ID: 1029810049

View in Genome Browser
Species Human (GRCh38)
Location 7:103038146-103038168
Sequence CCGAGCCAGGCATGGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 349}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029810049_1029810056 -5 Left 1029810049 7:103038146-103038168 CCTCCCTCCCATGCCTGGCTCGG 0: 1
1: 0
2: 1
3: 42
4: 349
Right 1029810056 7:103038164-103038186 CTCGGTGAGTCCCACACCCATGG 0: 3
1: 21
2: 119
3: 567
4: 2098

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029810049 Original CRISPR CCGAGCCAGGCATGGGAGGG AGG (reversed) Intronic
900110277 1:1002311-1002333 CCCAGCCACGCTTGGCAGGGAGG - Intergenic
900193153 1:1359937-1359959 CGGAGACAGACATGGGCGGGCGG - Intronic
900400385 1:2470655-2470677 CATAGCCAGGCGCGGGAGGGAGG - Intronic
900418723 1:2546496-2546518 CGGGGCCAGGCAGGGGCGGGTGG + Intergenic
901018005 1:6242617-6242639 CCGACCCGGGCCTGGGAGGGCGG - Intergenic
901379320 1:8862507-8862529 TGGAGCCAGGGCTGGGAGGGAGG - Intronic
901455213 1:9359262-9359284 CCGAGCAAAACATTGGAGGGTGG + Intronic
901529272 1:9843312-9843334 CCGAGCTGGGCCTGGGAGGGTGG + Intergenic
902082853 1:13833120-13833142 CCGAGCCAGGCATTCTAGGTGGG + Intergenic
902735948 1:18400836-18400858 CAGAGCCTGGCAGGGAAGGGAGG - Intergenic
903777901 1:25805034-25805056 CGGAGCCAGGCAGGGGGTGGGGG - Intronic
905223066 1:36462214-36462236 AAGAGCCAGGTCTGGGAGGGTGG - Intronic
905489907 1:38335216-38335238 CCTTGCCAGTCCTGGGAGGGGGG - Intergenic
906032909 1:42734792-42734814 CAAGGCCAGGCTTGGGAGGGGGG + Exonic
907304232 1:53504979-53505001 AGGAGCCCAGCATGGGAGGGAGG - Intergenic
909510270 1:76444858-76444880 CCAAGCCAGGGATGGCTGGGAGG - Intronic
913521732 1:119650910-119650932 CAGAGGAAGGCTTGGGAGGGAGG + Intergenic
914747301 1:150509861-150509883 CCTAGCCAGGGCTGGGAGTGGGG - Exonic
914815686 1:151060326-151060348 CCGAGTCAGGCAGGAGGGGGCGG + Exonic
914920949 1:151847195-151847217 CCCAGGCAGGCAGGGGAGGCAGG + Intergenic
914997902 1:152560978-152561000 CCAAGCCAGGCATCGGGGGAGGG - Intronic
915308248 1:154993430-154993452 TCTAGACAGGGATGGGAGGGTGG - Intergenic
915474833 1:156147332-156147354 CAGGGCCAGGCATGGCAGGGAGG - Intergenic
919839207 1:201597114-201597136 CCGTGCCTGGCCTGGCAGGGTGG + Intergenic
920096338 1:203488690-203488712 CTGGGCCAGGCAATGGAGGGTGG - Exonic
920571195 1:207019270-207019292 CCCAGCCTGGCATGATAGGGGGG - Exonic
920692951 1:208160435-208160457 CTGACCCAGGCATGGGAGGGAGG + Intronic
1064407127 10:15074044-15074066 CCCAGCCAGACATGCCAGGGTGG - Intergenic
1065024267 10:21526200-21526222 CCGCGCCGGGCCTGCGAGGGAGG + Intergenic
1069604681 10:69731858-69731880 CCCTGCCAGGAATGGGAGTGGGG + Intergenic
1069897142 10:71686950-71686972 CTGAGCCTGGCAGGGTAGGGTGG - Intronic
1069906089 10:71733228-71733250 CAGAGCAAGGCATGGGAGAAGGG + Intronic
1070747317 10:78941877-78941899 CAGGGCCTGGCAGGGGAGGGAGG + Intergenic
1070752989 10:78974781-78974803 CAGAGCCAGGCTGGGGAGGAAGG - Intergenic
1072615695 10:97047829-97047851 CCGTGCCTGCCATGAGAGGGTGG + Exonic
1074560863 10:114534177-114534199 CAGAGCCAGGGATGGGAGCTGGG + Intronic
1075454265 10:122574775-122574797 TCCAGCCAGGGATGGGAGTGAGG + Intronic
1075684547 10:124354363-124354385 CTGAGACCGGCATTGGAGGGAGG - Intergenic
1075686360 10:124367680-124367702 CGGATCCAGGCATTGGAGCGGGG - Intergenic
1075780687 10:125015478-125015500 CCCAGCGAGGCAGGGGAGGATGG - Intronic
1075942995 10:126407296-126407318 CCATGCCAGGCTTGAGAGGGTGG + Intergenic
1075954033 10:126506987-126507009 CAGAGTCAGGCATGGGAAGATGG + Intronic
