ID: 1029803894

View in Genome Browser
Species Human (GRCh38)
Location 7:102976650-102976672
Sequence CTCTTTAAGGGTAATGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 9, 2: 7, 3: 30, 4: 349}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029803894 Original CRISPR CTCTTTAAGGGTAATGTGGA CGG (reversed) Intronic
906667110 1:47629597-47629619 CCCTTTAGGGGAGATGTGGAGGG + Intergenic
906938474 1:50235195-50235217 CTCTGCTAGGGTAATGTGGAAGG + Intergenic
907120928 1:52007337-52007359 ATTTTTAAGGATAATTTGGAGGG + Intergenic
908620672 1:65975929-65975951 CTCTACTAGGGTAGTGTGGAGGG + Intronic
909083724 1:71147038-71147060 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
909710831 1:78647402-78647424 CTCTGCTAGGGCAATGTGGAAGG - Intergenic
909711105 1:78650274-78650296 CTCTATAAGGGTAGTGTCCATGG + Exonic
909755545 1:79220993-79221015 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
909837138 1:80270444-80270466 ACCTTTAAGGGTAATGGGAAAGG - Intergenic
910233198 1:85007946-85007968 CTCTGTGAGGGCAGTGTGGAAGG - Intronic
910354881 1:86342467-86342489 CTCTTTAAAGGTAATGCGGAGGG - Intergenic
910810051 1:91226799-91226821 GTTTTTAAGGGTAATTTGGAGGG - Intergenic
911387201 1:97192088-97192110 TTCTTCAAGAGTAATGTGTATGG - Intronic
911941400 1:104052294-104052316 CTCCTTTAGGGCAGTGTGGAAGG - Intergenic
911972163 1:104452495-104452517 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
912359383 1:109082328-109082350 CTCTATGAGAGTAATTTGGAAGG + Intergenic
912907068 1:113718524-113718546 CTCTGTGAGGGTAGTGTGGAAGG - Intronic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914726790 1:150334620-150334642 CTCTATAAGAGTTATTTGGATGG - Intronic
915614118 1:157022417-157022439 CTCTTTAATGCTATTGTGAATGG - Intronic
915894030 1:159797334-159797356 ATCTTAAAGGGTCATGTGAATGG + Intergenic
916879316 1:169004108-169004130 CTCCTCAAGGGTAAGGAGGACGG - Intergenic
918323043 1:183382969-183382991 CTCTACTAGGGCAATGTGGAGGG - Intronic
918718122 1:187818030-187818052 CTCTGCTAGGGTAGTGTGGAAGG - Intergenic
919124396 1:193378149-193378171 CTCTGCTAGGGTAGTGTGGAAGG + Intergenic
920574421 1:207048556-207048578 CACATTTTGGGTAATGTGGAAGG - Exonic
920574432 1:207048663-207048685 CACATTTTGGGTAATGTGGAAGG - Exonic
921150202 1:212394827-212394849 CTCTTTAAAGCTATTGTGAATGG - Intronic
921856817 1:219995425-219995447 CTTTTTAGGTGTAATTTGGAGGG - Intronic
921996566 1:221425893-221425915 CTCTTCTAGGGCAGTGTGGAAGG - Intergenic
922685867 1:227638510-227638532 CTCTTTAAGGGTAATGCAGACGG + Intronic
924050836 1:240078340-240078362 CTCTGCTAGGGTAGTGTGGAAGG + Intronic
924759216 1:246968603-246968625 CTCTACTAGGGTACTGTGGAGGG - Intronic
924795445 1:247289203-247289225 CTCTTTAAGGGTAATGCGGACGG - Intergenic
924814086 1:247427384-247427406 CTCATTAAGAGTGAGGTGGAAGG + Intronic
1063310236 10:4945401-4945423 CTCTGCTAGGGCAATGTGGAAGG + Intronic
1066500164 10:35985251-35985273 CTTTTTAAATGTAATGAGGATGG - Intergenic
1067472538 10:46547362-46547384 AACTTTAAGGGAACTGTGGAAGG - Intergenic
1068276124 10:54799580-54799602 ATGTTTAAGGGTAATTTGGGGGG + Intronic
1068495044 10:57776580-57776602 CTCTGCTAGGGTAGTGTGGAAGG - Intergenic
1071660854 10:87501366-87501388 CTCTTTAAAAGTAAAGTAGATGG + Intergenic
1072121338 10:92407792-92407814 GTTTTTAAGGGTAATTTGGTGGG + Intergenic
1072259510 10:93655229-93655251 CATTTTCAGGATAATGTGGAAGG + Intronic
1072837777 10:98735427-98735449 CTCTGTTAGGGCAGTGTGGAAGG + Intronic
1073822329 10:107278701-107278723 CTCTTTAAGGCTCATGTGTAAGG - Intergenic
