCTATAGAATCTGGGAGTGG - Intergenic
1045782110 8:105878697-105878719 AAGGCTAAATTATCTGGAAGAGG + Intergenic
1046045988 8:108965801-108965823 GTGGGTTAAGAATCTGGATGAGG + Intergenic
1047105364 8:121725435-121725457 CATGCTAAAAAATCTGGGAGAGG - Intergenic
1047295661 8:123568538-123568560 CAGGGGAATGATTCTGGAATGGG + Intergenic
1048668302 8:136689272-136689294 CCCGTTAAAGCATCTGGAAGAGG - Intergenic
1049341981 8:142118089-142118111 CAGGCTCCAGAAGCTGGAAGGGG + Intergenic
1049424846 8:142533385-142533407 CAGCGAAGAGGATCTGGAAGAGG - Exonic
1049834135 8:144722674-144722696 AAGTGTAATGAATGTGGAAGAGG - Exonic
1050681504 9:8117109-8117131 CTGGTTAATGAATCTGGAGGGGG - Intergenic
1051049409 9:12913739-12913761 CTGGGGAGAGAATCTGGAATTGG - Intergenic
1053214739 9:36261027-36261049 CAGCCTCTAGAATCTGGAAGGGG - Intronic
1054793275 9:69275695-69275717 CTGGGTCAAGAATCTGGACACGG + Intergenic
1054970763 9:71083431-71083453 CAGGATGAAGGATCGGGAAGAGG - Intronic
1055725009 9:79218163-79218185 CAAGGTAAAGCATCTGGCAAGGG + Intergenic
1057302007 9:93891971-93891993 CAGGGTAATGAATCTGGCCACGG + Intergenic
1057551329 9:96053013-96053035 GAGGGCAAAGGAGCTGGAAGAGG - Intergenic
1057955220 9:99401870-99401892 CAAGCTAAGGAATCTGGGAGTGG - Intergenic
1059180930 9:112211404-112211426 CAGGGGAAAGAATCTGGGGCTGG + Intergenic
1059773094 9:117446445-117446467 CAGGGAAAGGAAACAGGAAGGGG - Intergenic
1060777654 9:126387866-126387888 CAAGGTCATGCATCTGGAAGTGG + Intronic
1061389633 9:130310303-130310325 GAGGATCAAGAATCTGAAAGTGG + Intronic
1061502452 9:131011724-131011746 CAGGGGAAGGAATCTGGGACAGG + Intronic
1186667146 X:11728917-11728939 CAGCCTCTAGAATCTGGAAGGGG - Intergenic
1190291616 X:48996819-48996841 CAGGATGAATTATCTGGAAGAGG + Intronic
1191116950 X:56862724-56862746 CAAGCTAAGGAATCTGGGAGTGG + Intergenic
1193212043 X:78818394-78818416 CAGAATAGAGAATCCGGAAGTGG + Intergenic
1194934981 X:99938357-99938379 CAGGAAAAAGAATTTGAAAGAGG - Intergenic
1196714495 X:118798604-118798626 CAGGAAACAGAAGCTGGAAGTGG - Intergenic
1198588136 X:138145706-138145728 CAGGCAGAAGAATCTGCAAGTGG + Intergenic
1198776457 X:140184439-140184461 CATGGTAGAGCATCAGGAAGTGG - Intergenic
1198962262 X:142195293-142195315 CAGAGTAGAGAATGAGGAAGAGG + Intergenic