1076540734 10:131213162-131213184 ACCAGGCAGCCATGGGAGGGAGG - Intronic
1076541284 10:131216773-131216795 GCGGGCCAGGCATGGGAGTGGGG + Intronic
1076907904 10:133372668-133372690 CAGAGCCAGGCAGGGGGTGGGGG + Intronic
1077251418 11:1562318-1562340 CCTAGCCAGGAATGGGAGTCAGG - Intronic
1078086101 11:8233753-8233775 CAGAGCCAGGCTGGGGAAGGAGG - Intronic
1079119934 11:17674807-17674829 CCAAGGCAGGCATGGGATGCAGG - Intergenic
1081782741 11:45724406-45724428 TGGAGGCAGGCATGGGAGGGAGG - Intergenic
1082943550 11:58734270-58734292 ATGAGCCAGGCATGGTACGGTGG + Intergenic
1082988378 11:59186748-59186770 CAGGGCCAGGCATGGTATGGTGG - Intronic
1083594045 11:63910698-63910720 CTGAGCCTGGCCTGGGAGCGGGG - Exonic
1084491233 11:69479758-69479780 CCGAGCTGGGCAGGAGAGGGTGG - Intergenic
1084531218 11:69728950-69728972 CCAGCCCAGGCCTGGGAGGGAGG + Intergenic
1084573016 11:69970827-69970849 CCGTGCTGAGCATGGGAGGGCGG - Intergenic
1084649214 11:70478847-70478869 CAGAGCCAGACCTGGGAGTGGGG + Intronic
1090387125 11:126363868-126363890 CGGTGCCGGGCCTGGGAGGGTGG - Intronic
1090407067 11:126482753-126482775 CCAAGCCAGGCAGGGCAGCGTGG - Intronic
1091360656 11:134976535-134976557 CCGGGCCAGGGATGGGAGAGAGG - Intergenic
1091460864 12:642852-642874 GCGAGCCGGGCAGGGGAGCGGGG - Intronic
1091802150 12:3331082-3331104 CCGAGCCTGGCAGGGGAATGAGG - Intergenic
1092145587 12:6212482-6212504 ACGAGCCAGGCATAGCAAGGTGG + Intronic
1092180340 12:6442589-6442611 CCCAGCCAGGCATGGGGGAGAGG + Intergenic
1093984492 12:25514216-25514238 CAGACCCAAGCATAGGAGGGAGG + Intronic
1094484610 12:30914653-30914675 CTGAGCCTGGGGTGGGAGGGTGG + Intergenic
1094607342 12:31959770-31959792 CCGAGCCTTGCACCGGAGGGCGG + Intronic
1095943335 12:47740109-47740131 CAGAGCCAGGCCGGGCAGGGTGG + Intronic
1096212339 12:49776307-49776329 CCCAGCCTGGCATGGGAGGCGGG - Intergenic
1096677223 12:53232298-53232320 CAGGGGCAGGCAGGGGAGGGAGG - Intronic
1099436201 12:82648506-82648528 CCGTGACAGTCATGGAAGGGAGG + Intergenic
1101835475 12:108292086-108292108 CAGAGCCAGGCATGGCAGTGTGG + Exonic
1102258878 12:111431246-111431268 TCGAGTCAGGCATGGGGTGGGGG - Intronic
1102457032 12:113077334-113077356 CACAGCCAGGCAAGGGTGGGCGG - Intronic
1102484445 12:113246564-113246586 CCGGGCCGGACATAGGAGGGAGG - Intronic
1102731367 12:115113760-115113782 CCGGGCCTGTCATGGGGGGGTGG + Intergenic
1102937708 12:116911374-116911396 CCGGCGCAGGCATGGGCGGGGGG - Intronic
1103022750 12:117549346-117549368 AAGAGCAAGGCTTGGGAGGGTGG - Intronic
1103551043 12:121737657-121737679 CCCAGCCAGGGAAGAGAGGGTGG + Intronic
1103722820 12:122983688-122983710 CCGAGCCAGGGAGGGGTGGGGGG + Exonic
1104415588 12:128594566-128594588 CCGAGCCTTGCTTGGGAGGGAGG - Intronic
1104861734 12:131927685-131927707 CCGAGGCAGGAAGGGGAGGCAGG - Intergenic
1104927809 12:132322648-132322670 CGTCCCCAGGCATGGGAGGGGGG + Intronic
1105418657 13:20233607-20233629 CCTAGCCAGGCATGGTGGTGCGG - Intergenic
1105572011 13:21611617-21611639 GGGTGCCAGGCATGGCAGGGAGG + Intergenic
1105874872 13:24542174-24542196 TGGAGCCCGGCAGGGGAGGGAGG + Intergenic
1106192667 13:27467296-27467318 CCAAGGTAGGAATGGGAGGGAGG - Intergenic
1108108214 13:47036507-47036529 CCGAGACTGGCTGGGGAGGGAGG - Intergenic
1108380128 13:49847210-49847232 CAGAGCCTTGCATGAGAGGGAGG + Intergenic
1109348423 13:61145343-61145365 CACTGACAGGCATGGGAGGGAGG + Intergenic
1112333809 13:98497744-98497766 CTGCGCCAGGGATGGGAGGAAGG - Intronic
1112357050 13:98682370-98682392 CACAGCCTAGCATGGGAGGGAGG + Intergenic
1113368198 13:109697939-109697961 CCGAGGCAGTCATGTGAGTGAGG + Intergenic