1074286239 10:112100661-112100683 CTCTGCTAGGGCAATGTGGAAGG - Intergenic
1074323547 10:112426011-112426033 CGCTTTAAGCTTAATGTTGAAGG + Intronic
1078252511 11:9627955-9627977 CTCTTGAATGGTAATTTGGCTGG + Intergenic
1078698636 11:13659933-13659955 TTCTATAAGGGTAGTATGGAAGG + Intergenic
1078908072 11:15705884-15705906 ATCTCTAAGGGTAATGGAGAAGG + Intergenic
1080990866 11:37533162-37533184 CTTTTTAAGGATAATTTGGTAGG + Intergenic
1082170722 11:49001818-49001840 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1082268314 11:50143072-50143094 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1082287759 11:50335443-50335465 CTCTGCTAGGGCAATGTGGAAGG - Intergenic
1082605998 11:55234576-55234598 CTCTTTAAAGCTATTGTGAATGG + Intergenic
1082634984 11:55584218-55584240 ATCTTTAAGGGTAATGTGAATGG - Intergenic
1082734257 11:56838798-56838820 CTCTGTTAGGGCAATGTGGAAGG - Intergenic
1083085068 11:60134372-60134394 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1083108228 11:60379103-60379125 CTCCTCAAGGCGAATGTGGAAGG + Intronic
1084200209 11:67552004-67552026 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1085928943 11:81057507-81057529 CTCTTTAAGTGATATGGGGATGG + Intergenic
1086176786 11:83900730-83900752 CTCTGTTAGGGTAGTGTGGAAGG + Intronic
1086311879 11:85544742-85544764 CTCTTTGAGGCAAATGTGAATGG + Intronic
1086695083 11:89834542-89834564 ATTTTTAAGGGGATTGTGGAAGG + Intergenic
1086711067 11:90009942-90009964 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1087255125 11:95945000-95945022 CTCTGCTAGGGTAGTGTGGAAGG + Intergenic
1087675641 11:101158334-101158356 CTCTGCTAGGGTAGTGTGGAAGG + Intergenic
1088171460 11:107002201-107002223 CTGTTGAAAGGTAGTGTGGAAGG - Intronic
1088431917 11:109768289-109768311 CGCTTTAAGAGGGATGTGGAGGG - Intergenic
1089133397 11:116230056-116230078 ATGTTTAAGTGAAATGTGGAGGG + Intergenic
1090354484 11:126130695-126130717 CTGTTTAGGGGTACGGTGGAAGG - Intergenic
1091375277 12:21060-21082 CTCAAGAAGGGTAATGAGGATGG + Intergenic
1093474329 12:19537955-19537977 CTCTTTAATGGTAATATTCAGGG + Intronic
1093537307 12:20237568-20237590 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1094421148 12:30272661-30272683 CTCTGCCAGGGTAGTGTGGAAGG - Intergenic
1095450780 12:42328424-42328446 CTTTTTTAGGGTAAAATGGAGGG + Intronic
1095508501 12:42924171-42924193 CTCATTAAGGGTATTGTGCATGG + Intergenic
1097251648 12:57636467-57636489 GTGTTAAAGGGTAAAGTGGAAGG + Intergenic
1097348480 12:58521544-58521566 CTATATAAGGGTATTGTGCAGGG + Intergenic
1098185806 12:67894947-67894969 CTGTTCAACAGTAATGTGGATGG + Intergenic
1098761869 12:74435033-74435055 CTCTGTGAGGGCAGTGTGGAAGG + Intergenic
1099379670 12:81938753-81938775 CTCTGTTAGGGCAGTGTGGAAGG - Intergenic
1099396528 12:82147220-82147242 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1099738209 12:86597787-86597809 CTTTTTAAAGGGATTGTGGATGG - Intronic
1099799553 12:87440485-87440507 GTTTTTAAGGATAATTTGGAGGG - Intergenic
1099861625 12:88230425-88230447 GTTTTTAAGGGTAATGCGGATGG - Intergenic
1101054171 12:100895095-100895117 CTCTTTAACTGCAAAGTGGAGGG - Intronic
1101876064 12:108597661-108597683 CTGTGTGAGGGTGATGTGGACGG - Intronic
1101912617 12:108871809-108871831 GTTTTTAAGGGTAATTTGGTGGG - Intronic
1102740762 12:115205574-115205596 GTTTTTAAGGATAATTTGGAGGG - Intergenic
1102815661 12:115863711-115863733 CTCTTTGGGGGTAAAGGGGATGG + Intergenic
1103243080 12:119431269-119431291 GTTTTTAAGGATAATTTGGAGGG + Intronic
1106262288 13:28078228-28078250 CTCTGCTAGGGTAGTGTGGAAGG - Intronic
