ID: 1029810049

View in Genome Browser
Species Human (GRCh38)
Location 7:103038146-103038168
Sequence CCGAGCCAGGCATGGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029810049_1029810056 -5 Left 1029810049 7:103038146-103038168 CCTCCCTCCCATGCCTGGCTCGG No data
Right 1029810056 7:103038164-103038186 CTCGGTGAGTCCCACACCCATGG 0: 3
1: 21
2: 119
3: 567
4: 2098

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029810049 Original CRISPR CCGAGCCAGGCATGGGAGGG AGG (reversed) Intronic