1113760515 13:112843107-112843129 CCGAGCGACGCATGGTTGGGTGG + Intronic
1113907560 13:113826855-113826877 CCGGGGCAGGGATGGGTGGGCGG - Intronic
1114051490 14:18922068-18922090 CTGAGCCAGGCATGAGGGGCAGG + Intergenic
1114831567 14:26148773-26148795 CCTGTCCAGGGATGGGAGGGAGG + Intergenic
1115577272 14:34723845-34723867 CCAGGCCAGGCATGGCATGGTGG - Intergenic
1117253035 14:53954109-53954131 CGGGGCCGGGAATGGGAGGGAGG + Intronic
1121048098 14:90802573-90802595 ATGAGCTAGGCATGAGAGGGTGG + Intronic
1121270210 14:92632763-92632785 GCGAGCCAGGCAAGGAAGGGCGG + Intronic
1121781313 14:96624175-96624197 CCGAGCCAGCCATGGAGGGCGGG - Intergenic
1122153594 14:99737675-99737697 CCCAGCCCAGCATGGGGGGGTGG + Intronic
1122307111 14:100773232-100773254 GCTTGCCAGGGATGGGAGGGTGG - Intergenic
1122625789 14:103084806-103084828 CCCAGCCAGCCTTGGGAAGGAGG - Intergenic
1123018751 14:105387763-105387785 CCGAGCCAGCCATGGCAGGCTGG - Intronic
1123506059 15:20941889-20941911 CCGAGGCAGGGATGGGTTGGGGG + Intergenic
1123563289 15:21515596-21515618 CCGAGGCAGGGATGGGTTGGGGG + Intergenic
1123599540 15:21952879-21952901 CCGAGGCAGGGATGGGTTGGGGG + Intergenic
1124494221 15:30176551-30176573 CCGGGACAGACATGGGAGGTAGG + Intergenic
1124606823 15:31175686-31175708 GCCAGTCAGGCATGGGAGGCAGG - Intergenic
1124636879 15:31371217-31371239 CCGAGTGAGGGATGGGAAGGAGG + Intronic
1124749349 15:32362094-32362116 CCGGGACAGACATGGGAGGTAGG - Intergenic
1126181489 15:45789212-45789234 CAGAGCCAAGCTTGGGAGGTAGG - Intergenic
1128292769 15:66490677-66490699 CAGAGACAGGCATGGGAAGGAGG - Exonic
1128496900 15:68203952-68203974 CAAAACCAGGCATGGGTGGGAGG + Intronic
1129117772 15:73374840-73374862 CAGAGCCAGGCCAGAGAGGGAGG + Intergenic
1129258062 15:74345412-74345434 CCCAGCCAGGCAGAGCAGGGAGG - Intronic
1129440575 15:75578586-75578608 GCGAGCCGGGCACGGGAGCGGGG + Intronic
1129875551 15:78973270-78973292 CCCAGCCAGGCAGGGGAAGGGGG - Intronic
1129908031 15:79203404-79203426 CAGAGCAAGGCATGGAGGGGTGG + Intergenic
1129953021 15:79608609-79608631 GCAAGCCAGGCATGAGAGGTAGG - Intergenic
1132016362 15:98320819-98320841 CCGTGCCAGGCGTGGGGAGGTGG + Intergenic
1132237595 15:100233819-100233841 GCGAGCCTGGCAAGGGAAGGAGG + Intronic
1202971643 15_KI270727v1_random:242730-242752 CCGAGGCAGGGATGGGTTGGGGG + Intergenic
1132455893 16:22741-22763 CCGATCAAGGCATGGGATGGTGG + Intergenic
1132519849 16:382005-382027 CCGAGCCGGGAAGGCGAGGGCGG + Intronic
1132646067 16:999853-999875 GAGAGCCTGGCCTGGGAGGGTGG + Intergenic
1132843491 16:1989819-1989841 CCGGGGCAGGCAGGTGAGGGTGG + Intronic
1133944714 16:10338642-10338664 CCCAGCCAGGTCTGGGAGGGAGG + Intronic
1134216616 16:12321431-12321453 CCAGGCCAGGCCTGGGAGTGAGG + Intronic
1135555997 16:23437046-23437068 TTGGGCCAGGCATGGGAGGGAGG + Intronic
1137624766 16:49900633-49900655 CCGAGCAGGGAATGGAAGGGTGG + Intergenic
1137692862 16:50441461-50441483 AGGGGCCAAGCATGGGAGGGAGG + Intergenic
1138585138 16:57964445-57964467 CCCAGGCTGGCATGGCAGGGGGG - Intronic
1138595672 16:58027767-58027789 CCTGGCCAGGCCAGGGAGGGAGG - Intronic
1138598508 16:58041878-58041900 CAGGGCCAGGCATGGGAGGCGGG - Intronic
1138607078 16:58096461-58096483 CCTAGCCAGGCAGGGGGGCGTGG - Intergenic
1139354617 16:66360160-66360182 GTGAGCCAGGCAGGGCAGGGTGG - Intergenic
1139710518 16:68772276-68772298 TCGTGCCATGCATGGAAGGGCGG + Intronic
1139921483 16:70463312-70463334 CATAGCCAGGAAGGGGAGGGAGG - Intronic
1140917827 16:79509562-79509584 TCCAGCCAGGAATGGGAAGGCGG - Intergenic