1106734814 13:32578135-32578157 CTCTGCTAGGGTAGTGTGGAAGG + Intergenic
1106924705 13:34601614-34601636 CTCTTTAAAGGTAAAGTGGAGGG + Intergenic
1107868584 13:44727111-44727133 GTTTTTAAGGGTAATTTGGTGGG - Intergenic
1109526271 13:63580342-63580364 CTCTGCTAGGGTAGTGTGGAAGG - Intergenic
1110253865 13:73410077-73410099 CTCTTGGAGGGTAAGGTGGACGG + Intergenic
1110978011 13:81864625-81864647 GTCTTTAAGGATAATTTGGTAGG - Intergenic
1111879949 13:93943796-93943818 CTTTTTAAGGGTGATTTAGAGGG + Intronic
1112031337 13:95459343-95459365 CTCTGGTAGGGTAGTGTGGAAGG - Intronic
1113055534 13:106263118-106263140 CTCTTGAAGTGGAAGGTGGAAGG - Intergenic
1113390059 13:109887600-109887622 CTTTTTAAGGCTACTGTGAATGG - Intergenic
1113717112 13:112518649-112518671 CTAGTTAAGGATAATGTGAAAGG - Intronic
1114237165 14:20833596-20833618 CTCCTTAAGGGTAACGTGGACGG + Intergenic
1114320997 14:21547055-21547077 CTCTGTTAGGGCAGTGTGGAAGG - Intergenic
1114627535 14:24139183-24139205 CTATTTCAGAGTGATGTGGAGGG - Exonic
1114987665 14:28250879-28250901 CTCTCCTAGGGTACTGTGGAAGG - Intergenic
1116079660 14:40156224-40156246 CTCTGCTAGGGTAGTGTGGAAGG - Intergenic
1117203708 14:53418662-53418684 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1117576075 14:57099485-57099507 CTCTTTAAGGATAATTTAGAAGG + Intergenic
1117589917 14:57256620-57256642 TTCTTGAAGGGCAATCTGGATGG - Intronic
1117739945 14:58806828-58806850 CTCTTTCTGGGTCATGGGGATGG + Intergenic
1118942013 14:70347076-70347098 CTCTTTAAGGGTAATGCGGACGG - Intronic
1120132526 14:80823912-80823934 CTCTGCTAGGGCAATGTGGAAGG - Intronic
1126037501 15:44560045-44560067 CTCTTTAAACGTAAGGTGGCCGG - Intronic
1126256100 15:46627432-46627454 CTCTACTAGGGAAATGTGGAAGG + Intergenic
1128989135 15:72244107-72244129 CTAGTTAAGGCTAATGGGGAAGG - Intronic
1130308355 15:82730655-82730677 CTCTTGAAGAGTAAGGTGGGAGG + Intergenic
1131722751 15:95188339-95188361 CTCTACTAGGGCAATGTGGAGGG + Intergenic
1132437893 15:101825769-101825791 CTCTATACAGGTAAAGTGGAAGG + Intergenic
1134374266 16:13656248-13656270 CTCAGTAAGGGTTATTTGGATGG - Intergenic
1134602616 16:15545412-15545434 CTCTCTAAGGGAAGTCTGGATGG - Intronic
1135853391 16:25984712-25984734 GTCATTCATGGTAATGTGGATGG - Intronic
1137071380 16:35907649-35907671 GTTTTTAAGGATAATGCGGAAGG + Intergenic
1137335828 16:47547716-47547738 CTGTTTATGGGTACTGAGGATGG - Intronic
1138024738 16:53513476-53513498 CTCTGCTAGGGTAGTGTGGAAGG - Intergenic
1138626935 16:58259967-58259989 CTTTTTAAGGTTACTGTGGTAGG + Intronic
1139017114 16:62703774-62703796 GGCTTTGAGGGTAAAGTGGAAGG + Intergenic
1139188237 16:64832675-64832697 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1141201984 16:81905232-81905254 CTCGTTCAGGGTAACCTGGAGGG + Intronic
1145836925 17:27961363-27961385 CTCTGGAAGGCTAAGGTGGAAGG + Intergenic
1148220774 17:45860261-45860283 GTCTCTAAGGGGATTGTGGAGGG + Intergenic
1149857291 17:60093990-60094012 CTCTTTAGGAGTACAGTGGAGGG - Intergenic
1150386865 17:64768211-64768233 CCTTTGAAGGTTAATGTGGATGG - Intergenic
1150812647 17:68368791-68368813 CTCTTCACAGGTAATGTGCAAGG - Intronic
1151697627 17:75725939-75725961 CTCATCAAAGGTAATGGGGAAGG + Intronic
1153225378 18:2895808-2895830 CTCTTGAAGGGTGACGTGGCTGG + Intronic
1155171548 18:23270408-23270430 CTCTTCTAGGGCAGTGTGGATGG + Intronic
1157605839 18:48925444-48925466 TGCTTTAAGGGAAATGGGGAAGG - Intronic
1157919374 18:51699131-51699153 CTTTTTAAGGATAATGCAGATGG - Intergenic
1159319621 18:66830324-66830346 CTCTGCTAGGGTATTGTGGAGGG - Intergenic
1159580730 18:70232051-70232073 CTCTTTGAGGCCAAGGTGGAAGG - Intergenic
