ID: 1029809764

View in Genome Browser
Species Human (GRCh38)
Location 7:103035309-103035331
Sequence TGGGATTCCCAGACACAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029809758_1029809764 23 Left 1029809758 7:103035263-103035285 CCAGACAGACACTAGGAGGAATT 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1029809764 7:103035309-103035331 TGGGATTCCCAGACACAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029809764 Original CRISPR TGGGATTCCCAGACACAAAT GGG Intronic
No off target data available for this crispr