1141148819 16:81550470-81550492 CCCAGCCAAGAGTGGGAGGGGGG - Intronic
1141635590 16:85312363-85312385 CCGAGCCTTGGAAGGGAGGGCGG - Intergenic
1141830635 16:86508391-86508413 CCGAGCCAGGAAGGTGGGGGCGG + Intergenic
1141998172 16:87648078-87648100 CTGTGACAGGCATGGGAGGCAGG + Intronic
1142113884 16:88346412-88346434 CCAGGCCAGGGCTGGGAGGGAGG - Intergenic
1142799971 17:2338528-2338550 CAGAGGCAGGCAGGGGAAGGAGG - Intronic
1142890183 17:2938055-2938077 CGGAGCCAGGGCTGGGAGGAAGG + Intronic
1143266182 17:5639695-5639717 CTGAGCCAGGCAGGCAAGGGTGG + Intergenic
1143894867 17:10128056-10128078 CCCAGCCAGGCCTGGGAGCCAGG + Intronic
1144167973 17:12631242-12631264 ATGAGCCAGCCATGGGAGAGTGG + Intergenic
1144601591 17:16619799-16619821 CTAAGGCAGGAATGGGAGGGAGG + Intergenic
1144693594 17:17285857-17285879 ATTAGCCAGGCATGGTAGGGGGG - Intergenic
1144771473 17:17761920-17761942 GGGAGGGAGGCATGGGAGGGAGG + Intronic
1144859550 17:18292296-18292318 CTGAGCCAGCCTTGGGAGGATGG + Intronic
1144966477 17:19079766-19079788 ACTAGCCAGGCATGGTAGTGTGG - Intergenic
1144981441 17:19172291-19172313 ACTAGCCAGGCATGGTAGTGTGG + Intergenic
1144986783 17:19205948-19205970 ACTAGCCAGGCATGGTAGTGTGG - Intergenic
1145267317 17:21386031-21386053 CCGAGGCAGGGATCAGAGGGCGG + Intronic
1146377820 17:32306447-32306469 CCCAGTCTGTCATGGGAGGGGGG + Intronic
1146519703 17:33516801-33516823 CTAGCCCAGGCATGGGAGGGAGG - Intronic
1146682457 17:34817948-34817970 CTGAGCTAGACATAGGAGGGAGG - Intergenic
1146912583 17:36658102-36658124 CCGAGGCCCGCCTGGGAGGGCGG + Intergenic
1147374434 17:40015546-40015568 CCTGCCCTGGCATGGGAGGGAGG + Intronic
1148798435 17:50208747-50208769 TCCAGCCAGGCTTGGGAGGGTGG + Intergenic
1150280616 17:63927966-63927988 CACAGCCTGGCTTGGGAGGGAGG + Intergenic
1151824136 17:76514169-76514191 GCTAGCCAGGCAGGGGAAGGGGG + Intergenic
1151955931 17:77380265-77380287 TGGAGGCAGGCATGGGTGGGGGG - Intronic
1152008691 17:77697650-77697672 CAGAGCCAGGCAGGAGTGGGAGG + Intergenic
1152291425 17:79442123-79442145 CTGAGCCTGGCCTGGGAGGGAGG + Intronic
1152823186 17:82447540-82447562 CTGAGACAGTCATGGGGGGGTGG + Intronic
1153026894 18:680547-680569 CCCAGGCAGGGATGGGAGCGAGG - Intronic
1153487029 18:5609455-5609477 CAGGGCCAGGCCTGGGAAGGAGG - Intronic
1154494637 18:14946410-14946432 CAGGGCCAGGGATGGGAGAGAGG + Intergenic
1156895431 18:42240492-42240514 AGGAGCGAGGAATGGGAGGGAGG - Intergenic
1157120229 18:44902469-44902491 TGGAGCCAGGCAGGGGTGGGTGG + Intronic
1157184484 18:45526776-45526798 CTGAGCCAGGCAAAGTAGGGTGG + Intronic
1157909208 18:51599279-51599301 GCCAGCCAGACATGGGAGGCAGG - Intergenic
1158477514 18:57793394-57793416 CAAAGCCAGGCAAGTGAGGGTGG - Intronic
1160560120 18:79750929-79750951 CAGAGGCAGGCCGGGGAGGGAGG + Intronic
1160560191 18:79751134-79751156 CAGAGGCAGGCCGGGGAGGGAGG + Intronic
1160581815 18:79887500-79887522 CAGAGACAGACGTGGGAGGGAGG + Intronic
1160655693 19:267634-267656 CCGATCAAGGCACGGGATGGTGG - Intergenic
1161124101 19:2546332-2546354 CCCAGCAGGGCCTGGGAGGGCGG + Intronic
1161241267 19:3225096-3225118 CAGAGGCAGGCAGAGGAGGGAGG - Intronic
1161243628 19:3236659-3236681 CTGAGCTAGGCATGGCAGGGAGG + Intronic
1161354849 19:3813341-3813363 ACCTGCCAGGCCTGGGAGGGTGG - Intronic
1161709114 19:5837937-5837959 CAGAGCCCGGACTGGGAGGGAGG + Intronic
1161715228 19:5872492-5872514 CCGAGCCCAGAGTGGGAGGGAGG + Intronic
1161783640 19:6309972-6309994 CCTAGCCAGGCAGGGCACGGTGG + Intronic
1162029160 19:7909947-7909969 CCGTGCCAGCCCTGGGAGGAGGG + Intronic