1159811833 18:73025906-73025928 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1160072454 18:75640542-75640564 CTCTGTAAGGTTTAAGTGGAAGG - Intergenic
1160096467 18:75878001-75878023 CTCTGCTAGGGTAGTGTGGAAGG + Intergenic
1161592560 19:5135390-5135412 CTTTTGGAGGGTAATGTGGCCGG - Exonic
1163939265 19:20477625-20477647 GTTTTTAAGGGTAATGTGAACGG + Intergenic
1164582278 19:29442056-29442078 CCCTTTAAGGCTGATGGGGAGGG - Intergenic
925093042 2:1170429-1170451 CTCTTTGTGGGTAATCAGGAAGG + Intronic
926461124 2:13130713-13130735 CTCTACTAGGGTAGTGTGGAGGG + Intergenic
930273932 2:49289511-49289533 ATCTTAAAGGTTAATATGGATGG + Intergenic
930435551 2:51336957-51336979 CTCTTTATGGGTAATAAAGATGG - Intergenic
930544143 2:52745816-52745838 CTCTGTAAAGGCAGTGTGGAAGG + Intergenic
930560084 2:52949961-52949983 CTCTGTTAGGGCAGTGTGGAAGG - Intergenic
931119393 2:59199420-59199442 CTCTGTTAGGGCAGTGTGGAAGG + Intergenic
932923324 2:75942083-75942105 CTCTGTTAGGGCAATGTGGAAGG + Intergenic
933073256 2:77889281-77889303 GTTTTTAAGGATAATTTGGAGGG - Intergenic
936736207 2:115446293-115446315 CTCTGCTAGGGAAATGTGGAAGG + Intronic
936828707 2:116613140-116613162 GAGTTTAAGGGTAATTTGGACGG - Intergenic
936872115 2:117145880-117145902 CTCTGTTAGGGCAGTGTGGATGG - Intergenic
938251054 2:129816027-129816049 GTTTTTAAGGGGAATATGGAGGG + Intergenic
938786772 2:134636974-134636996 GTTTTTAAGGATAATGTGGTGGG - Intronic
938868837 2:135452961-135452983 CTCTGTTAGGGCAGTGTGGAAGG - Intronic
938973392 2:136452621-136452643 TTTTTTAAGGGTAATTTGGTGGG + Intergenic
939496630 2:142934238-142934260 CTTTTTAAGGGCAATGTGGATGG + Intronic
940783609 2:157959126-157959148 CTCTGTTAGGGCAGTGTGGAAGG - Intronic
941468896 2:165860722-165860744 CTCTGCTAGGGTAGTGTGGAAGG - Intronic
942803576 2:179903339-179903361 CTCTACTAGGGCAATGTGGAGGG - Intergenic
944003124 2:194866293-194866315 CTCATTATGGGTAATATGTATGG - Intergenic
946536295 2:220633125-220633147 CTCATTAAGGGTTATGAGGTGGG + Intergenic
947269779 2:228321003-228321025 CTCTTTAATGGAATTGTGGTGGG - Intergenic
948762716 2:240202761-240202783 CTCTGCAAGGGTGAGGTGGAGGG - Intergenic
1171354061 20:24530103-24530125 ATTTTTAAGGATAATGTGGAGGG - Intronic
1174549858 20:51354636-51354658 CTCTTTAAGGAGCATGAGGAAGG - Intergenic
1174765235 20:53247407-53247429 CTCTTGGAGGGCCATGTGGAGGG - Intronic
1175458948 20:59136447-59136469 TACTTTCTGGGTAATGTGGAAGG - Intergenic
1175984358 20:62756554-62756576 CTCTCTTAGGGTAATGTGCTTGG - Intronic
1177487471 21:21777933-21777955 CTCTTCTAGGGCAGTGTGGAAGG - Intergenic
1177606050 21:23379054-23379076 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1177722688 21:24928227-24928249 CTCTATGAGGGCACTGTGGAGGG + Intergenic
1177775420 21:25561579-25561601 CTCTTGAAGGGTGATGAGGTAGG + Intergenic
1178011318 21:28290091-28290113 CTCTGTTAGGGCAGTGTGGAAGG - Intergenic
1178178561 21:30132841-30132863 CTCTGTTAGGGCAGTGTGGAAGG - Intergenic
1178207499 21:30486683-30486705 CTCTACTAGGGCAATGTGGAGGG + Intronic
1182149921 22:28020705-28020727 CTCTTTAAGCTGAGTGTGGATGG - Intronic
1184627673 22:45749876-45749898 TTCTTTAAGGTTCATGTTGAGGG + Intronic
949662156 3:6291838-6291860 CTCTGCAAGGGCAGTGTGGAAGG - Intergenic
953379366 3:42455285-42455307 CTCTGCTAGGGTAGTGTGGAAGG - Intergenic
954759551 3:52864141-52864163 CTCTGCTAGGGCAATGTGGAAGG - Intronic
956205420 3:66749945-66749967 CTTTTAAAGAGTAAAGTGGATGG - Intergenic
956348845 3:68311875-68311897 CTCTGCTAGGGTAGTGTGGAAGG - Intronic
956722015 3:72126351-72126373 TTCTTGAAGGGGAATCTGGAAGG - Intergenic
