ID: 1029804427

View in Genome Browser
Species Human (GRCh38)
Location 7:102981692-102981714
Sequence CTGTGTCCACACATGGCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2709
Summary {0: 1, 1: 3, 2: 237, 3: 728, 4: 1740}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029804425_1029804427 1 Left 1029804425 7:102981668-102981690 CCTGGTTTATACACAGTCATTTC 0: 1
1: 0
2: 5
3: 16
4: 185
Right 1029804427 7:102981692-102981714 CTGTGTCCACACATGGCAGTAGG 0: 1
1: 3
2: 237
3: 728
4: 1740
1029804424_1029804427 7 Left 1029804424 7:102981662-102981684 CCACTTCCTGGTTTATACACAGT 0: 1
1: 2
2: 15
3: 97
4: 427
Right 1029804427 7:102981692-102981714 CTGTGTCCACACATGGCAGTAGG 0: 1
1: 3
2: 237
3: 728
4: 1740
1029804423_1029804427 8 Left 1029804423 7:102981661-102981683 CCCACTTCCTGGTTTATACACAG 0: 1
1: 2
2: 36
3: 174
4: 613
Right 1029804427 7:102981692-102981714 CTGTGTCCACACATGGCAGTAGG 0: 1
1: 3
2: 237
3: 728
4: 1740

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029804427 Original CRISPR CTGTGTCCACACATGGCAGT AGG Intronic
Too many off-targets to display for this crispr