1162479338 19:10919698-10919720 CTGAGCCAGGCCTGGGAGGATGG - Intronic
1162757171 19:12867356-12867378 CGGAGCCAGGCCTCGGAGGGTGG + Intronic
1162925946 19:13930593-13930615 CCCAGCCAGGCCTGGGTGAGGGG - Exonic
1163118011 19:15200019-15200041 CCGAGCGGGGGAGGGGAGGGAGG + Intronic
1163284479 19:16337989-16338011 CGGAGCCAGGCCTTGGGGGGCGG - Intergenic
1163371305 19:16902752-16902774 CGGAGGCAGGCATGGGGGGCGGG + Exonic
1165350280 19:35271512-35271534 GCCAGGCAGGCATGGGAGTGCGG - Intronic
1165388505 19:35525459-35525481 CAGAGCCAGGGATGGGTGGGTGG - Intronic
1165900341 19:39166749-39166771 CCGTGCCAGGCCTGGGAAGAGGG - Intronic
1166098583 19:40557054-40557076 GCGAGACAGGTATGGCAGGGCGG + Exonic
1166234031 19:41442900-41442922 CTGAGACAGGCAGGGAAGGGTGG + Intergenic
1166296466 19:41892448-41892470 CCGAGCAGAGCATGGGAGTGCGG - Intronic
1166851941 19:45765433-45765455 CAGGGACAGGAATGGGAGGGGGG - Exonic
1167105767 19:47429319-47429341 CCCAGCCACGCCTTGGAGGGAGG - Exonic
1167216825 19:48170656-48170678 CCGGGCCAGGCCTGGGCGCGGGG + Intergenic
1167566981 19:50262742-50262764 AGGATCCAGGCAAGGGAGGGTGG + Intronic
925669385 2:6294553-6294575 CTGAGCCAGGCTGGGGATGGAGG - Intergenic
925919390 2:8628592-8628614 CTGTGCCAGCCAGGGGAGGGAGG - Intergenic
926053771 2:9761706-9761728 CAGAGGCAGGAAAGGGAGGGCGG - Intergenic
927472414 2:23385861-23385883 CCGGGCCGGGCGTGGGAGCGGGG + Intronic
928387664 2:30883992-30884014 CCCAGCCAGGTATGCTAGGGAGG + Intergenic
929588377 2:43130219-43130241 CCAAGCCTGGCATGTGAGGGAGG - Intergenic
930946774 2:57084831-57084853 TGGAGCCATGCCTGGGAGGGTGG + Intergenic
931006099 2:57850823-57850845 CCTGCCCAGCCATGGGAGGGTGG + Intergenic
931336216 2:61346674-61346696 ATTAGCCAGGCATGGGTGGGGGG + Intronic
931625308 2:64251788-64251810 CTGAGCCAGGCTGGGGAGAGTGG - Intergenic
935821513 2:106897495-106897517 CCTAGCCAGGCATGGTGGTGGGG - Intergenic
938383324 2:130848646-130848668 CCAAGCCCGGCACTGGAGGGAGG - Intronic
945117797 2:206426334-206426356 ACAAGCCAGGCATGGTGGGGGGG - Intergenic
946249114 2:218402262-218402284 CCCACCCTGGCCTGGGAGGGAGG + Intronic
947525386 2:230874079-230874101 CCAACCCAGACCTGGGAGGGAGG + Intronic
947714726 2:232333775-232333797 CCCAGCCAGGCCTGGAAGGCTGG - Intronic
948074747 2:235156977-235156999 CCCAGCCAGCGATGGGAGTGGGG + Intergenic
948408175 2:237738520-237738542 CTGAGCAAGGCATGGTGGGGCGG - Intronic
948541027 2:238691529-238691551 CTGAGCCATGCCTGGGATGGAGG - Intergenic
948596392 2:239082251-239082273 CTGAGGCAGGTATTGGAGGGTGG + Intronic
948691267 2:239706613-239706635 CAGAGACAGGCGTGGGAAGGGGG + Intergenic
1168881600 20:1210956-1210978 CAGAGCCAGTCAGGGGTGGGGGG - Intergenic
1171404101 20:24898179-24898201 CCCAGCCAGGCTCGGGAGTGTGG + Intergenic
1172594920 20:36144307-36144329 AGGAACCAGGCAGGGGAGGGTGG - Intronic
1173750046 20:45469665-45469687 CCGAGCGGGGAAGGGGAGGGTGG - Intergenic
1174288041 20:49485794-49485816 GGGAGCCAGGCATGGGAGCCAGG - Intergenic
1174412645 20:50345956-50345978 CCCAGCCAGGGATGGGAGTCTGG - Intergenic
1175292074 20:57882585-57882607 CAGACCCAGCCTTGGGAGGGTGG + Intergenic
1179658735 21:42861474-42861496 CCTCGCCAGGCACGTGAGGGAGG - Intronic
1179892884 21:44345769-44345791 CAGAGCCAGGCCTGGGAGAAGGG + Intergenic
1180069127 21:45427418-45427440 CTGAGGCAGACATGGGAGGCTGG - Intronic
1180726144 22:17948117-17948139 CAGTGGCAGGGATGGGAGGGAGG - Intronic
1180959623 22:19756737-19756759 CCGGGCCAGGTGAGGGAGGGAGG + Exonic
1181489988 22:23255682-23255704 CAGAGCCAGGTGTGGGTGGGAGG - Intronic
1181507392 22:23369071-23369093 GCGAGCCAGGCAAGAGAGTGAGG - Intergenic