957726595 3:84073904-84073926 GTTTTTAAGGGTAATTTGGTGGG + Intergenic
957840708 3:85665503-85665525 CTCTTTCAAGTTAAAGTGGATGG + Intronic
958481637 3:94651931-94651953 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
958713349 3:97745823-97745845 ATTTTTAAGGGTAATTTTGATGG + Intronic
959695664 3:109246435-109246457 CTCTGCCAGGGTAGTGTGGAAGG - Intergenic
959928849 3:111956285-111956307 CTCTTAAATGGTAATGTTAATGG - Intronic
961173433 3:124815409-124815431 CTCTTTAAGGCTTCTGCGGAGGG - Intronic
962922198 3:139960327-139960349 CTCTGAAAGGGAAATGTGGGGGG - Intronic
963108057 3:141663509-141663531 GTTTTTAAGGGTAATTTGGTGGG + Intergenic
965066648 3:163858171-163858193 CTCTGTTAGGGCAATGTGGAAGG + Intergenic
965872332 3:173277479-173277501 CTCTCTAAGGTTAATGCAGACGG - Intergenic
967154972 3:186683837-186683859 CTCTTCTAGGGCAATGTCGAAGG - Intergenic
967501609 3:190204147-190204169 CTCTTCTAGGGCAGTGTGGAAGG + Intergenic
967505238 3:190246023-190246045 CTCTGCTAGGGCAATGTGGAAGG - Intergenic
968057739 3:195705590-195705612 CTCTTTAGGGCTAAACTGGAGGG - Intergenic
969121911 4:4917039-4917061 CTCTGCTAGGGTAGTGTGGAAGG - Intergenic
970756867 4:19437458-19437480 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
970793914 4:19890265-19890287 CTCCTTAAGGGTAATGCGGACGG - Intergenic
970929872 4:21496987-21497009 CTCTCTAAGGGGCATGTGGAGGG + Intronic
971939807 4:33200062-33200084 CTCTGATAGGGTAGTGTGGAAGG + Intergenic
973052198 4:45610097-45610119 CTCTTTAAGGATAATGTGGACGG - Intergenic
974013052 4:56624828-56624850 CTCTTCTAGGGCAGTGTGGAAGG + Intergenic
974563443 4:63553002-63553024 CTCTGTTAGGGGATTGTGGAAGG - Intergenic
974570540 4:63641601-63641623 CTTTTTAAGAGTAAAGTGAAAGG + Intergenic
974950497 4:68579322-68579344 CTCTTTAAGGGTGATGTGGATGG - Intronic
974958884 4:68674841-68674863 CTCTTTAAGGGTGATGTGGATGG - Intergenic
975373702 4:73617800-73617822 CTCTCTAACTGTAATGTGAAAGG + Intronic
975480577 4:74875428-74875450 CTGTCTAAGGTCAATGTGGAGGG - Intergenic
975629046 4:76381107-76381129 CTCTACTAGGGTAATGTGGAGGG + Intronic
975804294 4:78096458-78096480 CTCTGCTAGGGTAGTGTGGAAGG - Intronic
975964566 4:79955557-79955579 CTCTCTGAGGGCAATGTGCAGGG + Intronic
976296534 4:83478271-83478293 CTCTATAAGGGCACTTTGGATGG + Intronic
976299923 4:83507733-83507755 CTGTTTAAGGGTAATGTGGACGG + Intronic
976503115 4:85814839-85814861 CTCTGCTAGGGCAATGTGGAAGG - Intronic
977339876 4:95744530-95744552 CTCTGCTAGGGTAGTGTGGAAGG + Intergenic
978769924 4:112444439-112444461 CTCTTTGGGGTTAATGTTGAAGG + Intergenic
978904072 4:113985580-113985602 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
979906514 4:126300476-126300498 CTCTTCTAGGGCAATGTGGAAGG - Intergenic
979922987 4:126524639-126524661 CTCTTCTAGGGCAGTGTGGAAGG - Intergenic
980407021 4:132366516-132366538 CTCTACTAGGGTAGTGTGGAGGG - Intergenic
980586018 4:134817065-134817087 CTCTTCTAGGGCAATGTGGAAGG - Intergenic
980728040 4:136789745-136789767 TTCTTTTAGGGTAATATAGAGGG - Intergenic
980904900 4:138938828-138938850 CACTTTAAAGTTAAAGTGGAAGG + Intergenic
981131394 4:141161950-141161972 CTCTACTAGGGTAATGTGGAGGG + Intronic
981454740 4:144940395-144940417 CTCTTTCAGTGTAATGTGAGTGG - Intergenic
982208120 4:153012630-153012652 TTTTTTAATGGTAAAGTGGAGGG - Intergenic
982504915 4:156205455-156205477 CTCTGTTAGGGAAATGCGGAAGG - Intergenic
982886397 4:160788057-160788079 CTCTTCTAGGGCAGTGTGGAAGG + Intergenic
983331494 4:166334204-166334226 CTCTTTAAAGTTACTGTGAAGGG - Intergenic
983348649 4:166559386-166559408 CTCTGCTAGGGTAGTGTGGAAGG + Intergenic