1181583878 22:23842420-23842442 GCCAGCCAGGGCTGGGAGGGAGG + Intergenic
1182524224 22:30905753-30905775 CACCGCCAGGCAGGGGAGGGCGG + Intronic
1183099628 22:35575809-35575831 CTGAGCCAGGCAAAGTAGGGGGG - Intergenic
1183513677 22:38250791-38250813 CCGAGCCAGGGCTGGGATGTGGG + Intronic
1184286135 22:43472736-43472758 CCCAGCCTGGCCAGGGAGGGTGG - Intronic
1184688167 22:46105680-46105702 CCCAGCCGGGCATGGGAAGGAGG + Exonic
1184836151 22:47022315-47022337 CCGGGCCATCCCTGGGAGGGAGG + Intronic
1185093017 22:48786448-48786470 GTGAGCCAGGCAGGGGATGGGGG + Intronic
1185167097 22:49268181-49268203 GAGAGCCAGGCAGGGGTGGGTGG - Intergenic
1185181197 22:49364427-49364449 GAGAGCCAGGAAGGGGAGGGAGG - Intergenic
1185205985 22:49539019-49539041 CTTAGCCAGTCATGAGAGGGCGG - Intronic
1185251020 22:49801813-49801835 TGGAGCCAGGCAAGGGAAGGGGG - Intronic
1185299494 22:50072159-50072181 CCCAGTGAGCCATGGGAGGGCGG + Intronic
950656795 3:14441575-14441597 CCGAGCCAGGGAGAGGAAGGAGG + Intronic
950660931 3:14466676-14466698 CCCAGCCCTGGATGGGAGGGAGG - Intronic
952330749 3:32362502-32362524 GAGAGCCAGGAATGGGAGGCAGG + Intronic
952765750 3:36952710-36952732 CCTAGGGAGGCATGGGAGTGGGG - Intergenic
953149336 3:40309993-40310015 GCGCGCCGGGCAAGGGAGGGAGG - Intronic
953335588 3:42091366-42091388 CTGAGGAAGGCACGGGAGGGTGG + Exonic
953762636 3:45702490-45702512 CTGAGCAAGGCTGGGGAGGGAGG - Intronic
953919169 3:46940081-46940103 CAGGGCTAGGCATGGGAGGGAGG + Intronic
954003181 3:47573664-47573686 CAGAGGCAGGCAAAGGAGGGAGG + Intronic
954304150 3:49716732-49716754 TCAGGCCAGGCATGGGAGGCAGG + Intronic
954457417 3:50607442-50607464 AAGAGCAAGGCATGGGAGAGGGG - Exonic
956767566 3:72496790-72496812 GCGAGCCAGGCATGGAGGTGGGG - Intergenic
961458094 3:127034146-127034168 CCGGGTGAGGCAGGGGAGGGAGG - Exonic
961511486 3:127406552-127406574 CCGAGGCAGGCTGGGGAGGAGGG - Intergenic
961669417 3:128518024-128518046 CTGAGCCAGGCAGTTGAGGGAGG + Intergenic
965404273 3:168250118-168250140 CCGAGCCCGGGAAGGGATGGGGG + Intergenic
967222876 3:187263136-187263158 CCGAGCAAAGCATGAGATGGAGG + Intronic
967318983 3:188177275-188177297 CAGACCCAGGCCTGGGAAGGAGG + Intronic
967930421 3:194686736-194686758 CCGAGCCTGGCAGGGGCCGGTGG + Exonic
968085869 3:195873662-195873684 CCCAGCCAGGCCGGGGAGAGAGG + Intronic
968461938 4:730546-730568 CCGAGCCAGGCTTGGCACCGCGG + Intronic
968962520 4:3752775-3752797 CTGAGCCTGGCCTGGCAGGGAGG + Intergenic
968968895 4:3783394-3783416 CTGTGCCAGGGCTGGGAGGGAGG + Intergenic
969275768 4:6134848-6134870 TCAAGCCTAGCATGGGAGGGTGG + Intronic
969308357 4:6338394-6338416 CTGAGCCAGGGATGGGGGTGGGG - Intronic
973639237 4:52886593-52886615 CCTAGCAAGGCCTGGGAGTGGGG + Intronic
975460849 4:74651262-74651284 GAGGGCCAGGGATGGGAGGGAGG + Intergenic
975614591 4:76234116-76234138 CCCAGGCAGGGAGGGGAGGGTGG + Intronic
975647923 4:76564088-76564110 CAGAGCGGGGCATGGGAGGGTGG - Intronic
976043674 4:80918762-80918784 TAGAGGAAGGCATGGGAGGGAGG + Intronic
979253566 4:118589705-118589727 CTGAGGCAGGCTTGGGAGGGTGG - Intergenic
981059379 4:140404951-140404973 CCATGCCAGGCATGGTGGGGAGG + Intronic
981288818 4:143050315-143050337 CCAAGCAAGGCATGGAAGAGTGG - Intergenic
981539001 4:145828766-145828788 CCAGGCCAGGCATGGGATGTGGG + Intronic
982357987 4:154490541-154490563 CAGATCGAGGCATGGGACGGCGG - Intronic
983513061 4:168629625-168629647 CCCAGGAAGGGATGGGAGGGTGG - Intronic
984587327 4:181579036-181579058 CCCAGGCAGGGATGGGAGAGGGG - Intergenic
985507594 5:292726-292748 CCGAGTCAGGCAGGGGTGGCAGG + Intronic