983477023 4:168225884-168225906 ATTTTTAAGGGTAATGAGTAAGG - Intronic
983641739 4:169949738-169949760 TTCTTCAAGGGTGATTTGGAAGG - Intergenic
986520162 5:8606837-8606859 CTTTTTAGGGGTGATGTGGAAGG + Intergenic
986756734 5:10843855-10843877 CTCTGCTAGGGCAATGTGGAAGG - Intergenic
986759780 5:10869371-10869393 CTATTTTAGGGAAAGGTGGATGG + Intergenic
986873414 5:12078518-12078540 CTCTTCTAGGGCAGTGTGGAAGG - Intergenic
987641428 5:20616780-20616802 TTATTTAAGGGTATTGTGAAAGG - Intergenic
987895646 5:23942995-23943017 CTCTGCTAGGGCAATGTGGAAGG - Intergenic
988613539 5:32751328-32751350 CTCTCTAAGGGTACAATGGAAGG - Intronic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
990185153 5:53203441-53203463 CTCTTTAAGGGTAATGCGGACGG - Intergenic
990193285 5:53286232-53286254 CTCTTCTAGGGCAGTGTGGAAGG - Intergenic
991184842 5:63794850-63794872 CTCTGTTAGGGCAGTGTGGAAGG - Intergenic
991535943 5:67669414-67669436 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
992138112 5:73768172-73768194 CTCTGCTAGGGTAGTGTGGATGG + Intronic
992418707 5:76579528-76579550 TTATTTCAGGGTAATGGGGAAGG - Intronic
993215858 5:85021789-85021811 CTCTTGTAGGGCAATGTGGAAGG - Intergenic
993257866 5:85616704-85616726 CTCTACTAGGGTAGTGTGGAAGG - Intergenic
994425223 5:99576679-99576701 CTCTACAAGGGCAATGTAGAGGG + Intergenic
994436116 5:99735554-99735576 CTCTACAAGGGCAATGTAGAGGG - Intergenic
994524222 5:100882943-100882965 CTCTGCAAGGGCAGTGTGGAAGG + Intronic
994937549 5:106273985-106274007 GTCTTTAAGGGTATCATGGAGGG + Intergenic
995147793 5:108806339-108806361 CTCTGCTAGGGCAATGTGGAAGG + Intronic
995357943 5:111261101-111261123 GTCTTTAAGGATAAAGTGGTTGG - Intronic
995391007 5:111640137-111640159 CTCTGCTAGGGTAGTGTGGAAGG + Intergenic
995690935 5:114825215-114825237 CTCTGTTAGGGCATTGTGGAAGG - Intergenic
995977440 5:118057264-118057286 CTTTTGAAGGTTAATGTGGGTGG - Intergenic
996598788 5:125236809-125236831 CTCTGTAATGATACTGTGGAGGG + Intergenic
997057317 5:130460010-130460032 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
999668111 5:153934435-153934457 CTCTGCTAGGGTAGTGTGGAAGG - Intergenic
1000900608 5:166907523-166907545 CTATGTCAGGGTAAGGTGGAGGG + Intergenic
1001795530 5:174499089-174499111 CTCTTCTAGGGCAGTGTGGAAGG + Intergenic
1002113382 5:176937183-176937205 CTCTTTAAAGGTAATGTTTGAGG - Intronic
1004753317 6:18585420-18585442 CTCTCCAAGGGCAATGTGCACGG + Intergenic
1005816393 6:29556138-29556160 CACTTTCAGGGTAAGGTGGATGG + Exonic
1005908166 6:30283889-30283911 CTCTACTAGGGTAGTGTGGAGGG - Intergenic
1005921740 6:30407715-30407737 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1006344176 6:33466563-33466585 CTCTGCTAGGGTAATGCGGAAGG + Intergenic
1006919021 6:37615455-37615477 GCCTTTTTGGGTAATGTGGATGG - Intergenic
1007235118 6:40385291-40385313 GTCCTTCAGGGTAATGTGTAAGG + Intergenic
1007466922 6:42059018-42059040 GTTTTTAAGGATAATGTGGTAGG + Intronic
1008951335 6:57163122-57163144 CTCTTTTGGGGTGATGAGGAGGG - Intronic
1011513097 6:88123084-88123106 GTCTTTAAGGTTAATTTGGTGGG - Intergenic
1011870971 6:91892221-91892243 ATGTTTAAGGGGATTGTGGAGGG - Intergenic
1012033224 6:94099586-94099608 CTCTTTTAGGGGAATTTGGAGGG - Intergenic
1012446034 6:99307832-99307854 ATCTTAAAGGTTTATGTGGAGGG - Intronic
1012693191 6:102342724-102342746 CTCTTTAAGGCTAATGCCAATGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013659122 6:112276582-112276604 CTTTTGAAGGGTAATGGAGATGG - Intergenic
1014951223 6:127558319-127558341 CTCTGCTAGGGTAGTGTGGAAGG + Intronic