985658474 5:1143986-1144008 CCGAGCCAGCCAGGGGTAGGAGG - Intergenic
985846599 5:2354178-2354200 GCCAGCCAGGTGTGGGAGGGTGG - Intergenic
986306933 5:6523030-6523052 CTGAGGCAGGGATGGGAGGTCGG + Intergenic
990316942 5:54591524-54591546 CAGAGCCATGCAAGGGAAGGTGG + Intergenic
991916740 5:71613027-71613049 TGGAGGCAGACATGGGAGGGAGG - Intronic
992407816 5:76476221-76476243 CAGAGGCAGGCCTGGGAGGAAGG + Intronic
996597532 5:125222692-125222714 CCTTGCCAGGGATGGGAGGTGGG - Intergenic
997239383 5:132295354-132295376 TCCTGCCAGGCATGGGAGGAGGG + Intronic
998220065 5:140270241-140270263 GGAATCCAGGCATGGGAGGGTGG + Intronic
999144214 5:149381838-149381860 CAGTGCCAGGCCTGAGAGGGAGG + Intronic
999451447 5:151681236-151681258 CCGAGCCAGGCAGGCCAGAGAGG + Intronic
1000021484 5:157322708-157322730 CAGTGCCAGGCATGTGATGGGGG + Intronic
1001288881 5:170442556-170442578 CAGAGCCAGACAGGGCAGGGCGG - Intronic
1001661550 5:173396954-173396976 CCACGGCAGGCAGGGGAGGGGGG + Intergenic
1002475346 5:179461982-179462004 CGGTGCCAGGCATGGGGTGGAGG - Intergenic
1003565318 6:7217153-7217175 CCGAGATGGGCAGGGGAGGGTGG + Intronic
1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG + Exonic
1005987860 6:30885253-30885275 AAGAGCCAGGCATGGGGGGGTGG - Intronic
1006047193 6:31308104-31308126 CGGGGCCAGGGAGGGGAGGGAGG + Intronic
1006105741 6:31715292-31715314 CAGAGCCGGGCTGGGGAGGGGGG + Intronic
1006725422 6:36196559-36196581 CCGCGCCAGGCACGGGCGGGGGG + Intergenic
1007720848 6:43884755-43884777 CAGGGGCAGGCAGGGGAGGGAGG - Intergenic
1011135714 6:84098109-84098131 CAGAGAAAGGGATGGGAGGGAGG - Intergenic
1013110946 6:107064648-107064670 ACTAGCCAGGCATGGTAGTGTGG + Intergenic
1013208553 6:107966387-107966409 CAGAGCCAGGCAGGGGAGTGGGG - Intergenic
1014191461 6:118501248-118501270 CTGGGCCTGGCATGGGAGGTGGG - Intronic
1015581506 6:134730222-134730244 CAGAGCCAGGCAGGAGGGGGCGG + Intergenic
1018144140 6:160867014-160867036 TCAAGCCAAGGATGGGAGGGTGG - Intergenic
1018359713 6:163054924-163054946 CCAGGCCAGGGATTGGAGGGAGG + Intronic
1018635273 6:165854796-165854818 GCGCGCCAGGCAGGGCAGGGCGG + Intronic
1018770938 6:166970998-166971020 CCCGGGCAGGCATGGGAGTGAGG + Intergenic
1018945837 6:168346156-168346178 CAGAGCCAGGCCGGAGAGGGAGG + Intergenic
1019559835 7:1650548-1650570 CCGAGCCAGGCAGATGAGGCTGG + Intergenic
1019567629 7:1692403-1692425 CCGGCCCAGGCTTGGGAGAGAGG - Intronic
1019638115 7:2087642-2087664 CTGACCCAGGCCTGGCAGGGCGG + Intronic
1019729034 7:2620224-2620246 CTGAGCTTGGCATTGGAGGGTGG - Intergenic
1021948729 7:25753742-25753764 CCGAGCCAGGCAAGGGAGCCGGG - Intergenic
1022043407 7:26602428-26602450 CAGTGCCAGGCATAGGATGGGGG + Intergenic
1023850603 7:44147918-44147940 CAGAGACAGGCATGGGGGAGCGG - Intronic
1023873523 7:44275134-44275156 CTGAGCCAGGGAAGGGAGGGAGG - Intronic
1026850128 7:73718963-73718985 CCGCCCCAGGTATGGGGGGGGGG - Intronic
1027053142 7:75032204-75032226 CAGAGCCAGGCCTGGGAGTGGGG + Intronic
1027163941 7:75821594-75821616 CCGAGGCAGGCAGGGCAGGTAGG + Intronic
1029249700 7:99226968-99226990 GGGACCCAGGCTTGGGAGGGTGG + Intergenic
1029439678 7:100580087-100580109 GTGAGCCAGGCATGGCAGGAAGG - Intronic
1029607692 7:101609047-101609069 CGGAGCCAGGCTTGGGGTGGAGG + Intergenic
1029810049 7:103038146-103038168 CCGAGCCAGGCATGGGAGGGAGG - Intronic
1031105035 7:117530307-117530329 CAGAGCTGGGAATGGGAGGGAGG - Intronic
1032094673 7:128932100-128932122 TCGAGACAGGCATGGGTCGGTGG + Intergenic
1032181005 7:129677863-129677885 CTAATCCAGGCATGGGAGTGGGG + Intronic