1016292429 6:142539576-142539598 CTCTTTAAGGATAATGCAGATGG - Intergenic
1016589941 6:145733940-145733962 TTCTTTAAAGGAAATGTGCAAGG - Intronic
1016790201 6:148060004-148060026 CTCTGCAAGGGCAATGTGAAAGG - Intergenic
1018270522 6:162072322-162072344 CTCTTTGAGGGTATATTGGAGGG + Intronic
1018466148 6:164047479-164047501 CTCTGTTAGGGTAGGGTGGAAGG + Intergenic
1018556544 6:165056966-165056988 CTTTTGAAGGGTAATGTGTAGGG - Intergenic
1021111684 7:16701929-16701951 CTTGTTAAAGGTAATTTGGAGGG + Intronic
1021276143 7:18653917-18653939 CTCTCTTAGGTTACTGTGGATGG - Intronic
1021680048 7:23121138-23121160 GTCTTTCACGGCAATGTGGATGG - Intronic
1022003368 7:26246050-26246072 CTCTTTAAGGGTAATGCGGATGG - Intergenic
1022186262 7:27972413-27972435 CTCTTTTAGGGGAAGGAGGATGG + Intronic
1023970728 7:44988828-44988850 GTTTTTAAGGATAATTTGGAGGG + Intergenic
1024532762 7:50407026-50407048 ATCTCTAAGGGGGATGTGGATGG - Intergenic
1024843977 7:53620609-53620631 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027917434 7:84343569-84343591 CTCTCTAAGGGAAATGTGTCTGG + Intronic
1028581718 7:92416021-92416043 CTCTAGAAGGGCTATGTGGATGG - Intergenic
1029235721 7:99116605-99116627 CTCTTTGATGCTAATGTAGATGG - Intronic
1029803894 7:102976650-102976672 CTCTTTAAGGGTAATGTGGACGG - Intronic
1030784261 7:113640823-113640845 CTCTGCTAGGGCAATGTGGAAGG - Intergenic
1031173675 7:118322176-118322198 ATCTTTAAGAGGATTGTGGAAGG + Intergenic
1031288923 7:119908021-119908043 CTCTTCTAGGGCAATGTGAAAGG - Intergenic
1032747722 7:134804960-134804982 ATTTTTAAGGGTAATTTGGTGGG + Intronic
1033002945 7:137526908-137526930 CTCTTTATGGATAAAGTGGATGG + Intronic
1033885055 7:145934224-145934246 CTCTTCTAGGGCAGTGTGGAAGG + Intergenic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034742933 7:153495285-153495307 CTCTGTTAGGGCAGTGTGGAAGG + Intergenic
1035065206 7:156099351-156099373 TTTTTTAAGGATAATGTAGAGGG + Intergenic
1035288762 7:157823867-157823889 GTCTCTAAGGGGAATCTGGAGGG + Intronic
1036000287 8:4594882-4594904 CTCTGTAAAAGGAATGTGGATGG + Intronic
1038060513 8:23907257-23907279 CTCTTCAAGGGGAAGGTAGAAGG - Intergenic
1039345927 8:36705119-36705141 GTTTTTAAGGGTAATTTGGTGGG + Intergenic
1041013852 8:53571346-53571368 CTCTATTAGGGTAATGCAGAGGG + Intergenic
1041153290 8:54958060-54958082 CTCTTGAAGGGAAAGGAGGATGG - Intergenic
1042158145 8:65866265-65866287 CTCTTTAAGGGTAATGCGGACGG - Intergenic
1042654217 8:71077872-71077894 CTCTTTAATGGTGATGATGATGG - Intergenic
1043413481 8:80024510-80024532 CTTTGTAAGGATAATGTGTATGG + Intronic
1044879817 8:96712399-96712421 CTCTGCTAGGGTGATGTGGAAGG - Intronic
1045139852 8:99268208-99268230 CTCTGTTAGGGCAGTGTGGAAGG + Intronic
1045561841 8:103271562-103271584 CTCTTCTAGGGAAGTGTGGAGGG + Intergenic
1045804562 8:106143434-106143456 CTCTTTAAAAGTTAGGTGGAGGG + Intergenic
1045979720 8:108170638-108170660 CTCTTTGAGGCTATTGTGAATGG - Intergenic
1046175538 8:110570919-110570941 CTCTGCTAGGGTAGTGTGGAGGG - Intergenic
1046880185 8:119299107-119299129 CTCTGCTAGGGCAATGTGGAAGG - Intergenic
1047209990 8:122833432-122833454 CTCTTTAACAGTAATGCGGACGG + Intronic
1047798684 8:128285940-128285962 ATCTTTAAAAGTAATGTGAATGG - Intergenic
1047924527 8:129669747-129669769 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1047965460 8:130042973-130042995 CTCTTTTAGGGCAATGGAGAGGG - Intergenic
1048116732 8:131532028-131532050 CTCTGCTAGGGTAGTGTGGAAGG + Intergenic
1048130732 8:131694059-131694081 CTCTACTAGGGCAATGTGGAGGG - Intergenic
1048704035 8:137129949-137129971 CTCCGAAAGGGTAATGTGTATGG + Intergenic
1048768285 8:137867860-137867882 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1049676675 8:143892352-143892374 CTGTTTAAGAGAAATCTGGATGG - Intergenic
1050410128 9:5355129-5355151 GTGTTTATGGGTAATGTTGAAGG - Intergenic
1050945420 9:11511061-11511083 CTCTCTTAGGGCAATGTGGAAGG + Intergenic
1050945556 9:11511976-11511998 CTCTGTTAGGGCAATGTGGAAGG + Intergenic
1051227150 9:14911239-14911261 CTCTTTATGGTTAATTTAGAAGG - Intergenic
1052208292 9:25870024-25870046 CTCTACTAGGGCAATGTGGAGGG - Intergenic
1052732625 9:32307470-32307492 ATTTTTAAGGGGATTGTGGAGGG - Intergenic
1052969408 9:34367893-34367915 CTCTGTTAAGGCAATGTGGAAGG - Exonic
1053496180 9:38549814-38549836 CTCTACTAGGGAAATGTGGAAGG + Intronic
1055175560 9:73313852-73313874 CTCTGCTAGGGCAATGTGGAAGG - Intergenic
1055690076 9:78820635-78820657 TTCTTTAAAGGAAATGTGCATGG + Intergenic
1055975972 9:81955582-81955604 CTCTGCTAGGGAAATGTGGAAGG - Intergenic
1057781625 9:98055331-98055353 GTTTTTAAGGATAATGTGGTGGG + Intergenic
1058141188 9:101358136-101358158 CTCTGCTAGGGCAATGTGGAAGG - Intergenic
1058649224 9:107159455-107159477 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1060709716 9:125847157-125847179 CTCTTTATTGGTAATGTTGGCGG + Intronic
1062348558 9:136127367-136127389 CTCTGAAAGGGTGATGTGGAAGG - Intergenic
1186222744 X:7366754-7366776 CTCTTCTAGGGCAGTGTGGAAGG + Intergenic
1186266616 X:7840523-7840545 CTCTGCTAGGGTAGTGTGGAAGG - Intergenic
1186425564 X:9462747-9462769 CTCTTTACGGGTAATAAGGGTGG + Intergenic
1187833299 X:23404821-23404843 CTCTTTAAGAGTAATTAGTATGG + Intergenic
1188286292 X:28328898-28328920 GTTTTTAAGGATAATTTGGAGGG + Intergenic
1188396935 X:29696302-29696324 CTCTTTTTGGGTAAAGTTGAGGG - Intronic
1188530308 X:31133131-31133153 CTCCATAAGGGCAATGAGGAGGG - Intronic
1188554342 X:31395124-31395146 CTCTTTAGGGGAATTGAGGAAGG - Intronic
1189371302 X:40431660-40431682 CTCTATTAGGGCAGTGTGGAAGG + Intergenic
1189415235 X:40806892-40806914 GTTTTTAAGGATAATGTGGTGGG + Intergenic
1189619647 X:42821926-42821948 GTTTTTAAGGATAATGTGGTGGG + Intergenic
1190143897 X:47873194-47873216 ATCTTTATGGGAACTGTGGAGGG + Intronic
1191202915 X:57803649-57803671 CTCTGCTAGGGTAGTGTGGAAGG + Intergenic
1191734761 X:64377172-64377194 CTCTACTAGGGTAGTGTGGAAGG + Intronic
1191877740 X:65813199-65813221 CTCTTTCAGGGCAGTGAGGAAGG + Intergenic
1192967575 X:76195519-76195541 CTCTGCTAGGGTAGTGTGGAAGG - Intergenic
1193346662 X:80411975-80411997 CTCTGTTAGGGCAGTGTGGAAGG - Intronic
1193564119 X:83056378-83056400 CTCTACCAGGGCAATGTGGAGGG - Intergenic
1194048026 X:89033613-89033635 CTCTACTAGGGTACTGTGGAGGG - Intergenic
1194321143 X:92447640-92447662 CTCTGCTAGGGCAATGTGGAAGG + Intronic
1194473985 X:94335736-94335758 CTCTGCTAGGGCAATGTGGAAGG + Intergenic
1194577146 X:95627150-95627172 CTTTTTAAGGATAATTTGGTGGG - Intergenic
1195545257 X:106106292-106106314 CTCTGTTAGGGTGGTGTGGAAGG + Intergenic
1195698800 X:107686413-107686435 GGCTTTAAGGGCAATTTGGATGG - Intergenic
1196374634 X:115019500-115019522 GTCCTTAAAGGTAATATGGAAGG - Intronic
1196711304 X:118766139-118766161 CTCTTTATGGTTAATATGGGAGG + Intronic
1197625617 X:128798950-128798972 CACCTTAAAGGTAATGTGGTGGG - Intergenic
1197802442 X:130365644-130365666 CTCTATAAGGGCACTGTTGATGG + Exonic
1198941706 X:141963888-141963910 CTCTGTTAGGGCAGTGTGGAAGG - Intergenic
1199029574 X:142980982-142981004 ATCTTTAAAGGGAAAGTGGATGG - Intergenic
1200257185 X:154589428-154589450 CTCAGTAAGGGGAATGTGGCAGG - Intergenic
1200260585 X:154614974-154614996 CTCAGTAAGGGGAATGTGGCAGG + Intergenic