1033671841 7:143500538-143500560 GGGGGCCAGGCAGGGGAGGGAGG + Intergenic
1033681971 7:143603691-143603713 CTGATCCAGGCATTGCAGGGAGG - Intergenic
1033702919 7:143858222-143858244 CTGATCCAGGCATTGCAGGGAGG + Intronic
1034254267 7:149715696-149715718 CCGAGGCAGCCATGGATGGGGGG + Intronic
1034345727 7:150384154-150384176 CAGGGCCAGGCGTGGGAAGGGGG + Intronic
1035455714 7:159007382-159007404 CCCAGCCACGCTGGGGAGGGCGG + Intergenic
1035522805 8:288807-288829 CAGTGCCAGGCATCGCAGGGTGG - Intergenic
1036025213 8:4900103-4900125 AAAAGCCAGGCATGGGAAGGTGG - Intronic
1036184570 8:6612656-6612678 CCAGGCCAGGCAGGGGAGGTCGG - Intronic
1036239465 8:7069954-7069976 CCGAGAGAGGCAAGGGAAGGGGG + Intergenic
1038720313 8:30028962-30028984 CAGAGACAGGCATGGGAAGGAGG - Intergenic
1038777840 8:30546915-30546937 AAGAGCCAGGCCTGGGAGGCAGG - Intronic
1041693592 8:60714074-60714096 CAGAGCCAGGCCTCGGCGGGCGG + Intronic
1042560845 8:70071265-70071287 CTGAGCCAGGCTTAAGAGGGCGG + Exonic
1044498267 8:92917881-92917903 CAGAGCCAGGGATGGGAAGTGGG - Intronic
1044930682 8:97248851-97248873 CTGAGGCAGGCCAGGGAGGGAGG - Intergenic
1045432196 8:102124345-102124367 GCGAGCCAGGCTGGGGAGGGGGG - Intronic
1047757012 8:127926616-127926638 CAGAGCCAGGCAAGGGAAGGAGG - Intergenic
1048803370 8:138215783-138215805 CTGAGCCATTCATGGGTGGGAGG - Intronic
1049385539 8:142341268-142341290 CCTGGCCAGGCCTGGGGGGGTGG - Intronic
1049749532 8:144276712-144276734 CCGAGCCCCGCCTGGGACGGGGG + Intronic
1055906300 9:81297246-81297268 ATGATCCAGGTATGGGAGGGAGG + Intergenic
1057413278 9:94838155-94838177 ATGAGCCAGGCATGGGTGGCGGG - Intronic
1057832899 9:98420268-98420290 CTGAGCCAGGCATGGGACAACGG - Intronic
1058551523 9:106120347-106120369 CCGAGGCAGGCATGGAAGGAAGG - Intergenic
1058896965 9:109408898-109408920 GCGAGCGAGGCCTGGGAAGGGGG + Intronic
1059330037 9:113529079-113529101 GAGAGGCAGGCATGGGAGGCAGG - Intronic
1059405700 9:114097431-114097453 CCGAACCTGGGAGGGGAGGGAGG + Exonic
1059414861 9:114156207-114156229 CCGGGCCAGGCGCGGCAGGGCGG - Intronic
1059438432 9:114289747-114289769 CCGAGGCAGGCAGGTGAGGGGGG - Intronic
1060883554 9:127135298-127135320 CAGAGACAGGAATGAGAGGGTGG - Intronic
1061000509 9:127899647-127899669 CCGGCCCAGGCCTGGGAGGTGGG + Intronic
1061275908 9:129569235-129569257 CGGGGCCAGGCCAGGGAGGGAGG + Intergenic
1061948522 9:133922178-133922200 CCCAGCCAGGCATAGCAGGTGGG - Intronic
1062425023 9:136502156-136502178 CCGGGCCTGGCGTGGGAGGTGGG + Intronic
1185504025 X:619163-619185 CGGGGCGAGGCAGGGGAGGGCGG - Intergenic
1185835028 X:3337681-3337703 CAGAGCTGGGCAAGGGAGGGAGG + Intronic
1187165466 X:16800536-16800558 CCGAGCCAGGCCTGGAGAGGAGG + Intronic
1187960148 X:24560291-24560313 GCCAGCCAGGCAAGGGAAGGTGG - Intronic
1189272211 X:39759624-39759646 CCAACCCAGGAAGGGGAGGGTGG - Intergenic
1192178649 X:68901707-68901729 TAGAGGCAGGGATGGGAGGGTGG - Intergenic
1192555994 X:72089675-72089697 CCAAGCCAGGCTTGGGAGCTGGG + Intergenic
1193999912 X:88415182-88415204 CCTCCCCAGGCATGGGAAGGGGG + Intergenic
1194294855 X:92114978-92115000 CCCAGCCGGGCATGGTAGTGGGG - Intronic
1195108722 X:101624314-101624336 CCTAGCCTGAAATGGGAGGGAGG - Intronic
1195668328 X:107449852-107449874 CCGAGCCCGGCATGGGCTTGGGG - Intergenic
1197712172 X:129679148-129679170 AGGAGCCAGGCAGGAGAGGGTGG - Intergenic
1199755968 X:150865347-150865369 ATTAGCCAGGCATGGCAGGGTGG + Intronic
1200141174 X:153903848-153903870 CCAAGCCAGGCCTGGGTGCGGGG + Intronic
1200400477 X:156016984-156017006 CCGATCAAGGCATGGGATGGTGG - Intergenic